Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL461d05ex.5                         94 END     2           0        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL433e13ex.5.5                      237 PI      90         19      771                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7203937.5                      70 PI      76        116      495                (no blast hit)
     4   0.0    0Xl3.1-xl288k15.3                            4 PI      77        102      483                similar to H2A histone family, member V [Xenopus tropicalis]
     5   0.0    0Xl3.1-xl296g09.3                            2 PI      83        583      771                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012767038 Xl3.1-XL506a21ex.5 - 723 ESTs
                                                                       ........-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL506a21ex.5                                                                                                                                                                         TCCCGGATGCGCCGTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAAAAAAACTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTTAAATCATGGTATAAAAATACTGCCATTTTGTGGCTTTAATTTAGACCTGGCTGATAATACTCATGGGTTTTTGTTTTTTT
                                                  Xl3.1-CHK-1012684950                                                                                                                                                                               TxxxxxCGTCCCTTTTATAAAATTxGxCxGGxAxxAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAxxAxxxCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTTAAATCATGGTATAAAAATACTGCCATTTTGTGGCTTTAATTTAGACCTGGCTGATAATACTCATGGGTTTTTGTTTTTTTTTTTTA
                                                      consensus depths                                                                                                                                                                              3    13     3    14     4    16     7    23    19    49    34    80   227   358   306   476   365   552   379   563   391   578   474   592   489   598   536   600   578   606   572   611   589   613   588   614   591   624   594   629   610   629   608   633   601   635   614   636   613   638   617   641   619   644   628   653   639   659   638   659   636   660   644   662   647   662   650   664   657   669   654   672   651   674   666   679   664   683   662   683   661   679   663   677   657   674   663   677   663   676   652   674   658   672   648   668   657   671   657   673   647   670   610   668   610   665   543   657   519   654   530   652   526   650   407   641   350   632   305   613   243   564   202   359   199   325   187   305    86   168    19    34    19    33    16    29    14    26    13    23    12    22    12    19     9    15     9    13     7    11     6    11     6    10     6    10     4     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATATATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGCTTGATTTGTTTAATAAATGCATAATTGTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGATGGGTATGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------TG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------CA
                                               BLH ATG     115     552                                                                                                                                                                         
                                               BLH MIN     115      74                                                                                                                                                                         
                                               BLH MPR     115      74                                                                                                                                                                         
                                               BLH OVR     115     133                                                                                                                                                                         
                                               CDS MIN     115      78                                                                                                                                                                         
                                               EST CLI      67      78                                                                                                                                                                         
                                               ORF LNG     115       3                                                                                                                                                                         
  5   1   1       add Emb1                            IMAGE:6636570.5p tttttttttttttttttttttttttttttttACCATCATCCATGTTTGGGATTGGATTCCATATCTGAAACTGTTAACCAAAATGCTCTTTATTTATTGGGAAGGCCTCTGCCTTGGAGTCTACTTTAAGCAAATGTTTAAAGAAGCttttttttttttttcttttCTTGAAATTGGAAACTAAGCTGCATAACCCATTGGTGTTTTTATGTTTAAATGATTTTTAACAAACTTGGGTATGGGGGAAAAAGGACAAATTCCTTTATCCAAAAAGCCCTAAGTCCTGAGCATGCTGTAAAACGTATAGCATTGCATAAATATATTGATATATATGGGGGATTTTCCCCAttttttttttCTTTAGTTTCCAGTTGGGCGAATACACAAACTTCTGAAAAACAAAACTACCAGTCATGGGCGTGGGGGTGGTACAGCACCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGAAATGTAAAGGttttttttttttGGGAAGGGATTATGAATTTTTTAATTTTAAAGGGGCTGTTTGCCTTCCCACTACTCCCTTCAGTTTTTGGGGTTTCTTAAATTCACCCCCAATTTCTGTATCTTAAAGGGGTTATTCATCTTAAAATTGGCCCCTTAGTTGATCTTTTTTGAACTTTGGCCCTGCTGGGGGGAACCCCTGAGCTTTATTAAAGGCAGCTGTTTTTAATACAAAAGATGCTAATCTACCGATGGCTGGGGGAAAAAATGTTTCCCCTAATGGAGCAAAATTCTGCCTTTTAAAATAAAACCCCCCTTAAAAGGAAAGCTTTAAAGGTGGCCTTTGGAAACAATATAACAGGGGTTTGTGAAATACAACCTGGTTCTGCGC
  5   1   2       add Emb1                   IMAGE:6636570-IMAGp.IMAGp tttttttttttttttttttttttttttttttACCATCATCCATGTTTGGGATTGGATTCCATATCTGAAACTGTTAACCAAAATGCTCTTTATTTATTGGGAAGGCCTCTGCCTTGGAGTCTACTTTAAGCAAATGTTTAAAGTAGCttttttttttttttCTTTTCTTGGAATTGGAAACTAACCTGCATAACTCATTGTTGTTTTTATGTTTAAATGATTTTTAACAAACTTGGGTATGGGGGAAAAAGGACAAATTCCTTTATCCAAAAAGCCCTAAGTCCTGAGCATGCTGTAAAACGTATAGCATTGCATAAATATATTGATATATATGGGGGATTTTCCCCAttttttttttCTTTAGTTTCCAGTGGGTCGTATACACAAACTTCTGAAAAACAAAACTACCAGTCTTGGGCggggggggggAACAGCAGCAGGGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTAATGTAAAGGttttttttttttGGGAAGGTATTATGAATTTTTTAATTTTAAAGGGGCTGTTTGCCTTCCACACTACTC
  5  -1   2       bld Egg3                            IMAGE:6323535.5p          GTTAACCACTTTTATATGGTTTTTTCGGGGTCTACGTTAATTTTTGGGGGTGGAAAATTGGTGGAGGCGGGATAAAACCATTTTTCCACCCCCGGGAAAACAGGGCTTTTGGGCCCATGATTTTCGCCCCAAGTTTGGAAAATTTAACCCTCCATTAAAGGGGAACAAAAAGTGGGAGTTCCCACCGCgggggggggccgcttttttttttttttCGGTTTTCAGAGCTTTGTTTCGGGTTAAAGGAATAATTACAGGACTTGGTGAAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGTACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaagaaaaaaaaaaaaaGCGCCCGGGAA
  3   1   2       bld Ga18 5g3  in                      xlk132a05ex.3p                                                                                                       CCACGCGTCCGGGTTCAACCCAGAACAAGAGGAACGNCTTTCTATTGGTCGGGTTCTGANCCAAGTTCCCGGATGCGCTCGTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGNCTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGNNTGATT
  3   1   2       chi Ga15      in                       XL485e24ex.3p                                                                                                         CAATCAACTGTTCTGCTACATTGTTTTAAAAATTAGACCCTAGGCAGGAAAGAGGGGCAAACTGGGCCTTTGATCATAGCTGTAACTTTAAATCATTACATAGAATTTACGGTTTAATGAAATCACCATGGCAACTTTGCATTAGGCTAAGCAAATGTTCTGATGCATACACAGCCAGCACTAGGGTGCTTCTTGGTGTGTTGTAGGAAATGGTTTTGTCAACATTGTAATGTTTCATGGGCATTAGTGTTTATATACATTCTAATAACCATCCTCTCCATTCGCCCAGTAATAGGATTCTTGTATGGTTAAAATTGCTTTGCCTCGTTAACTTATCTGTTTTGACTATTGACATGTATTTGTTGAAATTTCAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  5   1   2       bld Ga18 5g3  in                      xlk132a05ex.5p                                                                                                                   GTTCAACCCAGAACAAGAGGAACGGCTTTCTATTGGTCGGGTTCTGAACCAAGTTCCCGGATGCGCTCGTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAANNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGNACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGNGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGNGGNGGAGTCANTCCACATATACACAAGTCCCTCATTGGAAAGNAANNNCNGCAGAAAACAGTCTAGGCAG
  5   1   2       bld Ga15 5g3  in                       XL417p09ex.5p                                                                                                                    CTCCGCCAGAACAAGAGGAACGGCTTTCTATTGGTCGGGTTCTGAACCAAGTTCCCGGATGCGCTCGTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCANACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCAT
  3   1   2       chi Thy       in                    IMAGE:8549279.3p                                                                                                                                     TAAAATTTAGACCCTAGACAGGAAAGAGGGGCAAACTGGGCCTTGATCATAGCCTGTAACTTTAAATCATTACATAGAATTTACGGTTAATGAAATCACCATGGCAACTTGCATTAGGCTAAGCAAATGTTCTGATGCATACACAGCCAGCACTAGGGTGCTTCTTGGTGTGTTGTAGGAAATGGTTTTGTCAACATTGTAATGTTTCATGGGCATTAGTGTTTATATACATTCTAATAACCATCCTCTCCATTCGCCCAGTAATAGGATTCTTGTATGGTTAAAATTGCTTTGCCTCGTTAACTTATCTGTTTTGACTATTGACATGTATTTGTTGAAATTTCAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATGTATAAACATGGAACAGCTACTCCCCCTTAATAAATAAAAAAACCAAAATTGT
  5   1   2       bld Tbd7 5g3  in                         XL067i13.5p                                                                                                                                           CGGGCTGCAGGNAATTCGGTCACGAGGNCCCGGNATGCGCTCGTCCCTTTTATAAAATTGGCCGGGTAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACC
  3   1   2       bld Ga18                             rxlk141e23ex.3p                                                                                                                                                         CNNGGACGCGTGGGGTTCCCGGATGCGCTCNTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGNCTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGNNTGATT
  3   1   2       bld Ga15 5g3  in                       XL430a15ex.3p                                                                                                                                                               AACCAAGTTCCCGGATGCGCTCGTCCCTTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGA
  5   1   2       bld Ga15 5g3  in                       XL430a15ex.5p                                                                                                                                                                AACCAAGTTCCCGGATGCGCTCGTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCANATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAANAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAAGTTGTTGGGANAT
  5   1   2       bld DMZ  5g3  in                         xl276j07.5p                                                                                                                                                                      GTTCTCGGATGCGCTCGTCCCTTTTATAAAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGT
  3   1   2       chi DMZ                                 rxl339d08.3p                                                                                                                                                                          AAATAAACACAACAAGCGTCCCCTCTGTGCATCTAGAGTAAGACAGCTATAGCTACAATTAATTCCAGACCCACAGACACCAGCCGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTTGTA
