Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL514h03ex.5.5                     3196 END     2           0        0                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7019480.5                    1311 PI      82        105     1181                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8822982.5                     817 PI      86         66     1182                (no blast hit)
     4   0.0    0Xl3.1-XL500b13ex.5                        788 PI      93          2     1640                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8532730.5                     754 PI      82        117     1182                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8744002.5.5                   723 PI      81        105     1182                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6875891.5                     597 PI      81         75     1181                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:7203686.5                     155 PI      80         87     1182                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:8527148.5                       8 PI      77         78      734                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012767030 Xl3.1-XL485j12ex.5 - 1077 ESTs
                                                                       ......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL485j12ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCGTTTTAGATGTCCAGAGGCCCTCTTCCAGCCATCTTTCCTTGGTATGGAATCCTGCGGTATTCATGAAACCACTTACAACTCAATTATGAAGTGTGATGTAGATATCCGTAAGGACCTCTATGCCAATACTGTTCTGTCTGGTGGTACCACAATGTACCCAGGAATTGCTGATAGAATGCAGAAAGAAATAACTGCACTAGCCCCCAGCACCATGAAAATCAAGATAATTGCCCCCCCTGAGCGTAAATACTCTGTCTGGATTGGTGGCTCCATCTTGGCTTCCCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGATGAGTCTGGCCCCTCAATTGTCCACCGTAAATGCTTCTAAAGGACAGACCCTTTCAACATGAACAAATGTACCTGTGCAGGAAGATCACATTGGCATGGCTTTACTCTTTTGTTGGCGCTTGGCTCAGAATTGATAACTGGAATGAACAAAATAGCACTGTATGGTCATCAATGCATCTGAGGACATTATGATTTTATTCAGTCAATAGTATTGTACTGAGGAAGCTACCCTCTCAGTGTTGCCCAGCTTGGTGGGAGCTCTTGCAGAAATCATGTTGATACTATTGGTTTTTGTTTTCTCGTGCAGCTATGTACCCAAACATGTCTCTGTATCTTCTGCCTTGAACACTTGTAACTTGTTTAACCACCCAAAGTATGGGGCTCATTCTCTTTAACATCTGGAAGGTTTACATTATCATTGATCACATAAGATGTGACTGGTCACCTGTAACCTAACTGAAAAAATAAAACTTATGTTGTTTCAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012684926                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCGTTTTAGATGTCCAGAGGCCCTCTTCCAGCCATCTTTCCTTGGTATGGAATCCTGCGGTATTCATGAAACCACTTACAACTCAATTATGAAGTGTGATGTAGATATCCGTAAGGACCTCTATGCCAATACTGTTCTGTCTGGTGGTACCACAATGTACCCAGGAATTGCTGATAGAATGCAGAAAGAAATAACTGCACTAGCCCCCAGCACCATGAAAATCAAGATAATTGCCCCCCCTGAGCGTAAATACTCTGTCTGGATTGGTGGCTCCATCTTGGCTTCCCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGATGAGTCTGGCCCCTCAATTGTCCACCGTAAATGCTTCTAAAGGACAGACCCTTTCAACATGAACAAATGTACCTGTGCAGGAAGATCACATTGGCATGGCTTTACTCTTTTGTTGGCGCTTGGCTCAGAATTGATAACTGGAATGAACAAAATAGCACTGTATGGTCATCAATGCATCTGAGGACATTATGATTTTATTCAGTCAATAGTATTGTACTGAGGAAGCTACCCTCTCAGTGTTGCCCAGCTTGGTGGGAGCTCTTGCAGAAATCATGTTGATACTATTGGTTTTTGTTTTCTCGTGCAGCTATGTACCCAAACATGTCTCTGTATCTTCTGCCTTGAACACTTGTAACTTGTTTAACCACCCAAAGTATGGGGCTCATTCTCTTTAACATCTGGAAGGTTTACATTATCATTGATCACATAAGATGTGACTGGTCACCTGTAACCTAACTGAAAAAATAAAACTTATGTTGTTTCACAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             39   121   155   257   355   462   411   492   454   502   473   511   483   516   482   518   485   518   489   520   514   523   515   527   516   528   516   526   522   532   525   534   528   539   532   547   536   549   536   552   538   553   542   557   547   557   543   557   546   558   545   556   549   561   553   563   548   564   544   563   547   563   545   562   548   562   553   568   553   572   554   576   556   576   556   576   549   576   548   577   548   579   553   584   553   584   529   585   535   583   539   586   519   587   535   587   528   589   510   586   514   586   503   585   476   583   451   581   440   579   396   581   382   582   342   571   328   569   310   564   257   531   228   516   209   506   171   492   156   467   135   456   145   444   145   446   152   450   142   448   166   444   175   447   231   460   257   446   280   446   295   435   298   426   306   420   321   418   325   416   335   414   332   410   341   414   343   414   334   410   352   410   351   411   356   414   367   423   366   429   370   440   382   442   390   444   394   444   398   452   401   452   396   451   391   447   387   446   393   444   396   443   393   443   396   443   391   442   395   440   388   437   394   438   401   434   407   435   403   434   407   436   407   434   410   434   404   433   406   433   406   431   404   433   404   432   402   432   401   427   401   425   399   424   394   421   393   420   390   418   388   417   382   417   374   416   370   413   364   411   351   399   225   318   148   259   112   222    97   152    23    80    12    35
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                               BLH ATG      53    3929                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      53     403                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MPR      50     403                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      53     117                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      53      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      13      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      53      10                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
  5   1   2       bld Sp1                             IMAGE:5511616.5p TTGTTTTGCTAAGTAGATGGGACATTGTCTTGCAGGATTCAGTTTATTCTCCTCAAGCAGGTCTAAATATGGAGAGGAGGGGCCCCTGGTAATGCAGAAAGGTTGGGGCCCTTGAATGAGGGGGATATGCAGAGTGTTGCAGTACAACTACAGCTGGAGAGTTGTCAGTTGGACATCGCTTTTCTTTATATGTGTGTCTATATTAAAGATATCTTAGTGTTTGTAACACAGTATGATATGCTGTTTGTGCTTTTAGCTATGTTTTTCTCTAAAGGGCCCCAAGCACCAGGGGCCCAGGGAAATGATTTTGTATAAATTCAATAAAAACAAATGTAATTTACCAGATTTACATCATAAATGAATAACAATATTTGCTCTATCTGTATGAAATAGTGAGGGAGAGTCACCATGTTAACTATGCCATGGAGAAGTTCCTGGCCATCCACATTTACAGAAAAGAACAAGAGCTGCCATGTTGCTTGCTTTTTAATACGGTTTTCTCCAAGGACTGTCATCAAACAGCCGGACGCGTGGGCGGACGCGTGGGTAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCNCGTGCTGTTTTCCATCTATTGTGGGTCGCCCAGACATCAGGGTGTCATGGTTGGAATGGGANCAAAGATAGCTATGTAGGAGATGAAGCTCANAGCANAAGAGGTATTCTT
  5   1   2       bld Tad2 5g                         IMAGE:6931532.5p                                                                                                                                                                                                                                                                                                                                                                                                                     GCGTAGTCCACCCAAAACACGAGCGCGGAGTCGACAGGAGAAGCGCCCGCATAACTTCTATATATACTTAACAAGTTATCATCGCGCCCCGATCATATGGCGGAAATGCCCCATTACGGGCGAAGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACANTGGAAGACGATATTGCCGCACTGCTCGTTGATAATGGTCTGGTATGTGCAAAGCCGGCTTTGCTGGGAATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCNAGACATCANGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGNATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCNNCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGGTTCGNTGATATCAAGGGAAAAATTNGTGCTATGTTTGGCTCTGGAA
  5   1   2       chi Int2                            IMAGE:8526902.5p                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGGCCACCATAATGGNAGGTGCATGATACAATTCGTCCCGGAATGGTGCAAACCCACGCGCCCTCTGCTGACTGAACTTGCGCAATGCAACAGACTGACAGGAAGTGCTGGGCTACAGGAGCCCCTGTCTGTGTTGGGCGGGTCCTCACCTCCAATCTAATTCTCTTTTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATTGAAATCCTAACTGAGAGGGGGTACAGCTTCA
  5   1   2       bld Spl  5g                         IMAGE:8462882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAATNNNNCACATGAGCTCNNAGAAGAAGCATCAATAAAAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCCCACAGCCCAAGAAAAATCCTTCGTGATATCAGGAGAATTGTGCTAGTTGCTCTGACTTGAACAGAAATGCCCCGCTGCTCTTCTCTCTTGGAAAAACTTGACTGCTGACGAAATCTCCCATTGTACAGGTTTTATTCCAG
  5   1   2       bld Spl  5g                         IMAGE:8463870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATATGNNCCTAGACTTACCTNGNNGATCCATCGATATGAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGATAGAGAAATTCGTTCGTGATATCAAGGAAAAATTGTGCTATGTTGCTCTGG
  5   1   2       bld Spl  5g                         IMAGE:8461533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTAAAAAANNNNCCCGACTCNNNGAGATCATCAATTAAATTCGTCCCCGCCCGCATGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAAGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCT
  5   1   2       chi Int2                            IMAGE:8529275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAANCCACAGATGTCGNNGGGGGGCCATCAATAAAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACAGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCGCCAACTGGGATGATATGGAGAAGAAGGGGCGTCACACCTTCTACAATGAACTGAGAGAGGCTCCAGATNAACACCCTCTGCTGCTCACACAATCACCCCTTATTCCTATATCTAACACGGATAAGATGACACAGATAATGTTCGAGACCTTTAACACTCTTGCTATGTATGTTGCCATCCTTGCTGTGTTTTCCCTGTATGCATCTGGTCTTACCTCTGGTATTGTCATGTACTCATGTGATGGTGTAACCCTCTCTGTGCCCATATTTTATGGTCATGCTCTACTCCTTTCTTTTCTGCTGCTGGATTCGTCCGGTCGCTGACCTACATATTTTCTTTTATTCTCTTTTCTGGAGGTGTTTAGCTTCCGTGCTTGCTTTTTATATTCTTCTCGATTTATGGTAAtttttgctttttctcttttttttCGTAATGCCCATTTCCTCTCTCTTTATGTATTTCTGTACTCTTATATCTGTA
  5   1   2       bld Int2 5g                         IMAGE:8821891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGAAGGGGAATTGAGGGCCAAATCGGTGTTTTCTTATTCGTCCCCGCCCGCATAGAAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGAACAGTCATCACAATGGTAACGAGCCGTTTTAGATGTCAGAGTCCTTCTTCAGCATCCTTTCTTGTATGGAAATCCTGCGTAATCCATGAACCCACTTACAGCCTCAATATGGAACCTGTGAATGTGTAAATATTCCGT
  5   1   2       bld Int2 5g                         IMAGE:8821115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCGCCGTTACCATAGGGAGCCCCACCCGCTACGAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATGGTACGAGCGTTTAGATGTCAGAGGCCCTCTTCAGCCATTCTTTCCTTGGTATTGGAATTCCTGGCGGGTATTTCATGA
  5   1   2       bld Tad1 5g                         IMAGE:6877849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGCATAAAACCGGCGGCCGAGCCCAAACCTCGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGAACTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAAGAGAAATCGTTCGTGATATCAAGGAGAAAATGGTGCTATGTTGCTCTGGACTTTGAAGCA
  5   1   2       bld Tail 5g3  in                    IMAGE:8542386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGNNNNNCCAGCTATTTNGNGNAGTACCTAATAATATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAAATTGTGCTATGTGCTCTGGACTTGAGCAGAGAGGCACAGCTGCCTCTCTCATCTTGGAAGAGCTTGACTGCTGACGACAGTCTCACATTGTACGACGTTAGATGTCAAGCCTCTCAGCATCTTCTTGTAGATCTGCG
  5   1   2       bld Int2 5g                         IMAGE:8526888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAANCCATCTATTANNGGAAGTACATCAATAAAAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAAGGGGTACAGCTTCACCACCACAGCCCGAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTG
  5   1   2       bld Spl  5g                         IMAGE:8461965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAANTNCCATGCTTTTNNNGNAGATCCATCGATACGAATTCGTCCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAANGAGAAAATGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCACAGCTGCCTCTCNTCATCATNGNAAAGAGCTATGAGCTGCTGAC
  5   1   2       bld Thy  5g3  in                    IMAGE:8550839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAACTACGACATAGGATTCAAAACGGAGTTTCGTATTCGTCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCATCATTGGTAACGAGCGTTTTAGATGTCCAGAGGCCTCTCAGCCATCTTTCCTTGTATGGAATCTGCGTATCATGAACACTTACACTCAATTATGATGTGATGTAGATTCGTAGACTCTTTGCATACTGTCTGTCGTGTACCCATGTACCAGGATGCTCGATAGAATGCAGAAGATATACTTC
  5   1   2       bld Thy  5g                         IMAGE:8547671.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATATTTTATTGAAGGGAAAAATTTTTTTAAAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAAGAAGATGGCCAC
  5   1   2       bld Spl  5g3  in                    IMAGE:8463902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACAAAANNNNCTCATCGCTTANNNNGAGACCATCAATAGAATTCGTCCCTGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACT
  5   1   2       chi Int2                            IMAGE:8527556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATATNNNNCCTTCTGTCTTCGTNTGAGGCTCCATCAATTCAATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAATACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACTCTCAAATATCCAATTGAACATGGCATTGTCTCCTACTGGGATGATATGGAGAATATCTGGCATCACACCTTCTATCAATTGAACTGCGATTGGCACCTGAATAACACCCTGTGCTGCTCACAGAATCACCCCTTAATCCTAACTCTACCTGGGAGAATATGACACATATCAAGTTCTAGACCTTTAACACTCTTTTCTATGTATGTAGCCACCCAAACTGTTCTTGCATTGTATGAATCAGGACATACCACTGGTATTGTCTTGCACTCAAGTGATTGTGTCTGCAATCGTGTTCTATTATTTGAACAGTTATTCTTTTCCTTATGttttttttATCTTCGACTTGATTGTGTTTATCTTTTCCGATTCCTCTTTATGACTCTATCCGTTGTGTGTAACTTTTATCATTCATCAATATAAAATGTTTCCTTTATCTCATAACTTTAGGTTATTTTTATCATTTTAG