  5   1   2       bld DMZ  5g3  in                         xl227h20.5p                                                                                                                                                                                           CGNTTNNATTCGGNCGAGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGAC
  5  -1   2       chi Bla2                            IMAGE:7300364.5p                                                                                                                                                                                            AAGGACAAAGCTGAGCTCACGCGTGGGCGCCGCTCTAGACTAGTGATCCCCCGGCTGCAGAATTCTAAAGGAATAATACAGGACTGGTTGAGACAAATGCTGTNNGGCAAGGCTGCAANNGATACCGAAAANGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTGaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTAAGAAG
  3   1   2       bld Ga18 5g3  in                       xlk76g18ex.3p                                                                                                                                                                                                   AAATTGGCCGGGAAGAAAAGAAGCAGNCTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNCNNATGCTTGA
  5   1   2       bld Ga18 5g3  in                       xlk76g18ex.5p                                                                                                                                                                                                   AAATTGGCCGGGAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTNNNTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCNNTTCTGATGGNCTCTGGNTTTACAttttttttttATATATATANNCAANTTGNTGGGAGNNATATAAACATGGAACAGCTGATNNTTNATTTGTTTANTAAATGCANNNTGTTTGACTTNNNA
  5  -1   2       bld Bla2      in                    IMAGE:7296197.5p                                                                                                                                                                                                      CTGAGTTCACGCGTGCGGCGTCTAGACTAGTGATCCCCGGCTGCAGATTCTTCCGGTAAAGGAATATTACAGGACTTGTTGAGACAAATGGCTGGTGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTTTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTTTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTGaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCCCCAAGAACCCN
  5   1   2       bld DMZ  5g3  in                         xl317p19.5p                                                                                                                                                                                                          ATCGATTCGAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl244g06.5p                                                                                                                                                                                                          ATCGATTCGAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTT
  3   1   2       bld Ga15 5g3  in                       XL409g22ex.3p                                                                                                                                                                                                            GAAGAAAAGAAGCAGACTTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGA
  5   1   2       bld Ga15 5g3  in                       XL409g22ex.5p                                                                                                                                                                                                             GAAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCGCATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGaaaaaaaaa
  5   1   2       bld Egg5 5g                         IMAGE:3430207.5p                                                                                                                                                                                                              AGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGANCTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCACCCGTGTTATTCACGCGCTTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTA
  5   1   2       chi Ga15      in                       XL473i04ex.5p                                                                                                                                                                                                              CGTTTGTCAATACACTCGCATACACCCTCGGCTATTGTTGGAATGCTTTTACCCACAGGAAGTCGCCATGTTGGGAGTTGTAACGCGAGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAANANAA
  5   1   2       bld Ga15 5g3  in                       XL484d12ex.5p                                                                                                                                                                                                              AAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL517d15ex.5p                                                                                                                                                                                                              AAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTaaaaaaaaaa
  3   1   2       chi Ga15      in                       XL473i04ex.3p                                                                                                                                                                                                              CGTTTGTCAATACACTCGCATACACCCTCGGCTATTGTTGGAATGCTTTTACCCACAGGAAGTCGCCATGTTGGGAGTTGTAACGCGAGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATT
  3   1   2       bld Ga15 5g3  in                       XL517d15ex.3p                                                                                                                                                                                                              AAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCT
  3   1   2       bld DMZ  5g3  in                         xl227h20.3p                                                                                                                                                                                                              AAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGC
  5   1   2       bld Ga18 5g3  in                       xlk65j01ex.5p                                                                                                                                                                                                               AAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGNNNTATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGANTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                       xlk65j01ex.3p                                                                                                                                                                                                               AAGAAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGATT
  5   1   2       bld Ga18 5g3  in                       xlk67l20ex.5p                                                                                                                                                                                                                AGAAAAGAAGNAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCAGTTCTGATGGACTCTNGNTTTACAtttttttttATATATATATGCAAGNTGTTGGGAGATATATAAACATNGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                       xlk67l20ex.3p                                                                                                                                                                                                                AGAAAAGAAGCAGNCTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGNTTGANTTNTT
  3   1   2       bld DMZ  5g3  in                         xl244g06.3p                                                                                                                                                                                                                TCGAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGC
  5   1   2       bld Ga15 5g3  in                       XL429n19ex.5p                                                                                                                                                                                                                 AAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAANCCANTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCNANTTGTTGNGANATATATANACCNTGGAACANCTGATGCTTGATT
  3   1   2       bld Ga15 5g3  in                       XL429n19ex.3p                                                                                                                                                                                                                 AAAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACCAGGCTGATGCT
  5   1   2       bld Kid  5x3                        IMAGE:7008970.5p                                                                                                                                                                                                                  AAAGAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTTATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGTGTTTTACATCTTCTTTAATATACGCACGTTGGTGGAAGAAACAAAAACTTTGAACACCCGAGCTTATATTGTTTAATAATCAAATACGTTAAACTCATCTATATAACTAAGCCTCCCTCTAAGAATTGCGTTAAAGGCCCCCTACTTCTTCTCC
  3   1   2       bld Ga18 5g3  in                      xlk103o07ex.3p                                                                                                                                                                                                                  CCCNNNNGTCCNNCCNNNNNCCGCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACNNNNATNNTTGAT
  3   1   2       bld Ga18 5g3  in                        xlk5k10ex.3p                                                                                                                                                                                                                    CCCAANNGTCCGGNCNANGTCNGCCNNNNGTCCGCGGNTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTT
  3   1   2       bld Ga18 5g3  in                      xlk142l01ex.3p                                                                                                                                                                                                                    CCANNGTCCGNCCNNNNNCCGCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNTNAT
  3   1   2       bld Ga18                             rxlk104i22ex.3p                                                                                                                                                                                                                    CANCGTCCGNCCNNNNNNNGNAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGNNGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCANCTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGATT
  5   1   2       bld Egg3 5x3                        IMAGE:3378279.5p                                                                                                                                                                                                                     GAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAGAGGACAGCAGAGAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTNTCACATTCATCCAAGACTTAAATTCCAATTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTACAAGACGCCAGATCTGATGGACTCTGGTATTACATTTTGTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTGTTGTATAA
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749894.5p                                                                                                                                                                                                                     GGAATTCCCTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAGAGGACAGCAGAAAACAGTC
  3   1   2       bld Ga18 5g3  in                      xlk153c01ex.3p                                                                                                                                                                                                                     CCNNNNTCNGCCCACGCGTCCGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAANCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTNGGAGATATATAAACATGGAA
  3   1   2       bld DMZ  5g3  in                         xl317p19.3p                                                                                                                                                                                                                     GAAGCAGACTTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTTGATTG
  3   1   2       bld Ga18 5g3  in                      xlk122g07ex.3p                                                                                                                                                                                                                      CNNNGTCNGNCCNNNNNCNCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTG
  5   1   2       bld Ga15 5g3  in                       XL447l21ex.5p                                                                                                                                                                                                                         CGCGTCCGCGGACGCGCTGGGTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  3   1   2       bld Ga18                              rxlk76d02ex.3p                                                                                                                                                                                                                         CNNGGACGCGTGGGTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGAT
  5   1   2       bld DMZ  5g3  in                         xl329b07.5p                                                                                                                                                                                                                             ATCGATTCGTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl328e16.5p                                                                                                                                                                                                                             CGATTCGGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAA
  5   1   2       bld Gas3 5g3  in                      xlnga002c17.5p                                                                                                                                                                                                                              TTTCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTTCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATNTTTGACCAGTTTTCACATTCATCCAAGACTTANATTCCCATTTCAAAGCAGATGCTTTGTGGTTGTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTNTACATTNNTTTATATATACCAGTTGNTGGGAGATATATAAACATGGNACAGCTGATGCTTGATTTGTTTATAAATG
  3   1   2       bld Ga18                             rxlk132a23ex.3p                                                                                                                                                                                                                              GTCCGNGGACGCGTGGGTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACNNTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATG
  5   1   2       bld Ga15 5x3                           XL415l01ex.5p                                                                                                                                                                                                                               CCCACGCCGTCCGGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAANTTGTTGGGANATATATAAACATGGAACANCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGNCT
  5   1   2       bld Egg4 5g3  in                    IMAGE:3745020.5p                                                                                                                                                                                                                                TCGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTA
  5   1   2       bld Emb4 5x3                        IMAGE:4930084.5p                                                                                                                                                                                                                                CCACGCGTCCGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaaaaaaaG
  3   1   2       bld Tbd7 5g3  in                         XL054f02.3p                                                                                                                                                                                                                                 GGTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCT
  3   1   2       bld Ga18 5g3  in                      xlk116k14ex.3p                                                                                                                                                                                                                                 CCACGNNTCCGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGC
  3   1   2       bld Ga18 5g3  in                       xlk78g09ex.3p                                                                                                                                                                                                                                 CCCACGCGTCCGGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGAT
  5   1   2       bld Tbd7 5g3  in                         XL054f02.5p                                                                                                                                                                                                                                  GTGTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGT
  3   1   2       bld Ga15                               XL470h11ex.3p                                                                                                                                                                                                                                  CCGCGATCTAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  3   1   2       bld Ga18 5g3  in                      xlk158e01ex.3p                                                                                                                                                                                                                                  CCACGCGTCCGGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNCNGATGCTTG
  5   1   2       bld Ga15 5g3  in                       XL459k02ex.5p                                                                                                                                                                                                                                   CTCCGCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL464l02ex.5p                                                                                                                                                                                                                                   CGCTCCGGCTTGGTGGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATA
  5   1   2       bld Gas4 5g3  in                    IMAGE:3421294.5p                                                                                                                                                                                                                                    CTTTGGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACC
  5   1   2       bld Ga15 5x3                           XL419d01ex.5p                                                                                                                                                                                                                                    GTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGNGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGNTGGGAGATATATAAACATGGANCNGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGATG
  3   1   2       bld Ga15 5x3  out                      XL498p18ex.3p                                                                                                                                                                                                                                    CNTCAGAGCTCCGTGTTCGGGTTAANGGAATAANNACAGGNCTTGGTTGAGNCANAATGNCTGGTGGCAAGGCNGGCAAAGATNCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGNTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTNTGAAAAACNGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGNGTATACAGCTGCTATCTTGGAATATCNNACTGNTGAGGTTCTTGAATTGGCTNGAAATGCTTCCAAAGACCTTAAGGNGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATCGGATGCTCNTATAAAAGCAACTATNGNTNGNGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGANAACAGTCTAGGCAGAGTCAGGACACCAAGACACTGATCAGACTTGTGCCGCGTTCTTNTGGAAGNTATTTNCGACCAGTTTTCACATTCATCCAAGNCNTAANTTCCCATTTCAAAGCAGATGCTTNGTGGTTTTAATGTTACCNTGGCTTCCAAGAAGCCAGTTCTGATGGACTNCGGTTNNACATTNTCTTTATANATATGCAAGTTGTNGGGAGATATA
  3   1   2       bld Ga15 5g3  in                       XL458m14ex.3p                                                                                                                                                                                                                                    TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTTGGTTGAGACAAAATGGCTGGTGGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGATT
  3   1   2       bld Ga18 5g3  in                       xlk54l07ex.3p                                                                                                                                                                                                                                    CCNNNNTCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNTNATGCTTGATT
  5   1   2       bld DMZ  5g3  in                         xl286a19.5p                                                                                                                                                                                                                                    ATCGATTCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCANAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCNAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGAA
  3   1   2       bld DMZ  5g3  in                         xl328e16.3p                                                                                                                                                                                                                                    GTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  3   1   2       bld DMZ  5g3  in                         xl329e16.3p                                                                                                                                                                                                                                    GTTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCNATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGANNG
  5   1   2       bld DMZ  5g3  in                         xl337g14.5p                                                                                                                                                                                                                                    ATCGATTCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTG
  5   1   2       bld Gas5 5g3  in                    IMAGE:3748463.5p                                                                                                                                                                                                                                     GGAATTCCCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAG
  5   1   2       bld Ga15 5x3                           XL403k20ex.5p                                                                                                                                                                                                                                     TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGA
  5   1   2       bld Ga15 5g3  in                       XL467n21ex.5p                                                                                                                                                                                                                                     TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL476a06ex.5p                                                                                                                                                                                                                                     TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk129b11ex.3p                                                                                                                                                                                                                                     CNNNNTCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGNNNNGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACNNNNATGC
  5   1   2       bld DMZ  5g3  in                         xl336g14.5p                                                                                                                                                                                                                                     TCGATTCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTG
  3   1   2       bld DMZ  5g3  in                         xl271d16.3p                                                                                                                                                                                                                                     ATTCGGCACGAGGGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGAACCAGCTGATGCTGA
  5   1   2       bld Egg3 5g3  in                    IMAGE:3377512.5p                                                                                                                                                                                                                                      CCGGGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTCTTCACATTCATCCAAGACTTGAATTCCCATTTCAAAGCAGATGCTTGGTGGTTCTAATGTTACCATGGCTGCCAAGATGCCATTCTGATGGACTCTGGTTTACATTCTTATATAATATATGCAAGTGCTGGGAGATATATAACGTGGAAAGCTGATGCTGAT
  5   1   2       bld Ga15 5g3  in                       XL458k24ex.5p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL458m14ex.5p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL462g03ex.5p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACANCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGACaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL468b22ex.5p                                                                                                                                                                                                                                      CGCTCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL479e01ex.5p                                                                                                                                                                                                                                      CGCTCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCACTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGANATATATANAACATGGAACNNCCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGAANAAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL462g03ex.3p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTG
  3   1   2       bld Ga15 5g3  in                       XL474f14ex.3p                                                                                                                                                                                                                                      CCCACGNGTCCGGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTGATTGT
  5   1   2       bld Ga18 5g3  in                      xlk110e12ex.5p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTNGNGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTNGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATNAACATGGANNAGCTGATGCTTGATTTGTTTAATAAATGCNTAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk152f11ex.5p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNNTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk127b14ex.3p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                      xlk124m12ex.3p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAANNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAAC
  3   1   2       bld Ga18 5g3  in                      xlk152f11ex.3p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGNATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCNCCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  5   1   2       bld Ga18 5g3  in                      xlk127b14ex.5p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGNACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGNTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTNGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGNCAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGNNCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCNAGACTTAAANTCCCATTTCAAAGCAGNNGNNTNGNGGNTTTNANNTTACCCT
  5   1   2       bld Ga18 5g3  in                      xlk124m12ex.5p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGNTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCNAAGCAGATGCTTGGNGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGNTGTTGGGAGANATATAANCATGGNNCAGCTGAT
  3   1   2       bld Ga18 5g3  in                      xlk110e12ex.3p                                                                                                                                                                                                                                      TTTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGNNANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNTGATGC
  3   1   2       bld DMZ  5g3  in                         xl321n07.3p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATA
  5   1   2       bld DMZ  5g3  in                         xl321n07.5p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTNG
  3   1   2       bld DMZ  5g3  in                         xl329b07.3p                                                                                                                                                                                                                                      TTCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTTGATT
  5   1   2       bld Gas8 5g3  in                    IMAGE:3516631.5p                                                                                                                                                                                                                                       AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAANCCTCTATCANCCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTANATTCCCATTTCAAAGCAGAT
  5   1   2       bld Ga15 5g3  in                       XL497p18ex.5p                                                                                                                                                                                                                                       TCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL497p18ex.3p                                                                                                                                                                                                                                       TCAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  5   1   2       bld Neu1 5g3  in                     Neu1-30F11-1.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAGGGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGA
  5   1   2       bld Ga15 5g3  in                       XL416j14ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL432c19ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTANCCTGAATTGACCATCTGTTCAATACTA
  5   1   2       bld Ga15 5g3  in                       XL445h07ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL450j24ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTA
  5   1   2       bld Ga15 5g3  in                       XL451e10ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga15 5g3  in                       XL451g14ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL423l07ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCTCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld Ga15 5g3  in                       XL461b09ex.5p                                                                                                                                                                                                                                        CANAGCTTGTGTTCGGGTTAANGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCNCCCGATCCTCCANAGCTGGNCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAANTACCANTCATGGGCGTGTGGGTGGTACAGCAGCAGAGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCANATGCTTGGTGGTTTTAAT
  5   1   2       bld Ga15 5g3  in                       XL461f23ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGAATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAC
  5   1   2       bld Ga15 5g3  in                       XL470e16ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAANNA
  5   1   2       bld Ga15 5g3  in                       XL518j15ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL416j14ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATNCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATNGAACCAGCTGATGCTG
  3   1   2       bld Ga15 5g3  in                       XL423l07ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCTCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL451e10ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL451g14ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACAGCTGATGCCTGATT
  3   1   2       bld Ga15 5g3  in                       XL456p06ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTG
  3   1   2       bld Ga15                               XL460k01ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGATTGT
  3   1   2       bld Ga15 5g3  in                       XL461f23ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCT
  3   1   2       bld Ga15                               XL461n15ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL470e16ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL518j15ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACAGCTGATGCT
  5   1   2       bld Ga15 5g3  in                       XL401f13ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCANTTCTGATGGACTCTGGTTTTACAttttttttATATATAT
  5   1   2       bld Ga15 5g3  in                       XL448l11ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2      seed Ga15 5g3  in                       XL506a21ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL401f13ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCNTGATTG
  3   1   2       bld Ga15 5g3  in                       XL448l11ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTG
  3   1   2       bld Ga15 5g3  in                       XL459k02ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTTGAT
  3   1   2       bld Ga15 5g3  in                       XL506a21ex.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTGATTGT
  5   1   2       bld Ga15 5g3  in                       XL456p06ex.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTAAAAAANNA
  5   1   2       bld Skin 5g3  in                    IMAGE:8641892.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAAAAATGCATAAATGTTTGACTTGaaaaaaaaaaaaaaaaaaaaaaaGGGCGGCCCGCAGG
  3   1   2       bld Skin 5g3  in                    IMAGE:8641892.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATAATAAACAGGAACAGCTGAGCTTGATTGTTAAAAGGCAATTTTTnnnnnnnnCCGG
  3   1   2       bld Skin 5g3  in                    IMAGE:8641870.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCAGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACTTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATAAAACAGGAACAGCTGATGCTGNTTNNNNNAAGNAATTTTTNNNNNNNCCCCC
  3   1   2       bld Ga18 5g3  in                      xlk131h03ex.3p                                                                                                                                                                                                                                        AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTNGAGACAAAATGGCTGGTGNNAAGGCTGGCAAAGATACCGGAAAAANCNAAGNCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGNATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTTAAATCATGGTATAAAAATACTGCCATTTTGTGGCTTTAATTTAGACCTGGCTGATAANACTCATGGGTTTTTGTTT
  5   1   2       bld DMZ  5g3  in                         xl271b03.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5g3  in                         xl246j02.5p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  3   1   2       bld DMZ  5g3  in                         xl246j02.3p                                                                                                                                                                                                                                        CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGATT
  5   1   2       bld Ga12 5g3  in                         XL199b14.5p                                                                                                                                                                                                                                         GAGGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGA
  3   1   2       bld Ga12 5g3  in                         XL201b14.3p                                                                                                                                                                                                                                         GAGGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAA
  5   1   2       bld Ga15 5g3  in                       XL471b08ex.5p                                                                                                                                                                                                                                         ACCCACGCGCTCCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL480b21ex.5p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGANNNNNA
  5   1   2       bld Ga15 5g3  in                       XL503o17ex.5p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL480b21ex.3p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGA
  3   1   2       bld Ga15 5g3  in                       XL503o17ex.3p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTGATTG
  5   1   2       bld Ga15 5g3  in                       XL412f19ex.5p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL412f19ex.3p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACAGCTGATGC
  5   1   2       bld Thy       in                    IMAGE:8549279.5p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTAATGTAGAGGCtttttttttttttGTGAAGGTATTATGAATTTTTTAATTTTAAAGGGGCTGTTTGCCTTCCACACTACTCACTTCAGTTTTTGGGGTTTCTTAAATTCACCCTCAATTTCTGTATCTTAAAGGGGTTATTCATCTTAAAATTGGTCCATTAGTTGATCTTTTTTTAACTTTGGTCCTGCTGGGCGGAATCCCTGAGCTTTATTAGAGGCAGCTGTTATTAATACAATAGATGCTAATCTACAGATGCTGTGGAGAAATGTATCCACTAATGTAGCAAATTCTGCTTTCAACTACAATCCCTTAAAATGAAGCATTAAGTTGCTTTGCATACTTTACAGGTCTGTCAATCAACTGTTCTGCTACATTGTTTTAAAAATTAGACCCTAAAAAGAAAGAAGGGCAAACTGGGGCTTTGATCTAGCTGTACTTTAAATCTTACTAGAAATTACGGTTAATGAATCCCCATGGAACTTTGCTTAGGTAAGCAAGTTTGAGCAACACGCCAGCCAGGGTGTTCTGTGGTTAAGATGGTTTGCACTTAAATTTA
  5   1   2       bld Skin 5g3  in                    IMAGE:8641870.5p                                                                                                                                                                                                                                         CGAGCTTGTGTTCGGTGTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAGAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCACAGCAGATGCTTGGTGGTATTGATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTGTTTCATCTATATGCCAGTTGNTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTATAATGCATAAATGTTGACTTGAAGaaaaagagaaaaaaaaTGGGCGCGCAAGCCTGATTCTCTAACTGGGTCGAGCCTCGCCTAAGTGGTCGATACCAAATCGACTGATATACTTGTGATTTGACACACAC
  3   1   2       bld Ga18 5g3  in                      xlk103f10ex.3p                                                                                                                                                                                                                                         CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCNTG
  3   1   2       bld Ga18 5g3  in                      xlk150i01ex.3p                                                                                                                                                                                                                                         GNCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAANNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGANCTGATCAGNCTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGNCCAGTTTTCACATTCATCCAAGNCTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTNCCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTNTTNGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                      xlk151i15ex.3p                                                                                                                                                                                                                                         CAGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  3   1   2       bld DMZ  5g3  in                         xl288j12.3p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGA
  5   1   2       bld DMZ  5g3  in                         xl248a02.5p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5g3  in                         xl288j12.5p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl248a02.3p                                                                                                                                                                                                                                         AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGAT
  5   1   2       bld Emb9 5x3                        IMAGE:7978487.5p                                                                                                                                                                                                                                          GAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTTGATTTGTTTTAATAAAATGCATAAATGTTTGACTTCaaaaaaaaaaCATAATCAA
  3   1   2       bld Ga18 5g3  in                      xlk116b19ex.3p                                                                                                                                                                                                                                          TCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTGAT
  3   1   2       bld Ga18 5g3  in                      xlk138g18ex.3p                                                                                                                                                                                                                                          TCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGNCCATCTGTTCAATACTAGGTTNNGAAGNTNNCGAA
  3   1   2       bld Ga18 5g3  in                        xlk7e16ex.3p                                                                                                                                                                                                                                          TCNGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANANNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGAT
  3   1   2       bld Ga18      in                      xlk119f15ex.3p                                                                                                                                                                                                                                          AGNNCTTGTGTTCGGGTTAAAGGAATAATNACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNCNAGGCANCCTCTATCACCCGATCCTCCAGA
  5   1   2       bld Ga18 5g3  in                      xlk160d06ex.5p                                                                                                                                                                                                                                          AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNCTTGATTTGTTTAATAAATGCATAATTGTTTGAANNAAA
  5   1   2       bld Ga18 5g3  in                      xlk149b12ex.5p                                                                                                                                                                                                                                          AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCANGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk127k11ex.3p                                                                                                                                                                                                                                          TCCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCNNGNNNNNNAANAAA
  3   1   2       bld Ga18 5g3  in                      xlk149b12ex.3p                                                                                                                                                                                                                                          AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGNCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTNGGAGATATATAAACATGGAANNNNGATGC
  3   1   2       bld Ga18 5g3  in                       xlk69g07ex.3p                                                                                                                                                                                                                                          AGAGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGAT
  3   1   2       bld Ga18 5g3  in                      xlk160d06ex.3p                                                                                                                                                                                                                                          AGAGCTTGTGTTCGGNTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGC
  3   1   2       bld DMZ  5g3  in                         xl276k08.3p                                                                                                                                                                                                                                          AATTCGGCACGAGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTG
  5   1   2       bld Tbd3 5x3                        IMAGE:3548344.5p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTA
  5   1   2       bld Ga15 5g3  in                       XL488b06ex.5p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL504f15ex.5p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTACTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCNAGACTTAAATTCCCATTTCNAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACNNNNNANA
  3   1   2       bld Ga15 5g3  in                       XL488b06ex.3p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL504f15ex.3p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15                               XL505f15ex.3p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCTG
  5   1   2       bld Ga15 5g3  in                       XL479a17ex.5p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAAATGTTaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL479a17ex.3p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATA
  3   1   2       bld Ga18 5g3  in                       xlk77p08ex.3p                                                                                                                                                                                                                                           CCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATANNNNNGGAANNCNNATGCTTGAT
  3   1   2       bld Ga18 5g3  in                      xlk140o21ex.3p                                                                                                                                                                                                                                           CCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTGA
  3   1   2       bld Ga18 5g3  in                      xlk158k13ex.3p                                                                                                                                                                                                                                           CCGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACNNNNATGCTTGATNTG
  5   1   2       bld Ga18 5g3  in                      xlk103o07ex.5p                                                                                                                                                                                                                                           ANNNNNGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGNTGGGAGATATATAAACATGGAACAGCTGATNCTTGANTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5g3  in                         xl280d05.5p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTT
  3   1   2       bld DMZ  5g3  in                         xl280d05.3p                                                                                                                                                                                                                                           AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATA
  3  -1   2       bld Neu4      in                    IMAGE:3556492.3p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTATATTCCCAT
  5   1   2       bld Gas8 5g3  in                    IMAGE:3516469.5p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGT
  5   1   2       bld Gas8 5x3                        IMAGE:3516530.5p                                                                                                                                                                                                                                            AGCTGGGGTTCGGGTTAAAGGAATAATAACAAGACTAGGCTGAGACAAAATGGCTGGTGGCACGGCTGGCAAACATACCGGAAAAGCCAAGGCAACCTATATCACCCAATCCTTCACAGCTGGTCTGCCCATTCCAGTCGGTCGTATACACAGACTCCTGAACAACAGAACTACCAGTCATGGGCGTGTGGGTGGGACAGCAGCAGAGGTACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATT
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402571.5p                                                                                                                                                                                                                                            CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048041.5p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAG
  5   1   2       bld Neu4 5g3  in                    IMAGE:4084480.5p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTG
  3   1   2       bld Ga12 5g3  in                         XL199b14.3p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCT
  3   1   2       bld Ga15 5g3  in                       XL459k01ex.3p                                                                                                                                                                                                                                            CTTGTGTTCGGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203134.3p                                                                                                                                                                                                                                            TCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGCAACAGCTGATGCATGATTTTTCTCCCACATCGCATAA
  3   1   2       bld Ga15 5g3  in                       XL433l01ex.3p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTTGATTGTTA
  5   1   2       bld Ga18 5x3                          xlk146g02ex.5p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGNTTAATAAANGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                       xlk78o21ex.3p                                                                                                                                                                                                                                            CCCACGCGTCCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATNCTT
  5   1   2       bld Ga18 5g3  in                      xlk147f11ex.5p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATNTTTGACTTG
  5   1   2       bld Ga18 5g3  in                       xlk78f16ex.5p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTNGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk116k14ex.5p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGNTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGNNGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATNGNANAGCTGNNGCTTGATTTGTTTAATAAATNCATAAATGTTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk153c01ex.5p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk147f11ex.3p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTGATNNNNTNAANAA
  3   1   2       bld Ga18 5g3  in                      xlk156c18ex.3p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATG
  5   1   2       bld Ga18 5g3  in                      xlk156c18ex.5p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGANTTGTTTAATAAATGCATAAATGTTT
  3   1   2       bld Ga18 5g3  in                        xlk1m24ex.3p                                                                                                                                                                                                                                            CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAAAAANCNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTANCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTNGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                       xlk78f16ex.3p                                                                                                                                                                                                                                            AGCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGATNTNTTNAA
  5   1   2       bld DMZ  5g3  in                         xl304e06.5p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGGTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl304e06.3p                                                                                                                                                                                                                                            GCTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGGTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTTGATT
  5   1   2       bld Ga15 5g3  in                       XL418n13ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL432h06ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL433c15ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCANACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAANTTGTTGNGANATATATAAACATGGAACANCTGATGCTTGATTTGTTTAATANATGCNTAAATGTTTNACTTNANAAAAA
  5   1   2       bld Ga15 5g3  in                       XL435i09ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL445a12ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACACATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGANATATATAAACATGGAACANCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAA
  5   1   2       bld Ga15 5g3  in                       XL453g06ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCANAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTANaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL454f23ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAANAAA
  5   1   2       bld Ga15 5x3                           XL457h16ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTA
  5   1   2       bld Ga15 5g3  in                       XL405l10ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGAANANNNNA
  5   1   2       bld Ga15 5g3  in                       XL469g16ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGANA
  5   1   2       bld Ga15 5g3  in                       XL473c09ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTA
  5   1   2       bld Ga15 5g3  in                       XL478a14ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL407b23ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL407o24ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACANCTGATGCTTGATTTGTTTAATAAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL485l15ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL486f09ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL490p10ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCANCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTANTCCACGTCACTTGCAACTTGCCATCANAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCNGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL506f06ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCANAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL507p13ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL513k16ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL514f19ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL491p10ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCANCAGTGTATACNGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCNAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCANAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCNAGACTTAAATTCCCATTTCAAANCAGATGCTTGGNGGTTTTANT