  5   1   2       bld Thy  5g                         IMAGE:8547163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAATNNNNNCCATATGGGCTTNNNGCGAGTCATATATATGTATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTG
  5   1   2       bld Thy  5g3  in                    IMAGE:8550911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACTGCCATTTGCACCTGAAATCGTTTCGTATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATTGGTACGAGCGTTTTAAATGTCAGAGGCCTCTTCAGCATCTTCTGGTATGGATCTGCGGTATCATGAACCACTACAACTCATTATGATGTGATGTAGATTCGTAGGACTCTATGCATATGTTCTGTTGGTGTACTC
  5   1   2       bld Int2 5g                         IMAGE:8824807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCCGCTTTATTCAATAGGAGCTCGCCGCTTCGAATTCGTCCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGATGGACAAGTCATCACCATTGTACGAGCGTTTAGATGTCAGAGCCTCTCAGCATCTTTCTTGGTATGGAATCCTGCGGTATTCCATGAAC
  5   1   2       bld Thy  5g3  in                    IMAGE:8550663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATAGTTTTTTACAAGAGTCCTCGCCTCGTTTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGATGGACAGTCATCACCATTGGTACGAGCGTTTAGATGTCCAGAGCCTCTTCAGCATCTTTCCTTGGTATGGAATCCTGCGTATCATGAAACACTTACACTCATATGAGTGTGGATGTAGATATCGTAGACCTCTATGCATACTGTTCTGTCTGGTGTACCATGTACAGAATGCGTTATGCAAAGAATACTGGCTAGCCCAGACCATGAAATCAGATATTGCCCCTGGAGCGAAATCTCTGTCTTGAAT
  5   1   2       bld Int2 5g3  in                    IMAGE:8822909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAGATGTTTTAAAGATGACATAAGATTCGAATTCGTCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCTGACGGACAGTCATCACCATTGTACGAGCGTTTTAGATGTCAGAGCCCTCTCAGCATCTTCCTGTATGGATCTGCGTATCATGAATCACTACACTCAATTATGGATGTGATGTTAGAATATCCGTAA
  5   1   2       bld Int2 5g3  in                    IMAGE:8820764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCATGATCATATTAGGACAAAATATTCGAATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCTGACGACAGTCATCACCATTGGTACGAGCGTTTAGATGTCAGAGCCCTCTTCAGCATCTCCTTGTTGATCTGCGAATCATGATCACTACACTCATTAGAGGTGTGATGTAAAATATCCGGTAAAGGA
  5   1   2       bld Tail 5g                         IMAGE:8543473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAATNNNNCCTCTAGACTGGGAGAAAGAACTAAATAATATTCNTCCCGAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGNAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTGGACA
  5   1   2       bld Spl  5g3  in                    IMAGE:8463456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATTNNNCCCAGCGTTTNNNGNAGATCCATAAATTAAATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAA
  5   1   2       bld Int2 5g                         IMAGE:8823703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTTTTATTGACGATTCATAAGATTCGAATTCGTCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAACACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGTACAGCTTCACCACCACAGCCGAAGAGAATCGTTCGTGATATCAAGGAAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGACAGTCATCACATTGGTACGAGCGTTTACATGTCCGAGCCTCTTCAGCTCTTCTTGGTATGGATCTGCGTATTCATGAACACTACACTCATTATGATGTGATTAAATTCCGTAAGACTCTATGCAAACTGTTCTGTTGGTGTACAATGTACAGGATGCGAGATGCAAGAATCGCTAGCTACATGATCAAATGCCCTGAAGAAACTGTCTGGAATGGACCTTGTTCTCTCTCTC
  5   1   2       bld Spl  5g                         IMAGE:8462767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATTGNNNCCAGACTTANNNGAGATCATCAATTAAATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTGAGCAGAGATGCCACAGCTGCCTCTCTCATCATTGGAAGAGCTATGACTGCTGACGACAGTCTCACATTGTAACACGTTTAAGTCAAGCCTCTTCACTCTTCTGTATGATCTGCGTATCTGACCTNA
  5   1   2       bld Int2 5g                         IMAGE:8825271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTACCAATTTAATAAATTACTTGGAAAATTTAACATATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCTCTTCTTCATCATGGAAAAGAGCTATGAGCTGCTGACGACAGTCATCACCATGTACGAGCGTTTAGATGTTCAGAGCCTCTCAGCATCTTCTGGAATGGATCTGGCGTATCTGATCATTCACTCATTAGGATGTGTATGTGAATTCCGTTAAAGGAACT
  5   1   2       bld Int2 5g3  in                    IMAGE:8821647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCCCCTGATTACCAGAGGATCCCATAAAATACGAATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCTGACGACAGTCATCACCATTGGTACGAGCGTTTAGATGTCAGAGCCTCTCAGCATCTTCTGTATGGAATCTGGCGGTTATTCATGAAACACTACAAACCTCAATT
  5   1   2       bld Int2 5g                         IMAGE:8531145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATNNGNNCCAGCTATTNNGAGATGCTCGATAGNATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACACCACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAATTGTGCTATGTGCTCTGGATTTGAGCAGAGATGGCACAGCTGCCTCTCTTCATCATTGAAGACTTGACTGCTGATGACAGTCTCACATTGTACAGCTTTAATGTCGAGCTCTCAGCTCTTCTGTATGACGCGTTCTGAACATAACCATA
  5   1   2       bld Thy  5g3  in                    IMAGE:8550683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGACATTGAGATCTATCACTTCGATTCGTCCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACATTGGTACGAGCGTTTTAGATGTCAGAGCCTCTTCAGCATCTTTCCTTGGTATGGATCCTGCGTATTCATGAACACTACACTCATTATGATGTGGATGTAAATTCGTAGACTCTATGCATACTGTTTGTTGGTGTACCCATGTACAGATGCGTGATGCAAGAATACTGCATAGCCCAGCCTGAAATCAGAATTGCCCTGAGCGAATATCTGTCGGGATGTGGTA
  5   1   2       bld Thy  5g                         IMAGE:8547697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAGTTTTTTTATTCAAACCAATCACATTTATAAATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGTACAGCTTCACCACCACAGCCGAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld Tail 5g                         IMAGE:8545725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATNNNNCCACGCTTAANAANAAGAACTAAATAAATTCGTCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAGAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCACAGCTGCTCTTCTCATCATGGAAAAGACTATGACTGCTGACGACAGTCTCACATGGTACGACGTTTAATGTCAGAGCCTCTCAACATCTTCTGTATGATCTGCGATCTGAACC
  5   1   2       bld Lmb1 5g                         IMAGE:8534380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATTACCCATGTTNNNNTGGGATTCATGATTGAATTCGTCCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTC
  5   1   2       bld Tail 5g                         IMAGE:8543879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATNNNNCCATTCTGCNGNNAGAAGTACCTAAATAAATTCGTCCCAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTACTGAGAGGGGGTACAGCTTCACAACCACAGCTGAAAAGAAATCGTTCGTGATATAAAGAGAAATGTGCTATGTTGCTCTGACTTGAGCAGAAATGCCCCACTGCCTCTCTTCTCTTGAAAAAACTTAACTCCTGAGGAAAGTCTCCCATTGTACAAC
  5   1   2       bld Int2 5g3  in                    IMAGE:8820836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGTATTATATATGATCTCATTCGCATTCTTATTCGTCCCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAAGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTTATGTTGCTTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTTCTTCTTCATCATTTGAAAAAGAGCTTATGAGCTGCCTGACGACAGTCATCCACCATTGGTTACGAGCGTTTAGATGTTCAGAGGCCTTCTTTCAGCATCTTTCTTGTATGGATTCTTGGCGTATTTCATGGATCACTTACACCTCCATTATTGATGTGTGAATGTTAAATATCCGGTTAAGGAACCT
  5   1   2       bld Int2 5g                         IMAGE:8529254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATNNNNCCAATGTCTTGGGNGAGAGCATCAAATAAATCGTCCCAAGGAGACAGTCTGTGTGCGTCCACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTACTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTTCCCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTGAGCAGGAGATGCCACAGCTGCCTCTTCTTCTCATGGAAAGACTAG
  5   1   2       chi Thy                             IMAGE:8546978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATAAATTCANTGCCATACAATATACGATTCGTCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCTATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAATAACACCCAGTGCTGCTCACATAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCACTGTACGCATCTGGTCGTACCACTGGTATTGTCATGTACTCAAGTGATGGTAGTAACCACACTGATGCTATATATGAATGCTATGCTCTACCACATGCCAATCTGCGTCTAGACTTGTCTTGACGTGACCTGACAGACTACCTCATGAAATTCCTAACTGAGAGTGGGTACACTACATCACCACATCCTATTGAATATCGTTCTAGTATCCACGTCATTCGTGTATGTTGCTTTGACTTGAGCAAGATAAGCACAACTGCTCTCTATTCATTGAAACACATAGACTGCTGACGATATCTTCTCTTGTACTTTCGTTGATGACAGTCTATCTATCTCTACTAGATTGACTCTTATATGAACTATATG
  5   1   2       bld Int2      in                    IMAGE:8823653.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCAGAAATTTAAGGGATTTATCAAATTCGATTCGTCCCAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCTCAGCTGCCTCTCTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGACAGTCATCACATTGTTACGAGCGTTTTAAATGTCGAGGCCTCTTCAGCATCTACTGTTGGATCTGCGTTTCTGAACACTACACCATAGATGGATGTAATCGTAGACCTCTGCCATCTGTCGTGGGTACATGACTGATGCGAATGCAGACGTTCGCAATGCTCGACTGATCGATTGCCCTGAGCAATCTCGGATGGCCTGTCCGTCCTTCCGATGG
  5   1   2       bld Int2 5g3  in                    IMAGE:8823181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAACTAGTTTACTTATTTCATCATATTCTTATTCGTCCCAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGACAGTCATCACATTGGTACGAGCGTTTAGATGTCAGAGGCCTCTCAGCATCTTTCCTGGTATGGATCTGCGGTATCATGAAACACTTACACTCATATGACTGTGGATGTAGATTCGTAACGACTCTATGCCA
  5   1   2       bld Spl  5g3  in                    IMAGE:8463481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAATTCTCCATACTCTTGNNGGAAATAAATAAATANNNNTGTCCGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTAACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAA
  5   1   2       bld Int2 5g                         IMAGE:8529144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATNNNTCTCATTGTGTCGTTTGAGATCCATCAATATCATTCGTCCCGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAAATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCATCTGGACTTGACTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAAGGAGAAATTGTGCTAGATACTCTGGACTTAGACAGGAGATGGCACAGCTGCCTCTTCTCATCTTGGAAAGAGCA
  5   1   2       bld Thy  5g3  in                    IMAGE:8548965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCTTTTGGGGTAGGTATCGATTCGTATTCGTCCCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGATGGACAGTCATCACCATTGGTAACGAGCGTTTAGATGTCAGAGGCCCTCTTCAGCCATCTTCTGTATGGATCTGCGTATCATGAACACTACACTCATATGAGTGTGATGTAGAATATCCGTAGGAACCTTC
  5   1   2       bld Int2 5g                         IMAGE:8824877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGGCCCAGAGTGCAAATAGTACCGCACCCCATTCGAATTCGTCCCACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGATGGACAGTCATCACATTGGTACGAGCGTTTAGAATGTCAGAGCCTCTCAGCATCTTTCTGTATGGAATCCTGCGTATTCATGAAACCACTTACAACTCAT
  5   1   2       bld Thy  5g3  in                    IMAGE:8550958.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCGGGTAATAAGACCAGGCTCTCGCTTCGATTCGTCCCAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACATTGGTACGAGCGTTTAGATGTCAGAGGCCTCTTCAGCATCTTCTTGGTATGGATCTGCGTATTCATGAAACCACTACACTCATTATGAGTGTGATGTAGATTCGTAAGACTCTTGGCATACTGTTCGTTTGTGGTACCAATGTACAGAATGCTGTAATGCAGGAATACTGCATAGCCAGACGTGAATACAGAATTGCCCCTGAGCTAATAC
  5   1   2       bld Int2 5g                         IMAGE:8822081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTCCAGTTCATACCGAGCAAACCCTATTTAAATTCGTCCCAGACAGGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCTCTTCTCATCATTGGGAAAGAGCTATGAGCTGCTGATGGACAGTCATCACATTGGTAACGAGCGTTTAGATGTCAGAGCCCTCTTCAGCATCTTTCTTGTATGGGATTCTGCGTATCATGAACACTTACAGTCATTATGAATGTGAAGTTGAATATCCGTAAGGACCTCCTATGCTCATA
  5   1   2       bld Int2 5g                         IMAGE:8530909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCTTTTCGTNGAGAGCATCAATANAATTCGTCCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGGTTGCTCTGGACTTTGAGCAGAAATGGCCACAGCTGCTT
  5   1   2       bld Int2 5g                         IMAGE:8824506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCGCTAGACCATCATAGGACCCGCCCCGGCACATTTCGTCCCGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGACAGTCATCACATTGGTACGAGCGTTTTAGATGTCAGAGGCCCTCTTCAGCCATTCTTTCCTTGGTATTGGAATTCTTGCGGTATTCCATGAGACCACTTACC
  5   1   2       bld Int2 5g3  in                    IMAGE:8822130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAATTTTTTTATATAAATTTATCTATTAAAAATTTACGTCCCGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAAAATGGCACAGCTGCCTCTCTCTCATTGGAAAAACTATGAACTGCCTGACGACAGTCATCACCATGTAACGAGCGTTTAAATGTCGAGCCTCTTCAGCATCTTCTTGTATGAATCTGCGTAATCCTGGACACTTACACTCAATACGAAGTGGAGTAATTCGTAGGAACTCTTCGTCCATACGCTCTT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5049305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGATATCGTCGACCCACGCGTCCGCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGAC
  5   1   2       bld Tail 5g                         IMAGE:8544689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAGTACTACATAATATTCGTCCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCA
  5   1   2       bld Int2 5g                         IMAGE:8529186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAAAAANCCAAGTGCTAGNNGAGAACATCAATACAATTCGTCCAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACNGACAGTCATCACATTGGTACGAGCGT
  5   1   2       bld Int2 5g                         IMAGE:8824716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGGCTTGTTACAATAGGACCCCTAAAATACAATTCGTCCCCAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATTGAGCTGCCTGACGACAGTCATCACCATTGGTACGAGCGTTTTAGATGTCCAGAGCCCTTCTTTCAGCCATTCTTTCCTTGGGTATGGAATCCTGCCG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACGCGTCCGCGGACGCGTGGGCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCNAGTG
  5   1   2       bld Int2 5g                         IMAGE:8526848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAANCCATGTTCGCNGGAGGAGCACTATAAAAATCGNCCCCAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGATAATCCTAACTGAGAGGGGGTACGGCTTCACCACCCCAGCCGATAGATAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCCTGGACTTTGAGCAGAGATGGCCACGCTGCCTC
  5   1   2       bld Spl  5g3  in                    IMAGE:8463538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATNNNNCCCACGTTNGNNGAAGAACATCAAATAATTCGTCCCGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGC
  5   1   2       bld Tail 5g3  in                    IMAGE:8542338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGNNNNCCATGATCTGTGNGNGGTACCTAATTAAATTCNTCCCGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGATAGAGAATCGTTCGTGATATCAGGAGAATTGTGCTAGTTGCTCGGACTTTGAGCAGAGATGGCCACGCTGCCTCTCTTCATCATGAAAAACTATAACTGCTGATGACAATCTCCCCTTGTACGACTTTTAAGTCAAAGCCTCTCACCTTCTCTTGGAGGATCTCGGATCTAACACTACATA
  5   1   2       bld Int2 5g3  in                    IMAGE:8823740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCAACTTATTGAAGACCCATCGATTCAAAATTCGTCCCGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATTGGTACGAGCGTTTAGATGTCAGAGGCCTCTCAGCATCTTCTGTTTGATCTGCGTATCATGAACCCTACACTCATTTGATTTGATGTAATATCGTAGACCTCTATGCATATGTTCTGTCGTGTACCAATGACCGATGCTGAAAATGCAAGAATACTGCTAGCCCAACTGAATCAAATTGCCTGACCAATCCTGTCGGATGGTCCTTGTTCTGTCTC
  5   1   2       bld Int2 5g                         IMAGE:8825335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGAAAAATTAACTTAATATGTAATATATTTAAATTCGTCCCGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATTGAGCTGCCTGACGACAAGTCATCACCATTGGTACGAGCGTTTTAGATGTCAGAGGCCTCTTCAGCATCTTTCTGGGTATGGGATTCTGGCGGTATTCATGACCACTTTACACTCATTATGACTGGTGATGTAGATTCCGGTACGACCCTCTCTATGGCCAATAT
  5   1   2       bld Emb4 5g                         IMAGE:4679975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGCGTCCGCGGACGCGTGGGGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAACCTTGCTCAGTGACCCGCCCGCCTATAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACCCTTTAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGTACAGCTTCACCACCACAGCGCAAAGAGAATCGTTCGTGATATCAAGAAAAATTTGGCTTGTTG
  5   1   2       bld Spl  5g                         IMAGE:8461369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTCAGTTNGNNGCNGACCATCGATAGAATTCGCCCGACAGTCTGTGTGCGTCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATTCCTACTGAAAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCGTGATATCAAGAAAATGTGCTATGTGCCTGGACTTGAACAGAGATGGCACGCTGCTCTTCTCTCATGGAAAGACTAGACTGCTGACGACAGTCTACATTGTAACACGTTAATTCAGAGGCTCTCACACTCCTGTAGATCTGCGATCTAACCTCATCATTGAGTGAGAATCCA
  5   1   2       bld FaB  5g3  in                    IMAGE:8070990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTCCGGATTCCCGGGATCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAATTGTGCTATGTTGCTCTGGATTTGAGCAGAGATGGCACAGCTCCCTCTCTCATCATTGAAAAGACTATGACTGCTGAC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4969038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATCGTCGACCCACGCGTCCGCCCACGCGTCCGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATC
  5   1   2       bld Eye1      in                    IMAGE:6948884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCGGAATTTCCGGGATCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGGCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACCGACAAGTCATTACCCATTGGGTAACGAGCGTTTTTAAATGTTCAGGAGGCCCCTCTTTCAGGCATTCTTTCCTTGGGGAATGAGAATCCCTGCGGGTATTCCTGGAAACCCCCTTTCCACTTTAAATTATTGAAAATGTGGAAGGTTAAAAAATTTCCCGTAAAGGGAACTTCT
  5   1   2       chi Sp1                             IMAGE:5506274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACGCGATCCGCCCACGCGTCCGAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTTACACTTCAGCTATGTATGTTGCCATCAAAGCTGTGTTGTCCCGGTATGCATTCTGGTCCTCCCCCTGTAATTGGCATGGACTCAGGGGATGGTGTAACCCCCCTGGTGCCAAAAATGAAGGGTATGTCCTACAACTGCCATTTTGCCTTGGGATTGGTGGGACTTGACTTGAAAAAACCCCTTGAAATACCTACCGAAAGGGGGAAAGTccccccccaccaaaaaaaaatcttttgataaagaaaattggtttttttctttttttaaaaaagcaccctcctttttcttttgaaaaa
  5   1   2       bld Eye1 5g                         IMAGE:7019623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGACCGGTCCGGATTCCGGGATCGCTAGAAGGAGAAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATAATCAAGGGAAAATTGTGCTAGGTTGCTCTGGAATTTGACCAGGAAATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAAAAGCTTTTAACTGCCCTGAAGGGACAATTCATCCCCATTTGGTTAACAAGGGTTTTTAGAAGGTCCAAAAGGTCCTCTTTTCCGGCCCATCTTTTCTTTGGGATATGGAAATCCTGGCG
  5   1   2       bld Sp1  5g                         IMAGE:5505734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACGCGTCCGCCCACGCGTCCGAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTCATCATTGGAAAGACTATGA
  5   1   2       add Tad2 5g                         IMAGE:6936155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATGTGGTATGTGCAAAGCCCGCTTTTCCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGGGGNCCAGGN
  5   1   2       bld Sp1  5g                         IMAGE:5511280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGCGGACTCGTGGGAAAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCGTGNATATCAGGAGAAATGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTTCTCATCATTGAAAAGAGN
  5   1   2       bld Te2       in                    IMAGE:7207831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCCGCGAATTTTCCCGGGATAGAAAGGAGAACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTTCTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATTGGTACGAGCGTTTTAGATGTCCAGAGCCTTCTTCCAGCATCCTTTCCTGGTATGGAATCCTGCGGTATTCATGGAACCCCTACAAACTCAATTTTGAAGTGTGAATGAAAAATTCGTAAGGGCACTCTATTCCCAATCTG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4965745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGCCCACGCGTCCGAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTT
  5   1   2       bld Tad1      in                    IMAGE:6877801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAGAAACGTTCGTGATATCCAGGGAGAAATTGTGGCTATGTTTGCTCCTGGACTTA
  5   1   2       bld Te1  5g                         IMAGE:6930421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGANAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGCCTA
  5   1   2       bld Tad2 5g                         IMAGE:6931941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAAGAGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTTCGTGATATCAAGGGAGAAATTGTGCCTATGGTTGGCTCCTGGA
  5   1   2       bld Tad2 5g                         IMAGE:6930955.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTGTGTTGTCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACCACCTCATGAAAATCCTAACTGAAGAGGGGGTACAGCTTCCCCACCACAAGCCGAAAGAGAAATCGTTCCGTGATATCCAAGGAACAAATTGGTGCTAATGTTTGCCTCTGGGACCTTTTGACCACGGAGAA
  5   1   2       bld Tad2 5g                         IMAGE:6933634.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGANAGGGGGTACAGCTTTCACCACCACAGCCCGAAAGAGAAATCGTTTCGTGATATCAAAGAAGAAAATTGTGCCTATGTTGGCTCCGGGGACTTTTGAACCAGG
  5   1   2       bld Tad1 5g                         IMAGE:6938424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAATAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGGTAACCCACACTGTGCCAATATATGAAAGCTATGCTCCTACCACATGCCCATTCTGCCGTCTGGAACTTGGGCTGGACGTTGATCCCGAACAGAACTACCTTCAATGAAAAAATCCTTAACCTGGAGAAGGGGGGGTACCAAGCTTCTCACCACCCACCAGGCTCGaaaaaaaagaaaaaaTCCGGCTCCGGTGGAATAATCCCACGGGCAAGAAAAATTGGTGGCCTAATTGTTTCTGGCCTACCTCGGAGAACATTTTTCGAAACCCAGGGAAAAGAATTGGGCCCTCCACCACCCCCT
  5   1   2       bld Int2 5g                         IMAGE:8825193.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATGGTTaaaaaaaaaaaaTAAATTTCATTTTCTAAATTCGTCCCCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCAATGGGTAACGAGCGTTTTAGATGTCAGAGGCCCTCTTCAGCATCTTTCTTGGTATGGGATCTGGCGTATTCATGAATCACTACACTCATTAGAAGTGTGAATGTAAATTCCGTAAGAACTCTTATGCGAATACTGGTCCTGTTCCTGTG
  5   1   2       bld Eye1 5g                         IMAGE:6945968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGACCGGTCCGGATTTCCGGGATAAGGAGAAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCCATATATGAAGGCTATGCTCTACCACATGCCATTCCTGCGTCTGGACTTGGCTGGGACGTGACCTGACAGACTACCTCATGAAAAATCCTAACTGAGAGGGGGTACAGCTTTCCCACCCACAGCCGAAAGAAAAATCGTTTCGTGATTTCAAGGGAAAATTGTGCCTTGGTTGCTCTGGACTTTTGAACCGGGAAATGGGCCACAGCTGGCCCTCTTCTTCATCATTGGAAAAAAGCTATTTAACTTGCCTTAAGGGAAAAATTATTCACCTATTGGGTAAAGCAGGGGCTTTTAAATGTTCCAGAAGGCCCCTCTTTTAGCCCATCTTTTTCCTTGGATAGGAAATCCCTGGCGGTGTTCCAATGAAAGCCCATTTTTAAACCTCAA
  5   1   2       bld Tad2 5g                         IMAGE:6934871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACACAAAATCTCGACAGATGCGTTCGTACGAGCTCTTC
  5   1   2       bld Tad1 5g                         IMAGE:6939040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCTCAGTGACCCGCCCGCATAGAAAGGAGATAGTCTGTGTGCGTCCAACCCTCAGATCACATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGGGTACAGCTTCACCACCACAGCCCGAAAGAGAAATCCTTTCGTGGATATCAAGGGAGAAATTGTGGCTATGTTGGCTC
  5   1   2       bld Tad1 5g                         IMAGE:6940213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTTCACCACCCACAGCCGAAAGAGAAATCGTTCCGTGATATCCAAGGAGAAAATTGTGCCTATGGTTGCCTCTGGGACTTTTGNAGCAAGGAAAATGGGA
  5   1   2       bld Tail      in                    IMAGE:8542675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNGAGTCATAATTCAATTCGTCCCAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4965679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACA
  5   1   2       bld Tad1 5g3  in                    IMAGE:6878377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAAATCGTCGTGATATCAAGGAGGAAATTGTGCTATGTTGCCTCTGGACTTTTGAACAAGAGATGGGCCACAGCTGCCTTCTTCTTTCTTATTGGGGAAAGAAGCTTTGGAGCC
  5   1   2       bld Tad1 5g                         IMAGE:6939585.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCAGTGACCCGTCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAGGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCCATATATGAAGGCTATGCTCTACCCCATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGGAAATCCTAACTGAGAGGGGGGTACAGCTTTCACCCTCACAGCCCGAAAAGAGAAAACGTTCCGTGATATCCAGGAAGAAATTGGTGCCTATGTTTGGCTCTGGGACCTTTGAGCCAGGGAAAATGGGCCCAT
  5   1   2       bld Ov1  5g                         IMAGE:8330134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACGCGTCCGGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTTCCCACCACAGCCGATAGAGAAATCGTTCGTGATATCAGGAAGAATTGTGCTATGTTGCT
  5   1   2       bld Tail 5g3  in                    IMAGE:8542087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGNGGAGCACCTATATAGAATTCGTCCCGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAGAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCACAGCTGCCTCTTCTCATCATTGAAAAGACTAGAGCTGCTTGACGAAGTCATCACATTGTACGAGCGTTTAATGTCAGAGCCCTCTTCAGCATCTCCCTGT
  5   1   2       bld Thy  5g                         IMAGE:8549878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGATCATAAATCGATTCGTCCCAGAAGGAAAAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAATCCTAACTGAGAGGGGTACAGCTTCCCACACAGCCGAAGAGAATCGTTCTGATTCAAGAGAATGTGCTATGTGCTCTGACTTGAGCAGAATGCACACTGCTCTCTCATCATGAAGACTATACTGCTACGACATCATCCATGTACAGCTTTAAGTCGAGCTCTCAGCTCTTCTGATGACTGCGTCTAACCTCATCTAGATGAGAATCGAGCTCTCACTCTCGGCCATACGATCATAGAA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174958.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACGCGTGGGCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAAACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACGCGTGGGCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTN
  5   1   2       bld Emb4 5g3  in                    IMAGE:4958973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACGCGTCCGCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTA
  5   1   2       bld Tad1 5g                         IMAGE:6879000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCANGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGGAAAGAGAAATCGTTTCGTGATATCAAGGGAGAAATTGTGCTATGTTGCTCTGGACTTTTGAGCAAGAGATGGGCCACAGCTGCCTCTTCTTCATCATTGGGAAAAGAGCTATGACCTGCCCTGACGGACAAGTCATCCACATTTGGTAACGAACGTT
  5   1   2       bld Tad1      in                    IMAGE:6879472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATGGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGGACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCATCCCTGGATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCGAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGGGACCTGACAGACTACCTCATGAAAATCCTAAGTGAAAGGGGGTACAGCTTCACCACCACAGCCGAAAAAGAAATCGTTTCGTGATATCAAGGAAAAAATTGTGCTATGTTTGCTCTTGGACCTTTGACCAGGAGAATGGCCACAGCTGGCCCTCCTTCCTTCATTCATTGGGGAAAAGAACCTATTGAGCCTGGCA
  5   1   2       chi Tad1      in                    IMAGE:6880729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGATAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCNGTGATGGTACCCACTGTGCATAATGAGCTATGCTCTACCTGCATCTCGCTGACTGTGATGCTGCATACCTGATCACGAGGGTCACTCCCAACAAGATCTTATCAGATGCTTTCTGTACGAGCATCCCTCTGAGAATGCCGGACTCTGAAGTATCAGCTCCCTCTTGACCGTCACTACATGATGGATCAGCTCATTTTGGCAGCATGAGAAACACACATATCTGACTGTGCTTCCTCAGANGAGGCTCATACTACGAGTTGATAGCATAACCGNATCTCACTCACCGCACAAAnnnnnnnnnnnnnnnnnnnnncntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCN
  5   1   2       bld Tad2 5g3  in                    IMAGE:6872647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGGTATGCTCTACCACCTGCCATTCTGCGTCTGGACTTGGCTGAACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGACAAGGGGGACAGCTTCCCCACCCACAGCCGGAAAGAAAAATTCCTTCGGGGATATTCAAGGAGAAAATTGCGCCTATGTTGCCTTCTGGGACTTTTGAAACAAGGAAAAATGGGTCCTACGCCGGCCCCCCTTGCGTTTAATCAACTGGGGGAAAAAAT
  5   1   2       bld Tad2 5g3  in                    IMAGE:6875313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGGGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAAACTGAGAAGGGGGGTACAGGCTTCACCACCCACAGCCCGAAAAGGAGAAAATCCGTTTCGGTGAAAT
  5   1   2       chi Tad2                            IMAGE:6930937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGGTATTGTCATGGACTCAAGTGATGGTGTAACCCACACTGTGCCCAATATAATGAAGGCTATGCCTCCACCACCATGGCCATTTCTGGCGTCCTGGAACTTGGGCTGGGAACGTGGACCCTGACCAGAACTACCCCTCCATGGGNAAAATCCCTTAAACCTGAAGAAAggggggggTAACAAAGCCTTTTCTACCCAACCCCAC
  5   1   2       bld Tad2 5g                         IMAGE:6930916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGGCCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCCATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACCTACTCCTGAAAATCCTAACTGAGAGGGGGTACAGCTTTCCCCACCCAAAGCCCGAAAAGAGGAAATCCGTTCGGTGAATATCCAGGGAGCAAATTTGTGGCTATTGTTGGCTTTTTGGACCTTTGAACCACGGAAAAATGGCCCT
  5   1   2       bld Tad1 5g                         IMAGE:6940467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAAGCTTCACCACCACAGCCCGAAAGAAGAAATCGTTCCGGATATTCAAGGGAGAAAATTGGTGCTTATGGTTA
  5   1   2       bld Tad1 5g                         IMAGE:6938516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAAAAGGGGGTACAGCCTTCCCCAACCACAGCCCGAAAGGAGAAATCCTTTCGTGGATATCCAAGGAAGAAAATTTGTGCTTATGTGTTGCTCCTGGGGACTTTTGGAACCCAGGGAAAAATGTGCCCACAAGGCCTTGCCCCTTCT
  5   1   2       bld Tad1 5g                         IMAGE:6936732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGTAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGGCTATGTTGCTCTGGGACTTTGAA
  5   1   2       bld Tad1 5g                         IMAGE:6940364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTAACTCCTGAAAATCCTAACTGAGAGGGGGTACAGCTTCCCCACCACCGCCCaaaaaaaaaaTCGTCGGGGAATCCAGGAAAAAATTGGGGCTATGGTGGCCCCTGAACATTTGAGCCAGGAAAAGGGCCCACACTGGCCTCCTTTCTTCATCAATGGGAAAAAGAACCTATTAACTTGCCCTGAAACGAAAAAATCCTCCCCCCTTTGGTTAAACCAAGGCGTA
  5   1   2       bld Tad1 5g                         IMAGE:6937348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGGACTTGGCTGGACGTGACCTGACAGACTACCTCCATGAAATCCCTAACTGAAAAGGGGGTACAGCTTCCCCACCCCCAGCCGAAAAGAAAAAATCGTTCCGTGGATATCCAAGGGAGAAAATTGTGTCCTAATGTTGGCCTCTGGGAACTTTGGAGACAGGGAGAATGGGCCCCCAGGCTTGGGCCCCTTTTCTTTAATCCAATTGGGGaaaaaaaaaGCTTATGTGAACCCTGGCCCCTGGACCGGGAACAAAAGTTCCTCTC
  5   1   2       bld Int2 5g3  in                    IMAGE:8822369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCACTTTTTTGTAGGAAACATATTCTATAATAAAATTCGTCCCCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATTGGTACGAGCGTTTTAGATGTCAGAGGCCTCTTCAGCCATCTTTCATGTATGGAATCTTGCGGTATCATGAACACTTACAACTCATATGAATGTGGATGTAAAATCGTAAGGACTCTATGGCATACTGTTCTGACTGGTGTGTACCCCAATGTTACACGA
  5   1   2       bld Int2 5g                         IMAGE:8822537.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGCGTTGGCCACAACACGAccccccccccTACAAAATCGTCCCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATTGGTAACGAGCGGTTTAGATGTCAGAAGGCCCTCTTCAGCATCTTCTGATATGGATCCTGCGTATTCATGAAACCACTTACAACCTCATTATGGAGGGTGTGATGTTAGAT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6877666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGTGACCCGCCCGCATAGAAAGGAGATAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATCGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGGTACAGCTTTCCCACCCACCGCCGAAAAGAAAAATCGTTTTCGTGATATCCAAGGAAAAAATTGGGCCTATGGTTGCTTCCGGGACTTTTGGAACCAGGAAAAAGGGCC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6875729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGANAATCCTAACTGAGAAGGGGTACAGCTTCACCACCACAGCCCGAAAGAGAAATCGGTCCGTGATATCCAGGAGAAAATTGTGCTATGTTTGCTCTGGGACTTTTGAGCAAGGAGATGGCCCACAGCCTGGCCCTCTTTCCTTCCATCATTTGGC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6875855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTTCACCACCACAGCCGGAAAGAGAAATCGGTTCCGGGAAAATCGAGGGAGAAAATTGGTGCCTTATGTTTGGC
  5   1   2       bld Int2 5g                         IMAGE:8527697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GNGGAAGATCGATTGAATTCGTCCCGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCTCTTCTCATCATGGAAAGAGCTATACTGCTGACGACAGTCTCACATTGTACGACGTTAGATGCAGAGCCTCTCAGCTCTTTCTGATGATCTGCGATCTGAACCTCATCATAGATGGA
  5   1   2       bld Tad2 5g3  in                    IMAGE:6872920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGGCTTCCCCACCACAGCCCGAAAGAGAATCGTTTCGTGATATCCAGGGAGAAATTGGGCTATGTTGCCTCTGGACTTTGAGCAGGGAGATGGGCACAGCCTGCCTCCTCCTTCATCATTGGGAAAAGAGCTATGAACCTGCCTGGACGGACAAGTTCTTCACCATTGGGTAACCGACCGTTTTAGATGGC
  5   1   2       bld Tad2      in                    IMAGE:6876491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGGATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAACGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAAGCTATGCCCTACCACATGCCATTTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTTCACCACCCCAGCCGGAAAGAGAAAATCGTTCCGTGGATATCCAAGGAAGAAAATTGTGCTAATGGTTGCTTCTGGGAACTTTGCACCCAAGGAGAATGGGCCCACCAGGCTGGCCCCTCCTTTTC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6881353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGACCCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCANGTGATGGTGTAACCCACACTGTGCCCATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCTGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACAACAGGCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGCTATGTTGGCTCTGGACTTTGAACCCGAACAGGCCCCAGCTTGCCTCTCCTTCATCTTTGGAAAAG
  5   1   2       bld Thy  5g                         IMAGE:8550065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAANNNNCCTGAGGCNTTGAGATCATCATTCGATTCGTCCCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAATCCTACTGAGAGGGGGACAGCTTCACACCACAGCCAAAGAGAATCTTCGTGATATCAGGAGAATGTGCTATGTGCTCGGACTTGACANGAGATGCACACTGCTCTCTCATCATGAAGACTATACTGCTGACGAATCTCCATGTACGACTTTAATGCGAGCTCTCACTCTTCTGTAGATCGCGTCTGACCTCATATAGATGAGAATCTAGCCTCACGTCTCGGCCAGCGATGCAAGCAAATCTCACTATGATGTAG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4965508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATATCGTCGACCCACGCGTCCGGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTAC
  5   1   2       bld Brn1 5g                         IMAGE:6953199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGGAATTCCCGGGATAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAAAAGGGGGTACAGCCTTCACCACCACAGCCCGAAAGAAAAATCCGTTCGTGGATATCCAAGGGAGAAAATTGGGGCTATGTTTGGCCCTGGAACTTTGGAGCAGCGAAAATGGGCCCCAGGCTGTCCTCCTTTTTTCATTCATTGGGaaaaaaaaGCTATTGAAGCTGGCCGTGAAGCGAAAAAATCTAATCACCCCTTTGGGGAAACGAAGGCGGTTTTTATAATGTTTCCCAAAGGGGCCCTCCTTTCCAGGCCATATTTTTTTCCTGTGTGTAATGGGAAATCCCTTGCCGGGTAATTTTCCGGGAAAACCCCTTTGTTCCCACCCCCAATTTTATGAGAACGGTGGGAAAGTAAGAATTATTCCGGGCAGAGGGCCTCCTTTTCTTCACCCTAATAAATTTTTN
  5   1   2       bld Sp1  5g                         IMAGE:5511581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTGCGTGAGTACAATTGAGACCGCCTGTGTGCGTCCAACCCTCTGATCACAATGTATTACGATATTGCCGCAATGGTCGTTGATAATGGATCTGGTATGTGCAAAGACCGGCATTTGCTGGAGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCGCGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCCGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACACATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCATGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCCATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACTGACAGACTACCTCGTGAAAATCTAACTGAGAAGAGGACTGCTTCTCCCCACAGCCGAACATAATCGTTGTGTATCAAGAGAATTGTCTTGTTGCTCGGATTTTACAGAATGGCCCAGTCCCCTCTCTCTTGAAAAACTTTAGTGCGTAGAAAGCAAACA
  5   1   2       bld Sp1  5g                         IMAGE:5505760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACGCGTCCGTAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAAAGGGGGTACAGCTCCACACCACACCCGAAGAAAATCCTTCCTGATATCAAGAAAATGTTGCTAGTTCCTTGAATTGACCAGAAATGGCCCACTTCCCTTTTCACTTTGAAAAACTTTATTTCCTGAGGAATTTCTCCT
  5   1   2       bld Sp1  5g                         IMAGE:5511988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGTAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTACGAGCNGTTAGATGTC
  5   1   2       chi Sp1                             IMAGE:5513726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCACGCGTCCGAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATAAAGGCTATGCTCTACCACATGCCCTTCAGCGTCTGGACTTGGCTGGATGTGACCCTGACGACTCTCTCTGACAATCCTAACTGATATGGGGTTTCTTTTTCCCTCCTCAGCCTAAAAAGAATTCATTCGATTAAAACGTAAAATTTGTCTATGTTTCTTCGGATATTATCAAGAAAACCCACTCTGACTCTTTCCCCTCATTGTAAAAAAACTATATTCCTCACCTCGGATT
  5   1   2       bld Emb4 5g                         IMAGE:4202874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGCGTCCGGNAAGGNAGACAGTCTGTGTGCGTCCANACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGGTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTTAGGTGATGGTGTAACCCACACT
  5   1   2       chi FaB       in                    IMAGE:8069729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTCCGGATTCCCGGGATGGAGACAGTCTGTGTGCGTCAACCCTTTTTCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCATGTGATGGTGTAACCCACTCTGTGCTAATATATGATGGCTATGCTCTACCCATGCCATTCTGCGTTGGACTTGCTGGACTGACCTGCAGACTACCCTTGAAAATCTAACTGAGAGTGGTACACTCTCACCACACCTAAGTAATCTTCGTGATTCATGAGAATGTGTTGTTCTCGGATTAATCAGAATGCACACTCCTTCTCTCTAGAAAACTTTACTCCTATGA
  5   1   2       bld FaB       in                    IMAGE:8069644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGTCGGATTCCCGGGATGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAAGTGATGGTGTAACCCACACTGTGCCTATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAAACTACCTCATGACAATCCTTACTGAGAGGGGGTACAGCTCCCCACCCCCTCCGaaaaaaaaTCGTTCTGATATAAGGAGAATTGTGCTTGTTGCTCTGACTTTAACCGGAAATGCCACACTGCCTCTTCTTCTCTTGGAAAGAATATGAGC
  5   1   2       bld Panc 5g3  in                    IMAGE:8734251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGCCCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATGGAAAGGAGCTATGAGCTGCCTGACGGAACAAGTCATCACATGGTTACGAGCGTTTAGATGTCAGAGGCTCTCCAGCAATCTGCTTGCATGATCTGCCGCATTCATGAAGCACCTACACCTCAATTATGATGTGTGAT
  5   1   2       bld Sp1  5g                         IMAGE:5506050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACGCGTCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCCTACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAAATGTTCGTGATATCAGGAAAATGTGCTATGTTCTCTGACTTGAGCAGGAATGGCACGCTGCCTCTCTCACTCTGAAAGACTTTGACTGCTGACGAGAATCTTCCCTGGTAAGAGCTTTAATCCAAGGCTCT
  5   1   2       bld FaB  5g                         IMAGE:8071888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATNCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTTCTCATCATT
  5   1   2       bld FaB  5g                         IMAGE:8071638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAA
  5   1   2       bld FaB  5g                         IMAGE:8074197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAGAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCACAGCTGCTTCTCTTCATCATGGAAAAGACTATGNCTGC
  5   1   2       bld Int2 5g                         IMAGE:8527586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTTACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATTGAAGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGAACCTACAGATTACCCCTGAAAATCTAACTGAGAGGGGTGCGCTTCTCCCCCCCACCCATAGAGAAACGTCGTGAATCAAGGAGAAATGTCTTTGTTCTCTGGCCTTGACAGGAAAGGCCCACTGCCCCTCTCTCTTTGAAAAACTTTACTGCTAGGACAGCCTCCCTTGTAAGACGTTTTATCC
  5   1   2       bld Int2 5g                         IMAGE:8530447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATNATCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTC
  5   1   2       bld Bone 5g                         IMAGE:8741232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCTCTTCTTCATCATTGAAAAGAAGCTATGAGCTGCCTGACGACAGTCATCACATGGTACGAGCGGTTTAGATGTCAGAGGCCTTCTTCCAGCCATCTTTCCTTG
  5   1   2       bld Emb4 5g                         IMAGE:5570880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAAGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACCGAGAGGGTGGTACAGCTTCACCACCCACGGCCTAACAGACAAATCAATTCGTGATATCCCAGGGAGAAAATGGTGGCCATGTTTGCTTCCGGCACTTTTTACCCGGGGGAATgccccccagcctggcccccttccctcccccAATGGGAAAAACCACCCCATCGAACCCGGCCCCTGACGGGGCCGAGGGCACCCACGCCTTGGCTNAACCCGAGCCTNTTCACAGGAAGCGCCCCNGAACAcccccccccTTCCCCGAGCCCGACA
  5   1   2       bld Sp1  5g                         IMAGE:5511318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCCTCTCTCATCATGNAAAGAGCTTGAGCTGCTGACGACAGTCTCACATGG
  5   1   2       bld Sp1  5g                         IMAGE:5512759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGNAAANGAGCTATGAGCTGCCTGACNGACAGTCATCACATTG
  5   1   2       bld Sp1  5g                         IMAGE:5512003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGANAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCANGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCNAGAGATGGCACAGCTGCCTCTTTCTCATCATTGGAAAAGAGCTATN
  5   1   2       bld Kid  5g                         IMAGE:7010153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCT
  5   1   2       bld Te2  5g                         IMAGE:7210254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCACAGCTGCCTCTTCTCATCATTGNAAAGAGTATGAGCTGCTGACGACAGTCATCC
  5   1   2       bld Ga15 5g3  in                       XL476i12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAA
  5   1   2       bld Ga15 5g3  in                       XL479b08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATT
  5   1   2      seed Ga15 5g3  in                       XL485j12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACG
  5   1   2       bld Emb9 5g                         IMAGE:7977371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGACAAGTCATCACCATTGGTACGAGCGTTTTAGATGTCCAGAGGCCCTCTTTCCAGCCATCTTTCCTTGGTAATGGAATCTCTGTG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7973828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGTGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAATCCTAACTGAGAGGGGTACAGCTTCACCCCACAGCCGAAGAGAAACGTTCGTGATATCAGGAGAATTGTGTATGTGCTCTGGACTTTAACAGAATGGCAAGCGCTCTTTTCTCTTGGAAGACTTTACTCCTACGACATCTCCCTTGTACAGCTTTAATTCAAGCCTTCCCCTTTCTGTGAACGCGTACTGAACTAACATTGAGGTGAATCGAG
  5   1   2       bld Emb9 5g                         IMAGE:7974590.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGAC
  5   1   2       bld Emb9 5g3  in                    IMAGE:7974012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAACCTAACTGAGAGGGGGACAGCTTCCCACCACAGCCAAAGAGAAATCTTCGTGTATCAAGGAAAATGTGCTAGTTGCCTGGATTTGAGCAGAATGCCCAGCTGCACTCTCTCATTGAAAAACATACTGCTGACGACATCTCCCTGGTACACGTAAAGTCGAGCCCTCCCACTTCTGTTGATCGGATCTGACCTCCCATTATTGTTTCCTAGCTACATGTTTG
  5   1   2       chi FaB                             IMAGE:8071553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCNTACAGGGAGAAGATGACACAGATAATGTTCGAGACTTTTACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCCTGGACCCCGGGTAATGGTGGAAACCCACCTGTGCCAAATAATGAAGGGTATGGCTCAACAATGCCTTTTGGCTCTGGACTTGGCGGGACTTACCCGAAAAATCCCTTTGAAAACCTAACTGAAAGGGGGAACCCTcccccccccccccaaaaaaaaCTTTCTGATAAAAGAAAATTGGGT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGA
  5   1   2       bld FaB  5g                         IMAGE:8073735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTTGTGATAATCAGGAGAATTGTGCTATGTT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCTTTCGTGATATCAAAGAGAATTGTGCTATGTTGCTCTGGAACTTGAGCAGAGATGGCCA
  5   1   2       bld FaB  5g                         IMAGE:8074115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCCTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACATTGGTACG
  5   1   2       bld Ov1  5g                         IMAGE:8331507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAA
  5   1   2       bld Tail 5g                         IMAGE:8544896.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGATTTGAGCAGAGATGGCACAGCTGCTCTTCTCATCATGAAAGACTATACTGCTGACGACAGTCTCACATGGTACGACGTTTAATTCAGAGCCTCTCAGCTCTTCTGNATGATCTGCGATCTGAC
  5   1   2       bld Int2 5g                         IMAGE:8527118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAAGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATG
  5   1   2       bld Tail 5g                         IMAGE:8544340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCCTCTCTTCTCATGNAAAGAGCTATGACTGCTGACGACAGTCTCACATGGTACGACGTTTAATGC
  5   1   2       bld Tail 5g                         IMAGE:8545422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATG
  5   1   2       bld Int2 5g                         IMAGE:8531204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCCCACCACAGCCGAAAGAGAAATCGTCGTGATATCAAGAGAAATGTGCTATGTGCTCTGACTTGAGCAGAGATGGCACGCTGCTCTTCTCATCATGAAAGACTTGACTGCTGACGACAGTCTCCCATTGTACAGCGTTTAATGTCAGAGCTCTCAGCTCTTTCTGTAGATCTGG
  5   1   2       bld Spl  5g                         IMAGE:8462406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGATTTGAGCAGAGATGGCCACACTGCTCTTTCTCTCATTGAAAGAGCTTGACTGCTGACGACAGTCTCACATTGTACGACGNTAGATTCAGAGCCTCTCAGCTCTTCTGNATGATCTGCGAC
  5   1   2       bld Thy                             IMAGE:8550151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GNGTGCTCGATCGATTCGTCCGACAGCTGTGTGCGTCCACCCTCAGATCCATAGGAAGAAATATTGCCGCACTGGTCGTTGATAATGGGATCTGGATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCCTCATGAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAANGAGAATTGTGCTATGTGCTCTGGACTTGAGCANGAATGGCACAGCTGCTCTTCTCATCATTGAAAAGACTATGACTGCTGANGACAGTCTCACATTGTACGAGCGNAGATGCAGAGCCTCTCAGCTCTTCTNGATGATCTGCGATCTGACACNCATCATAGATGGATGAATCGAGACTCTCAACGTCGTCGGACATGCAGATCGAGAGCAGAAGCAGCCACGATA
  5   1   2       bld Thy  5g                         IMAGE:8549124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACACCACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCANGGATGGCACACTGCTCTTCTCATCATGGAAGACTTACTGCTGACGACATCATCCATGTACGACGTTAATGTCAAGCTCTCAGCTCTTCTGTATGACTCGATCTGACCTCACCATTGATGAGAAACTAGCTCTCATCGTGCGGACAG
  5   1   2       bld Thy  5g                         IMAGE:8549628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGNATATCAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCTCTTCTCATCATGNAAAGACTATAGCTGCTGANGACAGTCTCACATTGTACGACGTTAATGTCAGAGCTCTCAGCTCTTCTG
  5   1   2       bld Int2 5g                         IMAGE:8821538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATGGAAGAGCTATGAGCTGCTGACGACAGTCATCACATGTACGAGCGTTTAGATGTCAGAGCCTCTTCAGCATCTTTCCTTGGGAATGGAATCT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4965589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGAAGGAGACAGTCTGTGTGCGTCCGACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4969052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCACGCGTCCGGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAT
  5   1   2       bld Emb4 5g                         IMAGE:5536801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGANAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAAGAGAAATCGTTCGTGATATCAAGGAGAAAATGTGCTATGTTGCTCTGGACTTTGAGCCAGGAGATGGCCCCCAGCTGGCCTCTTCTTCATCATTGGAAAAAGAGCTATGAAGCTGGCTTGACGGGACAAATCATCAACATTGGGTAACGAACCGGTTTTAAAAGGTCCAGAGGGCCCCTCCTTCCAACCAATCTTTTCCTTGGGGAT
  5   1   2       bld Emb4 5g                         IMAGE:5541785.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCACGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGTCGAAAGAGAAATCCTTCGTGATATCAAGGAGAAATCGTGCTATGTTGCTCTGGACCTCTGAGCAGGAGATGGGCAACAGCTGCCCTCCTCCTTCTTCATTGGAAAAAGAGCTATGGACCTGCCCTGACGGGACAAGCTCATCACCAATTGTGGAACCGAGCGCCTTTTAGAATGTCCCAGAAGGGCCCCTTCCTTTCCAAGCCCATTCTGTTTCTCTTTGGGGAATGGCGGAAATCCCTCGCGCCAGAATTTCCCTTGGGAAAACCCCCTCTCTAACCCAAAGCTCANAATTTGAGTGCAAC
  5   1   2       bld Emb4 5g                         IMAGE:5572825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTNGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGANAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGACCTATGAACTGCCCTGACGGACCAGTCATCCACCATTGGTAACCAGCCTTTTTAAAATGC
  5   1   2       bld Brn1 5g                         IMAGE:6956052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCGTTTTAGATGTCCAGAGGCCCTCTTCCAGCCATNCTTTCCTTGGTATGGAATCCCTGCGTATTCATGAAAA
  5   1   2       bld Sp1  5g                         IMAGE:5513562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCCCGCATAGAACCGTTGAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAACTTTATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCATTTTTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAGGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTTGGAAAGAGCTATGA
  5   1   2       bld Eye1 5g                         IMAGE:7019847.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCCCGCATAGAAAGGAGAAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTTGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGGCTGCCTCTTTCTTCATCATTGGAAAAAGAGCTAATGAGCTGCCCTGAACGGACAAGTCCATCAACCATTTGGTAAACGAAGCGTTTTTTAGGATGGTCCCAAGAGGCCCCTTCCTTCCAAGCCT
  5   1   2       bld FaB  5g                         IMAGE:8073830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGATTCCCGGGATGGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAGGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCC
  5   1   2       bld Lmb1 5g                         IMAGE:8532546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAGAGAATCGTTCGTGATATCAAGGAGAATGTGCTATGTGCTCTGACTTTGAGCAGAATGGCACACTGCTCTTCTCTCATGAAAGNACTATACTGCTGACGACATCTCNCATGTACAGCTTTAATGTCGAGCTCTCAGCTCTTCTGGTGATCTGCGATCGACCTCACTATGATTGTTAACT
  5   1   2       bld Int2 5g                         IMAGE:8529498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGAAAAGAGCTATGAGCTGCCTGACNGACAGTCATC
  5   1   2       bld Spl  5g                         IMAGE:8461862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTCATCATTGGAAAGAGCTATGAGT
  5   1   2       bld Int2 5g                         IMAGE:8529954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACACCACAGCCGAAAGAGAATCGTTCGTGATATCAAGGAGAAATGTGCTAGTTGCTCTGACTTTGACAGAGATGGCCACGCTGCTCTTCTCATCATGAAAGAGCTTGACTGCTGATGACAGTCTCCCATTGTACGACGTTTGATGTCGAGGCTCTCAGCTCTTCCTGATGACTGCGATCTGACCCTCATA
  5   1   2       bld Tail 5g                         IMAGE:8544707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTC
  5   1   2       bld Thy  5g                         IMAGE:8551261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCCCACAGCTGAAAGAGAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGACTTGAGCAGAGATGGCACACTGCTCTTCTCATCATGAAAGACTTGACTGCTGATGACAGTCTCACATGTACGACGTTAGATGTCGAGCTCTCAGCTCTTCTGTAGATCGCGATCTGAC
  5   1   2       bld Thy  5g                         IMAGE:8546914.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCCCGCAAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCTGAAGAGAATCGTCGTGATATCAAGAGAATGTGCTATGTGCTCTGACTTGAGCAGAGATGCACGCTGCTCTCTCATCTGAAAGACTATACTGCTGATGACATCTCACATGTACGACGTTAATGTCAAGCTCTCAGCTCTTCTGTAGATCTGCGATCTGACCTCATCATTGAGTGAGNATCTAGACCTCAACGTCGTGGACAATACGATCAAAGCAA
  5   1   2       bld DMZ  5g3  in                         xl289i15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl291p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGC
  5   1   2       bld Tbd1 5g                              AW764498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGACGTGACCTTGCAGACTACCTTATGAAAACCCTAACTGAG
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3201129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCATAGAAAGGAGACAGTCTGTGTGCTTCTCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTANGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCANGTGATGGTGTAACCCACACTGTGCCAATATATGAATGCTATGCTCTACCACATGCCATCCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGACAATCCTAACTGATAAGGGGTACAGCTTCACCACCACAGTCGAA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4963950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATTGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGCACCACTGGTATTGTCATGGACTCACGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTA
  5   1   2       chi Emb4                            IMAGE:5572302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCGCATAGAAAGGAACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGAAAGACTACCTCATGAAAATCCTAACTGACAGGGGGGACAGCTTCCCCCACCACAGCCGAAAGAGAAACGGTTCGTGAATATCCAGGAAAAAATTGTGCTATGGTGGCTCTGGAACTTTGAAGCAAGGAGAGGGCCCCCACCTGCCCTCTTCCTTTCTCCGTTGGGAAACAAGCCATTGAAGCTGCCCTGCACGGGACCAAGTCAATCCCCCATTGGCGAAACGAAGCGGTTTAACCATGCCCAAGAGAGGCCCCTCCTCCCCCC
  5   1   2       bld Ov1  5g                         IMAGE:6318386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCCCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGAACGACTACCTCATGAAAATCCTAACTGAGAAGGGGTACAGCTTTCCCCACCACAGGCCGAAAGAGAAATCCGTTCGTGATATCCAAGGAGAAATTGGTGCTATTGGTTGCTCTTGGACTTTTGAACCAAGGAAGATGGGCCCACAGCTTGGCCTCCTTTCTTTCCTTCATTTAGGAAAAAAGAAGCCTTAGTGAACCTTGCCCTTTAAAGGGGAACAAATTCCAATTCAACCCATTTGGGATAAACCCCGAGCGCCGGTTNTATAAAAATGTCTTCCCAGAAAGGGGCCCCCTCCTCCTTTCTCAAGGCCCCATT
  5   1   2       bld Emb4 5g                         IMAGE:5514595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACGCGTCCGGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATNCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGGA
  5   1   2       bld Kid  5g                         IMAGE:7008219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGACGCGTGGGGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAANATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATNCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGNAAAGAGCTATGAGCTGCCCTGACGGACAGTCATCACCATGGGTACGAGCGTTTAGATGTCCAGAGCCCTCTCAGCATCTTNCTNGTATGAATCTGCGTATCTGAACACTACACTCATAGATGTATGAATTCGTAGACCTTGCATATGTCGTCGTGACCAGTACAGATGCTAGAGCAAGATATGCTGCCAGCTGATNGTATCCCTGACATCTGCGTGGTCTG
  5   1   2       bld Ga15 5g3  in                       XL418l21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTG
  5   1   2       bld Ga15 5g3  in                       XL435c12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGANCTGCCTGACGGACAANTCATCAC
  5   1   2       bld Ga15 5g3  in                       XL462b17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGANAGGGGGTACAGCTTCNCCACCACANCCNA
  5   1   2       bld Ga15 5g3  in                       XL478m15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAA
  5   1   2       bld Ga15 5g                            XL480d19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAAGCTGCCTGACGG
  5   1   2       bld Ga15 5g3  in                       XL483b18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGGTATGTTGCATGACTTTTGGTATGTGATTATTTAGGGTGGGGTTGTTCTTAAATTTCTTTTTTTATATTTATGTAATTTGCTATTCATTACAGGGCTTTCCTGGCCTCAAAGTTTACTGGATTCTTTACAGGTTTCTATATTTGCCTGTTTTTTTACANCNAGGGTANAATACTAACAATGTTANGGTANTGTGTGAANANTGCTAAATGGCTTGNATTTCNNANNTCNCTTTGCTTGTGTGGNTTTTTCNCATTNNCCCTGCCTGAATTANTCTCTTGNGT
  5   1   2       bld Ga15 5g3  in                       XL438i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGGACAAGTCATCACCATTGGTA
  5   1   2       bld Emb9 5g                         IMAGE:7974821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCATACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCCGCGTCTGGACTTGGCCGGACCTGACCTGACGTACTACCCTCATGAAAATTCTAACTGAAAAGGGGTACAGCTTCACACCGCTGCCGAAAGATAAATCGTTTGTGATATAAGGCAGAATTGTGC
  5   1   2       bld FaB  5g3  in                    IMAGE:8069611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTGGACCAGGAGATGCCACAGCTGCCTCTTCTTCTCATTGGAAAAAACA
  5   1   2       bld Int2 5g                         IMAGE:8528078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCACAGCTGCCTCTTCTCATCATTGGAAAGAGCTATGAGCTGCTGATGA
  5   1   2       bld Bone 5g3  in                    IMAGE:8740683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCTGACGACAGTCATCACCATTGGTACGAGCGTTTAGATGTCAGAGCCCTCTCCAGCATCTTCTGTATGATCTGCCGTATCATGATCACTACACTCAATTATGAGTGTGATGTTAAATATTCCG
  5   1   2       bld DMZ  5g3  in                         xl319l10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATA
  5   1   2       bld DMZ  5g3  in                         xl317j05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATAT
  5   1   2       bld Tbd5 5g                         IMAGE:3580166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCTTAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCANGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGTGTACAGCTTCACCACCACAGTCGATAGAGAAATCGTTCGTGATATCCAAGAGAAATTGTGCTATGTTGCTCTG
  5   1   2       bld Sp1  5g                         IMAGE:4175491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGANTCGCNAGAGAAGAGCGCGAGTGCTGCTCACANAANCACCCCTGAATCCTAAAGC
  5   1   2       chi Kid                             IMAGE:4032369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCCTTCTACAATGAAAACTGCGAGTGGGCACCAGAANGAACACCCCAGTGGCTGGCTCACAGAAAGCACCCCCTGAATCCCTAAAAGCTAACCAGGGGAGAAAGATGGACCCCAGATAAATGTTCCGAGAACCTTTTAACCACTTCCAGCTTATGGTATTGTTTGCCAATTCCAAGCCTGGGGGTTGGCCCCCTGGAATGGCATTCTGGGTCCGAACCCACCGGGGAATTTGGTCATTGGACCTCCCGGGGGGAATGGGGGTAACCCCCCCACCTGTGGGCCCAAAAAATTTGAAAGGGTTTTGTGTTCTTACCCCACATTGGCCATTTTTTTGGGGGCTTGGGGGACCTTTGGGTTTGGGAAAACTGGAACCCTTGTaaaaaaaaaaTACCCCCTCTCTTGGGAAAAAAATCCCCTTAACTCTGTGAAAAAAgggggggggtaaaacaaagttttttttAACACCACAACACAAAAC
  5   1   2       bld Lmb1 5g                         IMAGE:8533494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAGTCCTAAATATATTCGTCCCTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCTCATTGGAAAGAGCTATGAGCTGCTGACGGACAGTCATCACATTGGTAC
  5   1   2       bld Thy  5g                         IMAGE:8547515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGAAAAGAGCTA
  5   1   2       bld Skin 5g3  in                    IMAGE:8640289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATNCAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCACAGCTGCCTCTTNTCATCATTGGAAAGAGCTATGACTGCCTGACGGACAGTCATCACATTGG
  5   1   2       bld Ga18 5g                           xlk161n13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCANNNNNGCTTNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGNCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATNNTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTNCAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAANTGTGCTATGTTNCTCTGGNCTTTGAGCAGAG
  5   1   2       bld Ga18 5g3  in                      xlk126d07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCGCATAGAAAGGAGANAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAANNNNGCTTNNNGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGNATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGNNTATNCTCTACCNNNNNNCATTCTGCGTCTGGNCTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAANCGTTCGTGATATCAAGGNGAAANTNTGCTATGTTNCTCTGGACTTTGAGCA
  5   1   2       bld DMZ  5g3  in                         xl319n19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGAT
  5   1   2       bld DMZ  5g3  in                         xl319p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4970336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGNNAAAGAGCTATGAGCTGCCTGAA
  5   1   2       bld FaB  5g3  in                    IMAGE:8070940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGGACTTGAGCANGAGATGGCACAGCTGCCTCTTTCTCATCATGGAAAGGCTATGAGCTGCTGACG
  5   1   2       bld Spl  5g                         IMAGE:8462927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGGAAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGATTTGAGCAGAGATGGCCACGCTGCCTCTCTCATCATTGGAAAGACTTGACTGCTGACGACAGTCTCACATTGTACGACGTTTAATGTCGAGCCTCTCAGCATCTTCTGTAGGA
  5   1   2       bld Int2 5g                         IMAGE:8527285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCT
  5   1   2       bld Ga18      in                       xlk66a21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGCATAGAAAGGAGANAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCANNNNNGCTTTNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGGTATGTTGCATGACTTTTGGTATGTGATTATTTAGGGTGGGGTTGTTCTTAAATTTCTTTTTTTATATTTATGTAATTTGCTATCCATTACAGGGCTCTCCTGGCCTCAAAGTTTACTGGATTCTTTACAGGTTTCTATATTTGCCTGttttttttACAGCAAGGGTAGAATACTAACAATGTTAGGGTAGTGTGTGAAGAGTGCNNAATGGCTTGTATTTTAGAGTNCACTTTGCTTGTGTNGNttttttttCACNNTGGCCCTGCTGAATTAATCTCTTGTGTGCAGCAAANTCAATGTTGNGAATGTANNNNTNCATGGGGANTTNGA
  5   1   2       bld DMZ  5g3  in                         xl332c22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAG
  5   1   2       bld DMZ  5g3  in                         xl290f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl328c16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4058240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGCGTCCGGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGGTAACAGGGAGAAGATGACACAGATAAATGTCGAGACCTTTAACACTCCAGCTATGTATGGTGCCATTCCAGCTGGTGTGGTCCCTGATTGCATCGGTCGTACCACTGGTATT
  5   1   2       bld Emb4 5g                         IMAGE:4930690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCCTGACGGACAGTCATCACCATTGGGTACGAGGCGTTTTTAGATGTCCAGAGGCCCCTCTTTCAGCCATCCTTTCCTTGGGTATGGGAATCCCTGGCGGTATTCTTGAAAACCACTTACACCTCCAA
  5   1   2       bld Emb4 5g                         IMAGE:4681586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAAGAGAAATTGTGCTATGGTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGGCCTCTTCTTCATCATTGGGAAAAGAACTATTGAGCCTGCCTGAACGGAACAAGTCATCCACCATTGGGGAACGAAGGGTTTTTTAAAATGGTCCAAAGGGCCCTTCTTTCCCAGCCATCTTTTTCCTTGGGGAAAGGAAAATCCCC
  5   1   2       chi Brn1                            IMAGE:6954172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCGATAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCACGTGATGGTGTAACCCACACTGTGCCAATATATGAAAGGCTATGCCTCTACCCACATGCCAATTCTTGCGTCTCGGGACTTGGCCTTGGACGTTAACCCCTGACAGAACCTACCCTCCTATGAAAAAATCCCTTAACCTGGAAGAAGGGGTGGGATACCAGCGCTTTTCCAACCAAACCCCAACAAGTCTCCCGAAATTCGGAACGAACAAATTCTGCTTTTTCCCGTTGGGAAATAGTCCCCCCAGGGGGACCCaaaaaaaaTTTGGTATGGCCCCTATACTGGGTTTTGGACCTTTCTTGTGGGGAACCCTTTCTTTTAAAAGCCCCTAGGGGACAGAAAAATGTGGGACACCACACGAAGTACCATGGGACCAATGCCCCCTTTTCCTGTGCCCACATAATAGTTTCGCGTGAGAACCAACAAGAGTCCCTTTCCTCGCCAGACCCTCCGAGCCACTGACGAAACGGGGGAACCAAAAAGTTTCTCATTTCGCCCCCACAATTTGGTGGTCTATACCGCGAAAGCCCCCTACTTATTTAGGATACTTCTCTCCCCATATAGACGACCCCCCCTCACATATTTCCNCAGACCCCCAAACCCTATGTTCTCTCTCAACGGGTATACATGGGGTAAAT
  5   1   2       bld Te2  5g                         IMAGE:7208931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATAGAAAGGAGATAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCATGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTATGAGCAGGAGATCGCCACAGCTG
  5   1   2       bld Int2 5g                         IMAGE:8527401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATNCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGC
  5   1   2       bld Ga18 5g3  in                      xlk162h20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGNATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAANNNNGCTNNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAANCCACACTGTGCCAATATATGAAGGCTATNNTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGNNGAAANTNTNCTATGTTNNTCTGGACTTTGAGCAGGAGATGGC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACGCGTCCGGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGGTTACAGAAGCACCCCTTGAA
  5   1   2       bld Emb4 5g                         IMAGE:4682748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGGGCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCCATTGGTAACAAGCCGTTTTTAAATGGTCCAGAGGGCCCTCTTCCAGCCATCNTTTCCTTTGGGATGGGGAATCCT
  5   1   2       bld FaB  5g3  in                    IMAGE:8069563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTCCGGATTCCCGGGATCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGGTATGTTGCATGACTTTTGGTATGTGATTATTTAGGGTGGGGTTGTTCTTAAATTTCttttttttATATTTATGTAATTTGCTATCCATTACAGGGCTCTCCTNGGCCTCAAAGTTACTGGATTCTTTACAGGTTTCTATATTTGCCTGtttttttttCAGCAAGGGTAGAATATAACAATGTTAGGGTATGTGTGAAGATGCTAATGGCTGTATTTTAAGTTCACTTGCTTTGTGGTTTTTTTCACTTGGCCTGCCTGATTATCTCTTGGTGAGCATATCATGTTGGAATGACCAGCATGGGATTGATTACAGAATCCGCAATGCCTCTTAATC
  5   1   2       bld Ga18      in                       xlk78g23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNCATAGAAAGGAGANAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAANNNNGCTNNNNNGGGATGATGCTCCTCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGNATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTANNCCACACTGTGCCAATATATGAAGGCTATNNTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGNCGTGACCTGACAGACTANCTCATGAAAATCCTAACTGAGNNGGGNNNCAGCTTCACCACCACAGCCGAAAGAGAAATCGNTCGTGATATCAAGGAGAAATTNTNCTATGTTNNTCTGGACTTTNAG
  5   1   2       bld DMZ  5g3  in                         xl224e22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld Sp1  5g                         IMAGE:5511174.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGAANAGAGCTATGAGCTGCCTGACNGACAGTCATCACATTGGTACGAGCGTTTN
  5   1   2       bld Ga18 5g3  in                      xlk145g04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCATAGAAAGGAGANTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAANNNNGCTNNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGNACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACNCACACTGTGCCAATATATGAAGNCTATNNTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTNCAGCTTCACCACCACAGCCGAAAGAGAAATCGTNCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGANTTTGAGCAGGAGANG
  5   1   2       bld Ga18 5g3  in                      xlk117p03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCATAGAAAGGAGANAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCANNCNNGCTTTNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGNGTAACCCACACTGTGCCAATATATGAAGNCTATNNTCTACCACATGCCATTCTGCGNCTGGACTTGGCTGGNNGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGNNGGGGTANAGCTTCACCACCACAGCCGAAAGAGAAATCNNTCGTGATATCAAGNAGAAANTGTGCTATGTTNNTCTGGACTTTGAGCNNGA
  5   1   2       bld Ga18 5g3  in                      xlk119g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCATAGAAAGGAGANAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCANNNNNGCTTNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATNNTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCGTTTTAGATGTCCAGAGNCCTCTTCCAGCCATCTTTCCTTGGNATGGAATCCTGCGGTATTCATGAAANCACTTACAACTCAANTATGAAGNGNGATGTAGANNTCCGTAAGACCNTCTATGCCAAT
  5   1   2       bld Ga18 5g3  in                      xlk142b09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAANNNNGCTNNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATNCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGNTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTNGNAAAAGAGCTATGAGCTGCCTGANGGANAAGNCATCACCAT
  5   1   2       bld DMZ  5g3  in                         xl257h19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAAGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCNATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAANAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTANAGCTAACAGGGAGAAGATGACACAGATCATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCNAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCAT
  5   1   2       bld Emb3 5x                         IMAGE:3400220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGANTCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTG
  5   1   2       bld Egg1 5g3  in                    IMAGE:4783005.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACC
  5   1   2       bld Emb4 5g                         IMAGE:5572018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTNGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTTGAGAAGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTTGGTAACGANCCGTTTTAGATGTCCCGAAGGCCCTCCTTCCGCCATCTTTTCCTTGGTATGGAATCCCTGCGGTATTCATGAAAACCCCTTACAACTCCAATTATGAAAGTGGTGATGTAAAATATCN
  5   1   2       bld Sp1  5g                         IMAGE:5512250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCT
  5   1   2       bld Emb4 5g                         IMAGE:5515450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCNATGGAAAAGAGCTATGAGCTGCCTGACNGACAGTCATCACCATGGGTACGAGCGTTTAGATGTCAGAGGCCCTCTTC
  5   1   2       bld Te2  5g3  in                    IMAGE:7208469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAGAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATCGCCACAGCTGCCTCT
  5   1   2       bld FaB  5g3  in                    IMAGE:8071177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTC
  5   1   2       bld FaB  5g3  in                    IMAGE:8070284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACTACCACAGCCGAAAGAGAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTAAGCAGAGATGGCACAGCTG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4963719.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGATACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTC
  5   1   2       bld Emb4 5g                         IMAGE:5542006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCANGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCCACACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACCTTAAGCAGGAGATGGCCAAAGCTGCCTCTTCCTCCTCATTGGAAAAAACTATGAGTTGCCTGGAAGGACAATTTATTACAATTGGGAACGACCCGTTTCCTCTCGCCTACCCGTCCCCTTCCAAGCATCCTCTCCGCCGCTTGTGCCACCGTAGTGCCGTTCGCGAAACTATTGCCCCCATTTCCCCCGCTTCATCCGCCGCCTCCCACTCACCCCGTCAACGCGCGCTC
  5   1   2       bld Sp1  5g                         IMAGE:5511454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGA
  5   1   2       bld Sp1  5g                         IMAGE:5435349.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAAGGAGAAATGTGCTATGTTGCTTCTGGACTTTGAGCAAGAGAATGCCACAGCTGCCTCTTCTTCATCAATGGAAAAGG
  5   1   2       bld FaB  5g                         IMAGE:8071691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGC
  5   1   2       bld FaB  5g3  in                    IMAGE:8070529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAAT
  5   1   2       bld FaB  5g3  in                    IMAGE:8069679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCTGATATCAAGGAGAATTGTGCTAGTTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCTCTTCTTCATATTGAAAAGAGCTAGACTGCTGACG
  5   1   2       chi Tail                            IMAGE:8545159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATGCGAAACGGTCTGAGTGCTTCCTTTCCTCCAATCACAATGTAAGACGATTTTGACGCACTGATTCGTTGATTCTGCATCTCGTCTGTGCGAAACCAGCTTTACTGCTTATTATGCGCCCCCTGCTGTTTTCCCATCTTCTGCGTGTCGCCAAGCATTTCATGTTGTCATGTTTATAATGCCACAAATACATATCAATCTATCAAATAACTCTCTGACCAAAAGATGTATTCTTACACACTTATATCCGATTGAGCTCGGTCATTGTCTCCACTGGGATGATATAGAAGTATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATGTGCTATGTTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCCTCTCTTCTCATTGNAAAGACTATGACTGCTGACGACAGTCTCACATTGTACGACGTTTAATTCAGAGCCTCTCCACTCTTCTTGTATGATCTG
  5   1   2       bld Thy  5g3  in                    IMAGE:8549354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTTGAGCAGAGATGGCACAGCTGCCTCTTCTCATCATTGAAAAGAGCATGAGCTTGCTGACGACAGTCATCACATGGTACGAGCGTTTAAATTCAGAGCCTCTTCA
  5   1   2       bld Thy  5g                         IMAGE:8550023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNGNGTGCATCGATTCGATTNCGTCCCACCCTCAGATCACAATGGAAGACATATTNGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGNAATGTGCTATGTGCTCTGGACTTGAGCNGAGATGGCACAGCTGCTCTTCTCATCATTGNAAAGACTATGACTGCTGACNGACATCATCACATTGTACGAGCGTTAGAGTCAGAGCCCTCTCAGCTCTTCTNGTATGATCTGCGTATCTGACACTACATCATATGATGGAGAGATCCGAGGCTCTGCATACGTCGTGGTGACCATGACAGATGCTAGAGCAAGAAA
  5   1   2       bld DMZ  5g3  in                         xl229m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTT
  5   1   2       bld DMZ  5g3  in                         xl230m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAANGGAGACTGTCTGTGTGCGTCCAACCCTCANATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATAT
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3581396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4633840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAAGAGTATTCTTACACTCAAATATCCAATTGAACATGGCAATTTTACCCAATGGGATGATATTGAAAAA
  5   1   2       chi Emb4                            IMAGE:5537497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGCGTCCAGCTTCCCCACCACACCCGAAGAAGAAATCCCTCCCGGCTTCACAGGACACTTCGGACTCCGGTGTTCCGGGACTTTGGCCCAGCCAATGCCCACAACCTTGCCTCCTCTCCACCATCCGNAACAAAAGCAACCACACATCGCTTGGGCGGATACTCCTACCCCCGTTCGGTGTACCCACTGGTTCTCACACTCTATCCCCGGGCCCCCTTGCCCCGCGCGACCTTTTCCGGTACCGATCGACATTNCCCCCCGCGTAGCGCTAGTGAGTCGGANTCCCCCCGATGGCTACTCCCCCATAATTCGTTTCCCCGCAGCCGCCGTGTACCACACGATGCTCCCCGA
  5   1   2       bld Ov1  5g                         IMAGE:6316537.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCGTTTTAGATGTCCAGAGGCCCTCTTTCAGCCATCTTTCCCTTGGAATGGGAATCCGGCG
  5   1   2       bld Emb4 5g                         IMAGE:5514520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGGAGACAGCCCTTTTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTCCCTCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACTATGTACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4970112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGCGTCCGGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCNATGGAAAAGAA
  5   1   2       bld Emb9 5g                         IMAGE:7977562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTTCTGGACTTTGAACAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCAACCATTGGTTACGAGCGGTTTAGAATGTCAGAAGGGCCCTCTTTCCAGCCATTCTTTTCCTTGGATGGAACTCCTGCGGGGCATATTTCATGA
  5   1   2       bld Emb9 5g                         IMAGE:7977313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAGAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTTGACGGGAACAAGTTCATCACCATTTGGTTACGAGCGGTTTTTAG
  5   1   2       bld FaB  5g                         IMAGE:8073865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGAT
  5   1   2       bld Spl  5g                         IMAGE:8462169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGGCACAGCTGCCTCTTTCTCATCATTGNAAAGAGCTATGAGCTGCCTGACNGACAGTCATCACATTGGTACGAGC
  5   1   2       bld Int2 5g                         IMAGE:8526741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCTCTTCTCATCATTGAAAGACTATGACTGCTGATGACAGTCTCACATTGTACGACGTTTAAGTCAGAGGCTCTCAGCATCTTCTGTATGATCTGCGATCTGAACCTCATCATAGATGGATAATCGTAGCC
  5   1   2       bld Int2 5g                         IMAGE:8530421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGTTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCAC
  5   1   2       bld Spl  5g                         IMAGE:8463014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAAGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCTCCACCCAGCCGAAAGAAGATCGTTCGTGATATCAAGAGAATTGTGCTTGTTGCCTGGACTTGAGCAGAGATGGCCAGCTGCTCTTCTTCTCATGAAAAGCTTGACTGCTGACGAAGTCTCTCTTGGTACACGTTTAATCCAGGCCCTCAGCTCTTCTGATGATCGCGATCTGACCTT
  5   1   2       bld Int2 5g                         IMAGE:8531375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGGACTTGAGCANGAGAATGGCACAGCTGCCTCTTTCTCATCATTGGAAAGAGCTATGAGCTGCCTGACNGACAGTCATCACATTGGTACGAGCGTTT
  5   1   2       bld Thy  5g                         IMAGE:8549730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGATTTGAGCAGAGATGGCCACGCTGCTCTTCTCATCATGAAAAGAGCTATGACTGCTGACGACAGTCTCACATTGTACGACGTTTAAGTCAGAGCCTCTCNGCATCTTCTGTATGATCTGCGAA
  5   1   2       bld Thy  5g                         IMAGE:8551230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCCTCTCTCATCATGNAAAGACTATGACTGCTGACGACAGTCTCACATGGTACGACGTTTAAGTCAGAGCCTCTCAGCATCTTCTGTATGATCTGCGATCTGA
  5   1   2       bld Skin 5g                         IMAGE:8644550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAAGGGGTACAGCTTCACCACCACAGCCGAGAGAGAAATCGTTCGTGATATCAAGGAGAAATGTGCTATGTTGCTCTGGACTTGAGCAGGAGATGGCACAGCTGCCTCTTCTCATCATTGGAAAGACTT
  5   1   2       bld Ga18 5g3  in                       xlk64f24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGAAAGGAGANANTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGNTATGTGCAANNCGGCTTTCNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTNCACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCNNGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACNNACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTNCAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGNGAAATTNTNCTATGTTNCTCTNGACTTTGAGCNGNNGNNGGCCACAGCTGCNNCTTCTTCATCATTNGNAAAAGAGCTATGAGCTGCNT
  5   1   2       bld DMZ  5g3  in                         xl221a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl222a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATAT
  5   1   2       bld DMZ  5g3  in                         xl223e06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCA
  5   1   2       bld DMZ  5g3  in                         xl306a03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGA
  5   1   2       bld DMZ  5g3  in                         xl263d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTT
  5   1   2       bld DMZ  5g3  in                         xl309h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAA
  5   1   2       bld DMZ  5g3  in                         xl233n17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl262m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGAT
  5   1   2       bld Sp1  5g                         IMAGE:4963718.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGATTCAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGATTTTCTAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGGCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTA
  5   1   2       bld Emb4 5g                         IMAGE:5543599.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAGGAACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGGTAACGAAGCGTTTTAGAATGTCCAGAGGCCCTCCTCCAGGCCATCTTTTCCTTTGGGATGGAAACCCTTGCGGGATTTCATGAAAACCACCTTACAACTTCATTTTTGAAAGGGGGAATGTAAAATATCC
  5   1   2       bld Sp1  5g                         IMAGE:5513269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAAATGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTATCATNNGAAAGAGTATGAGCTGCTGACGACAGTCAC
  5   1   2       bld Ga15 5g3  in                       XL483p15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAG
  5   1   2       bld Ga15 5g3  in                       XL488m22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACA
  5   1   2       bld FaB  5g                         IMAGE:8074052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGNAAAAGAGCTATGAGCTGCCTGACNGACAGTCATCAC
  5   1   2       bld FaB  5g                         IMAGE:8072253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAGGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGGACTTGAGGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGGAAAGAGCTATGAGCTGCCTGACNGACAGTCATCACCATTGGTACGAGCGTTT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGG
  5   1   2       bld Tail 5g                         IMAGE:8545137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTCCCTCTCTCATCATGGAAAGAGCTTGACTGCTGACGACAGTCTCACATGGTACGACGTTAGATGTCAAGCCTCTCAGCATCTTCTGTATGATCTGCGATCAGAC
  5   1   2       bld Spl  5g                         IMAGE:8460347.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAGGAGAAATTGTGCTATGTTGCTCTGGACTTTNGAGCAGAGATGGCACAGCTGCCTCTTCTCATCATTGAAAAGACTATGAGCTGCTGAACGACAGTCATCACATTGGTACGAGCGTTTGATGTCAGAGGCTCTTCGCATCTTCTT
  5   1   2       bld Thy  5g3  in                    IMAGE:8550524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGNAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAAGGAGAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACACTGCTCTTCTTCTCATGGAAAAAGCTATACTGCTGACGACAGTCTCACATTGTACGAGCGTTAATTCAGAGCCTCTCAGCATCTCTGTATGATCTGCGATCTGACACTCATCATTGATGG
  5   1   2       bld Bone 5g3  in                    IMAGE:8739312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCTGACGACAGTCATCACCATTGGTACGAGCGTTTAGATGTCAGAGCCCTCTTCAGCCATCTTCCTGTATGATTCTGCGTAATCATGAATCACTTACACTCATTATGAAAGTGTGTGAATTGTTAGAAATATTCCGTA
  5   1   2       chi Panc                            IMAGE:8737348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAAGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAGAGAAATGTGCTATGTTGCTCTGACTTTGAGCAGAGAATGCCACAGCTGCTCTTCTTCATCAATGGAAAGAGCTATGGGCTGGCTGACGACAGTCTACTACCATTGACGACCTTGAGTTCGAAGCCTCTTCAGCCATCTTTTCTTTGGATGATCTCCGGCGATTCAGTGAC
  5   1   2       bld DMZ  5g3  in                         xl225a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4202725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAA
  5   1   2       bld Brn1 5g3  in                    IMAGE:4740974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAGACAGTCTGTGTGCGTCCANACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTTATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTA
  5   1   2       bld Sp1  5x3  out                   IMAGE:4964576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCC
  5   1   2       bld Emb4 5g                         IMAGE:5572509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCAACATTGGTAACCGAGCGGTTTTAAAATGTCCAGAGGCCCTCTTCCAGCCATCTTTTTCCTTGGTATGGA
  5   1   2       bld Emb4 5x                         IMAGE:5570546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGGAACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACCAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCACGTGATGGTGTAACCCCACACTGTGCCCATATATGAAGGCTATGGCTCTACCACATGCCATTTCTGCGTCTGGACTTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGGACAGGGGGGTACAGCTTTCCCACCAACAGCCCGAAAGAAAAAATCGTTCCGTGATATCAAGGGAAAAAATTGGGGCTATGGTGGTTCTGGAACCTTTGAACCCGGACAAAGGGCTCCCGACTTGCCTCCTTCTTTCACCATCGGGAAAAAAACACCTTGGAGGCTTGCCTAAATCGGGCTAAACGCCTAAACCCCTGGGGAAAAGGTAGTCCCTTTACCATTCTGAACGGAGGGCCTcccccccccGGACATATCTACCGCCTGGAAAATGGAAGAATCCTGCAGACGCATTCTGTTACAN
  5   1   2       chi Eye1                            IMAGE:6959606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGGAACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATTTTACAGTTAGGAGAATTATTTAGCCAGATACAATGCGGTAGCTTCTGCCAAAGCCAAGGACATGTTCCTGAGACTCAGCCTATGTAACTGCTGTCCCATTGTTTCAGATCAGTGTTGAGTAGGACAAGGTTTATAATCACGCCTTTGATAAAGCCTGTAAATGGCGGGTGAAACGAGCGTCAGGCGCTATTTTTATTCTGGATAGGCAGGGGTCCGCACTAAAGGTGGCCATACACGGGCAGATTAAAGCTGCCGATATCGGTCCCTTAGACCAATTCAGCATTTTATCTGCCCATGTGTGGGGGCAGATATCGATCGGTCAAGTTTGATTTTTTTGTACAATCCAGGACAGCATTGTCTAGTTGATGCGGTCCTGCGACCCGTCGGTGCCTATTCGTAGTATTGGAATCCGATCATCCGGCCCTAGGGCCGAACGTTTGGATTTATCCGATATTGCCCAGCCGTTAGTGGGCAATTGGGGGGTGAAGAATCCGCTCGTTTTGGGCGACCTTGCGGAAACGAGCGGGATCTTTATAAGTGTATGGGCCCACCTTTAAATTTACAGATCTTTAAGGGCCAGTCACAAGATTGCAAAAATTGGGGAGGTTGATTCACTGCGGGTGGAAAAAGGGTTTGGTGGGG
  5   1   2       bld Sp1  5g                         IMAGE:5512062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGNANAAGAGCTATGAGCTGCCTGACNGACAGTCATCACCATTGGTACGAGCG
  5   1   2       bld Sp1  5g                         IMAGE:5511427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAGAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTTCTCATCATTGNAAAGAGCTATGAGCTG
  5   1   2       bld Sp1  5g                         IMAGE:4965360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTCTTCATCATTTGGAAAGAGC
  5   1   2       bld Eye1 5g                         IMAGE:7020588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAGGAACAGTCTGTGTGCGTCCAACCCTCAGATCCAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGGTAACGAGCGTTTTTAGATGTCCCAGAGGCCCTCTT
  5   1   2       bld Ga15 5g3  in                       XL457k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAA
  5   1   2       bld FaB  5g3  in                    IMAGE:8071108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCTTCGTGATATCAGGAGAATTGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCCTCTCTCATCATTGAAAAAGCTTGAG
  5   1   2       chi FaB       in                    IMAGE:8070565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATACCTATGTAGGAGATGGTGGCCCTGCCAACAGAGTGTATCATACACTCGGATAGCCCTGTGTACATGGCATGAACCAAGACCAGGTACCATATGATCACAGTCTGTACATCACTCTGACTCTTAATACCACGATCCTCCCCTCAGCCTAATATAACGCTCCCCTCCCCTTAGAG
  5   1   2       bld FaB  5g                         IMAGE:8072240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGCCACAGCTGCCTCTTCTCATCATTGGAAAGAGCTATGA
  5   1   2       bld Spl  5g3  in                    IMAGE:8464003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGGAGACAGTCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGAG
  5   1   2       bld Tbd1 5g                              AW765422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTNACCCACACTGTGCCAATATATGGAAGGGCTATGGCTCTTACCACAATGCCCATTTCTGCG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGGCCCTGTAT
  5   1   2       bld Kid  5g                         IMAGE:4031921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCGCCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCGTTTTAGATGTCCAGAGGCCCTCTTTCAGCCATCTTTCCTTGGGATGGAAATCCTGCGGTATTTCATGAAACCACTTC
  5   1   2       bld Eye1 5g                         IMAGE:6959325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGAGAAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGGTAACGAGCGTTTTAGATGTCCAGAGGCCCTCTTCCAGCCATCTT
  5   1   2       bld Brn1 5x                         IMAGE:6956047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGGATGATATGGGAGAAAGATCTGGGCATCACACCTTTCTTACAATGAAACTGCGAAGTGGGCACCCGAAAAAAACACCCCAGTGGCCTGCTCAACAGAAAcccccccccTGAAATTCCCTAAAAGCCTTAAAAGGGGGAGAAAAAAATGGACCCCCCGATTTAATTGTTTTCCAAAAAACCCTTTTTAACACCCTCCCCCGCCTTTAGTGTTATgtttttccccctttccaaaaacccttgggtttttttcccccccgtgtttttggcaaatttttgggggggccgaaaacccccacccggggggaaaatttgtcccccaggggggccccccccccgggggggaaaaaagggggggttaaaaaccccccccccaccgtgggtgggcccccccaaatattttttttAAAAAGGGGGGGCCAAATGGCCCCCCTTATAAACAACCAAAAATGGTGCCCCCCAttttttttttCGCCGCTTTTCTGTGGGGGGAAACATTTTTTTGCCCCCGGGGGAGACAATTTTTAAAACCCCCCTTTTGaaaaaaaaaaaaaaaaa
  5   1   2       bld Eye1 5g                         IMAGE:6947218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGAGAAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAAGAGCTATGAGCTGCCTGACGGACAAGTCATCACCATTGGTAACGAGCCGTTTTAGATGTCCAGAGGCCCCTCTTCCAGCCATCTTTTCCTTGGTAA
  5   1   2       bld Eye1 5g                         IMAGE:7019629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGACAGTCTGTGTGCGTCCAACCCTCAGATTCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCCGAAAGAGAAATCGTTCGTGATATCAAGGAAAAATTGGGGCTATGTTTGCTCTGGAACTTTGAACCAGGAAGAAGGGCCACAGCCTGCCTCCTTTCTTCCATCATTGGaaaaaaaaGCTTATGAACCTGCCCTGACCGGACAAATTCCATCCCCCATTGGGTTAACCAAGCCGGTTTTAAGAATTGTCCAGAAAGCCCCCTCTTTTCTAACCCAATCCTTTTCCCTTGGGAAAGGGAAAATCCCTGGGCGGTAATTTTAAGGAAAA
  5   1   2       bld Ga15 5g                            XL485p19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGG
  5   1   2       bld Ga15 5g                            XL495g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCA
  5   1   2       bld Te2  5g3  in                    IMAGE:7390243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGATAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCATTGGAAAAA
  5   1   2       bld FaB  5g3  in                    IMAGE:8069735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCCCGGGATCTGTGTGCGTCCACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTACTGAGAGGGGTACAGCTTCACCACACAGCCGAAAGAAAATCGTTCGTGATATCAAGGAAAATTGTGCTATGTGCTTCGGACTTTGACAAGAGATGGCACAGCTGCCTCTCTTCTCATTGAAAAAAGCTATGACTC
  5   1   2       bld Spl  5g                         IMAGE:8460433.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCCTGACGACAGTCATCACATTGGTACGAGCGTTTAGATGTCAGNAGCCTC
  5   1   2       bld Thy  5g                         IMAGE:8549536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCACAGCTGCCTCTTCTCATCATTGAAAAGACTATGACTGCTGATGACAGTCTCACATTGTACGACGTTTAATTCAGAGCCTCTCAGCATCTTCT
  5   1   2       bld Ga18 5g3  in                       xlk54g24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGGAGNNAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCNNNNNNGCTTTNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGNGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATNNTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTNCAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAANTGTGCTATGTTNNTCTGGACTTTGAGCAGG
  5   1   2       bld Ga18 5g                           xlk119p01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGGAGNNAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCANNNNNGCTTNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTNCAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGNGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGNACTTTGAGCAGGAGATGGCCACAGNTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGNCTGACGGACAAGTCATCACCATTGGTAACGAGNGTTTTAGATGTCCAGAGGCCCTCTTNCCAGCCATCTTTCCTTGGNATGGANTCCNTGNGNATTCATGAAACCACTNNCAACTCAATTATGAAGNGTGATGNNNNNNNCCGTAAGNC
  5   1   2       bld Ga18 5g3  in                      xlk103e11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCANNNNNGCTTNNNNGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACCGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACNNACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGNCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATCGTTCGTGATATCAAGGNGAAANTGTGCTATGTTGCTCTGGNCTTTGAGCAGG
  5   1   2       bld DMZ  5g3  in                         xl266e04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCNAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTG
  5   1   2       bld Tbd5 5g                         IMAGE:3580130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACTGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGATAATCCTAACTGAGACGTGGTACAGCTTCACCATCACAGCCGATAAAGAAATCGTTCGTGATCTC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGTTTTTTCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTG
  5   1   2       bld Emb4 5g                         IMAGE:5515992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACAGTCTGTGTCGCTTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGC
  5   1   2       bld Ga15 5g3  in                       XL467o16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld FaB  5g                         IMAGE:8070443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATTGTCCCAGCTGCCTCTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8327976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAAGAATCGTTCGTGATATCAAGGAGAAATTGTGCTAG
  5   1   2       bld Int2 5g                         IMAGE:8530338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCCACAGCTGCCTCTTTCTCATCAT
  5   1   2       bld Int2 5g                         IMAGE:8529698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACAGTCTGTGTGCGTCCAACCCTCAGAATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCCGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCCTCTTCTTCATCATTGG
  5   1   2       bld Spl  5g                         IMAGE:8462652.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAATCGTTCGTGATATCAGGAGAAATGTGCTATGTGCTCTGGACTTGAGCAGAGATGGCACAGCTGCTCTTTCTCATCATGAAAGACTATACTGCTGACGACAGTCTCACATTGTACAGCGTTTAATGCAGAGCCTCTCAGCTCTTCTGNATGATCTGCGATCTGACACTACAT
  5   1   2       bld Int2                            IMAGE:8531028.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATNNNTNCCAGCTTANNNGAGAGCATCAATAAAATTCGTCCCGACGATATTGCCGCACTGGTCGTTGATAATCGATTTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCTTTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGATATTGTGCTATGTTGCTCTGGACTTTGAGCAAGAGATGGCCACGCTGCCTCTTCTCATCTTGGAAAGAGCTATGAGCTTGCTGAGGACAGTCATCACATTGGTACGAGCGTTTAAAGTCAGAGCCTCTTCAGCATCTTCTTGTATGATCTGCGTATCAGAACACTACACTCATTGAGTGGATAAATACA
  5   1   2       bld Int2 5g                         IMAGE:8531312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCANGAGATGGCACAGCTGCCTCTTCTCATCATTGGAAAGACTATGAGCTGCCTGACGACAGTCATCACATTGGTACGAGCGTTTAATGTCAGAGCCCTCTCAGCATTTNCNNTGATNGATCTGC
  5   1   2       bld Thy  5g3  in                    IMAGE:8548808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGAGATGGCCACAGCTGCCTCTTCTTCATCATTGGAAAGAGCTATGAGCTGCCTGACGGACAGTCATCACCATTGGGTAACGAGCGTTTTAGATGTCAGAGCCTCTTCAGCATCTTTCTGGTATGGATCTGCGTATCATGAACCACTTACACTCATATGAACTGTGAATGCAAATCGCTAGACCTTATCCATACGGTCTGGTCCTGAGTATGCTTACATCA
  5   1   2       bld DMZ  5g                              xl227k23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGACAGTCTGTGTGCGTTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl297c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACTGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGA
  5   1   2       bld DMZ  5g3  in                         xl297l15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl235b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTAACTGAGAGGGGGTACAGCTTCACCACCACAGCCGAAAGAGAAATCGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGA
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCTAACTGAAAGGGGTACAGCTTCACCACCACAGGCGACAGAGAAAT
  5   1   2       bld Sp1       out                   IMAGE:4964494.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTGGCTGGA
  5   1   2       bld Emb4 5g                         IMAGE:4959970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACCCACACTGTGCCAATATATGAAGGCTATGCTCTACCACATGCCATTCTGCGTCTGGACTTG
  5   1   2       bld Eye1 5g                         IMAGE:6958589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAAGTCTGTGTGCGTCCAACCCTCAGATCACAATGGGAAGACGATATTGCCGCACTGGTCGTTGATAATGGATCTGGTATGTGCAAAGCCGGCTTTGCTGGGGATGATGCTCCCCGTGCTGTTTTCCCATCTATTGTGGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAAAAAGATAGCTATGTAGGAGATGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCAATTGAACATGGCATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAACTGCGAGTGGCACCAGAAGAACACCCAGTGCTGCTCACAGAAGCACCCCTGAATCCTAAAGCTAACAGGGAGAAGATGACACAGATAATGTTCGAGACCTTTAACACTCCAGCTATGTATG