  5   1   2       bld Ga15 5g3  in                       XL492o18ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL496d20ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGANATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld Ga15 5g3  in                       XL409c20ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCNGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCNGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCANAGACCTTAAGGTGAAGCGTATTANTCCACNTCACTTGCAACTTGCCATCAGAGGTGATGAANAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCNTTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACANCA
  5   1   2       bld Ga15 5g3  in                       XL409i06ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL418n13ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL435i09ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTGAT
  3   1   2       bld Ga15                               XL441a18ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGATTGT
  3   1   2       bld Ga15 5g3  in                       XL451k03ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATA
  3   1   2       bld Ga15 5g3  in                       XL453g06ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL458k01ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL405l10ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACCAGCTGATGCTTGATTG
  3   1   2       bld Ga15 5g3  in                       XL468b22ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL469g16ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTG
  3   1   2       bld Ga15 5g3  in                       XL478a14ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGNGGTTTTAATGTTACCTNGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACANGGAACAGCTGATGCNTGATT
  3   1   2       bld Ga15 5g3  in                       XL479e01ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGA
  3   1   2       bld Ga15 5g3  in                       XL407o24ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTG
  3   1   2       bld Ga15 5g3  in                       XL490p10ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTG
  3   1   2       bld Ga15 5g3  in                       XL507p13ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCNTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGATT
  3   1   2       bld Ga15 5g3  in                       XL514f19ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTANNGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGAT
  3   1   2       bld Ga15 5g3  in                       XL492o18ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACGGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL496d20ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCNTGATTG
  3   1   2       bld Ga15 5g3  in                       XL409i06ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCTTGATTGT
  5   1   2       bld Ga15 5g3  in                       XL417k18ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCTTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL433l01ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL510l10ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAA
  3   1   2       bld Ga15 5g3  in                       XL417k18ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCTTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCT
  3   1   2       bld Ga15                               XL422j01ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTTGATTG
  3   1   2       bld Ga15 5g3  in                       XL432h06ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAANTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGNTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTG
  3   1   2       bld Ga15 5g3  in                       XL433h22ex.3p                                                                                                                                                                                                                                             TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL407b23ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTG
  3   1   2       bld Ga15 5g3  in                       XL510l10ex.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTTGATTG
  5   1   2       bld Ga15 5g3  in                       XL451k03ex.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTANNNNNNNA
  5   1   2       bld Em10 5x                         IMAGE:7983368.5p                                                                                                                                                                                                                                             GCTTGTGTTCGGGTTGAGGAATAACCACAGGACTTGGTTGAGACGAAATGGCTGGTGGCAAGGCTGGCCAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAGAACAGAACTACCGGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTAATGTAGAGGtttttttttttttGTGAAGGTATTATGAATTTTTTAATTTTAAAGGGGCTGTTTGCCTTCCACACTACTCACTTCAGTTTTTGGGGTTTCTTAAATTCACCCTCAATTTCTGTATCTTAAAGGGGTTATTCATCTTAAAATTGGTCCATTAGTTGATCTTTTTTGAACTTTGGTCCTGCTGGGCGGAATCCCTGAGCTTTATTAAAGGCAGCTGTTATTAATACAATAGATGCTAATCTACAGATGCTGTGGAGAAATGTATCCACTAATGTAGCAAATTCTGCTTTCAACTAACAATCTCTTAAAATGAAGCATTAAGTTGCTTTGCATACTTAACAGGTCTGTCAATCAACTGTTCTGCTACATTGTTTTAAAAATTAGACCCCTAGGAGGAAAGAAGGGCAAACTGGGCCTTGATCATAGCTGTAACTAAAATCATTCCTAGAATTTCCGTTTAATGAATCACCCTGCCACTTTGCATAGCTAAGCAATGTTCTGATCATACCACCACCC
  5   1   2       bld Ga18 5g3  in                      xlk151i15ex.5p                                                                                                                                                                                                                                             AGNNGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl256c06.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCTTGATT
  3   1   2       bld DMZ  5g3  in                         xl286a19.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAAC
  3   1   2       bld DMZ  5g3  in                         xl287k05.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTG
  3   1   2       bld DMZ  5g3  in                         xl258g12.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTTGATT
  3   1   2       bld DMZ  5g3  in                         xl288e13.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGANGC
  3   1   2       bld DMZ  5g3  in                         xl336g14.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCCAAGTTGTTGGGAGATA
  3   1   2       bld DMZ  5g3  in                         xl288o13.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGAAC
  5   1   2       bld DMZ  5g3  in                         xl256c06.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAA
  3   1   2       bld DMZ  5g3  in                         xl260p03.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  3   1   2       bld DMZ  5g3  in                         xl337g14.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATA
  5   1   2       bld DMZ  5g3  in                         xl319l14.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5g3  in                         xl287k05.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAA
  5   1   2       bld DMZ  5x3                             xl271m21.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTT
  5   1   2       bld DMZ  5g3  in                         xl276g19.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl288e13.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl288o13.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5g3  in                         xl260p03.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl272g22.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld DMZ  5g3  in                         xl277g19.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld DMZ  5g3  in                         xl258g12.5p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGACAAA
  3   1   2       bld DMZ  5g3  in                         xl278h18.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTNTGATGGACTNCTGGTTTTACATTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl319l14.3p                                                                                                                                                                                                                                             CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGC
  5   1   2       bld Gas3 5g3  in                      xlnga003c01.5p                                                                                                                                                                                                                                              TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTTGATTTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGACAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGATTTCACATTCATGCAAGACTTACATTCCCATCTCAGAGCAGATGCTTGGTGGATGTAATGGTACCATGGGCTCCAAGAAGCCAGCTCTGATGGACTCTGGGTGTACAttttttttATATATATGCAAGTTGTTGCGAGATATATAAACATGGTACAGCTGATGCTTGATTTGTTTATAAATG
  5   1   2       bld Tbd1 5x3                             AW871953.5p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCCAGTTTCACATTCATCCCAGACTTAAATTCCCATTTCAAAGCAGATGCTTTGTGGTTTTATTGGTACCCTTGCTT
  5   1   2       bld Gas8 5g3  in                    IMAGE:3516743.5p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCANAGCAGATGCTTG
  5   1   2       bld Emb1 5x3                        IMAGE:6866049.5p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTaaaaannannaaaaaaannnaaaaannnaaaaannnnnaaaaaaGGGCGG
  5   1   2       chi Egg3                            IMAGE:6866676.5p                                                                                                                                                                                                                                              GATTCCCGGGGGTTAAGGAATTTTCCAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCNGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTTCCAAAAAGCCAGTTCTGAATGGACTCTGGtttttacattttttttATATAATATGGCAAGTTTGTTTGGGAAAAAATTTTTTAAACCTTTGGGAAAACACCTTGAAGGGGCTTTGGAAATTTTTGTTTTaaaaaaaaaaaatgggccataaaaaaggggtgtttgaaaacccttttgaaaaaaanacaggaaaagcggcggggaacaataacattttggggggggggggggggcggccacaaaacacacaaatgagtcggggagggggggAAA
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203134.5p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaaaaaaaaaaaaaaaaGGG
  5   1   2       bld Ga15 5g3  in                       XL433h22ex.5p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGA
  3   1   2       bld Ga15 5g3  in                       XL498m16ex.3p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTGATTG
  3   1   2       bld Ga15 5g3  in                       XL409c20ex.3p                                                                                                                                                                                                                                              TTGTGTTNGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGAG
  3   1   2       bld Ga18 5g3  in                       xlk56l10ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                      xlk117f02ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANANNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGATNT
  3   1   2       bld Ga18 5g3  in                      xlk155d22ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTGAT
  3   1   2       bld Ga18                              rxlk70o21ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANANNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGNT
  3   1   2       bld Ga18 5g3  in                       xlk70o22ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGA
  3   1   2       bld Ga18 5g3  in                      xlk135n13ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANNCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGATTT
  3   1   2       bld Ga18 5g3  in                       xlk74p09ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTG
  3   1   2       bld Ga18 5g3  in                      xlk110n04ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGC
  3   1   2       bld Ga18 5g3  in                      xlk134a04ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAANNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTGATT
  3   1   2       bld Ga18 5g3  in                      xlk134m16ex.3p                                                                                                                                                                                                                                              CTTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGNTTGATNT
  3   1   2       bld DMZ  5g3  in                         xl271b03.3p                                                                                                                                                                                                                                              TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTGAT
  3   1   2       bld Ga15 5g3  in                       XL447l21ex.3p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCTTGATTGT
  5   1   2       bld Ga15 5g3  in                       XL498m16ex.5p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAANACTTANATTCCCATTTCAAAGCANATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCNANTT
  5   1   2       bld Ga18 5g3  in                      xlk158e01ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk78g09ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNANGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTNGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk110n04ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGANTT
  5   1   2       bld Ga18 5g3  in                       xlk56l10ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTNGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGNTGGGAGATATATAAACATGGAACAGCTGATNCTTGANTTGTTTANTANNGCATAAATGTNNAC
  5   1   2       bld Ga18 5g3  in                      xlk134a04ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNANGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGNTCTTCTGGANGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCNTTGGNGGGTTTNATGTTACCATGGCTTNCNA
  5   1   2       bld Ga18 5g3  in                      xlk134m16ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGANGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATG
  5   1   2       bld Ga18 5g3  in                       xlk70o22ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNNTTNGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGNTCTGATGGACTCTGGNTTTTACAtttttttttATATATATATGCAAGTTGNTGGGAGATATATNAACATNGNANNAGCTGATGCTTNANTTGTTTANNA
  5   1   2       bld Ga18 5g3  in                      xlk135n13ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGNCTCTNGGTTTTACAttttttttATATATATGCAAGTTGNTGGGAGANATATAAACATGGNAANAGCTGATGNTTGANTTGTTTAATAAATNCATNAATGTTTNACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                        xlk1m24ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCNAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk121o14ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGNGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGNCACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAANTTCCCATTTCAAAGCAGATGCTTGGNGGNTTTAATGTTACCTTGGCTTCCAAGAAGCCAGNTCTGATGGNNTCTGGNTTTTACAttttttttATATATATGCAAGT
  5   1   2       bld Ga18 5g3  in                       xlk61o19ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGNTGNTGGGAGANATATAAACATGNNNCAGCTGATNNTTGATTTGTTTNATAATGCATAAATGTTGACTT
  5   1   2       bld Ga18 5x3                          xlk144c23ex.5p                                                                                                                                                                                                                                               TTGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGNGGCAAGNTNGCAAAGATACCGGAAAAGCCAAGNCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGNCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTNTTGCTGGCGGNGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGNTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCNCATTTCAAAGCAGATGCTTGGNGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGNNCTGATGGACTCTGGNTTTACAttttttttATATATATNNNAGTTGTTGGGAGANNTATAAACATGGAANAGCTGANGCTTGANNG
  3   1   2       bld DMZ  5g3  in                         xl323n15.3p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAAGCTGATGCT
  3   1   2       bld DMZ  5g3  in                         xl275f17.3p                                                                                                                                                                                                                                               GGCACGAGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGAT
  3   1   2       bld DMZ  5g3  in                         xl276g19.3p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGC
  5   1   2       bld DMZ  5g3  in                         xl323n15.5p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl296d01.5p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  3   1   2       bld DMZ  5g3  in                         xl338p12.3p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGC
  3   1   2       bld DMZ                                 rxl230e10.3p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGC
  3   1   2       bld DMZ  5g3  in                         xl296d01.3p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGC
  5   1   2       bld DMZ  5g3  in                         xl338p12.5p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl339p12.5p                                                                                                                                                                                                                                               TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk127k11ex.5p                                                                                                                                                                                                                                                TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGNNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATNCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTNNNNNNANNAA
  5   1   2       bld Ga18 5g3  in                      xlk158k13ex.5p                                                                                                                                                                                                                                                TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                        xlk7e16ex.5p                                                                                                                                                                                                                                                TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTNGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk116b19ex.5p                                                                                                                                                                                                                                                TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCANTTCAAAGCAGATGCTTGGNGNNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGNCTCTGGNTTNCATTTTTTTATATATATGCAANNTGNTGGGNGNNNTATAAACATGGAACAGCTGATNNTTGATTTGTTTANAAATGC
  5   1   2       bld Ga18 5g3  in                      xlk136n17ex.5p                                                                                                                                                                                                                                                TGTGTTCGGGTTAAAGGANTAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGNNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAANTCCCATTTCAAAGCAGATGCTTGGNGGNTTAATGTTACCATGGCTTCCAAGANGCCAGTNTGATGGACTCTGGTTTACAttttttttATNTATATGCAAGT
  3   1   2       bld Ga18 5g3  in                      xlk136n17ex.3p                                                                                                                                                                                                                                                TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGGCTGGCAAAGATACCGGAANNNCAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTTAAATCATGGTATAAAAATACT
  3   1   2       bld Ga18 5g3  in                       xlk51b14ex.3p                                                                                                                                                                                                                                                TNNNGGTTAAAGGAATAATTANNGGACTTNNTTGAGACNAAAATGNCTGGTGGCAANGCTGGCAAAGATNCNGGNAAAANNNNAGGNAACCTCTATCACCCGATCCTCCAGAGCTGNNCTGCAGTTTCCNAGTTGGTCGTATACACAGNCTTCTGAAAAACAGANCTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACNCCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTGCTTCCAAGAANCCAGTTCTGATGGACTCTGGTTTTACATTTNTTTNATATATATGCAAGTTGTTNGGAGATATATAAACATGGAA
  3   1   2       bld DMZ  5g3  in                         xl287p16.3p                                                                                                                                                                                                                                                GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGATT
  3   1   2       bld DMZ  5g3  in                         xl302h17.3p                                                                                                                                                                                                                                                GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  5   1   2       bld DMZ  5g3  in                         xl287p16.5p                                                                                                                                                                                                                                                GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld DMZ  5g3  in                         xl292m11.5p                                                                                                                                                                                                                                                GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld DMZ  5g3  in                         xl302h17.5p                                                                                                                                                                                                                                                GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGGA
  3   1   2       bld DMZ  5g3  in                         xl292m11.3p                                                                                                                                                                                                                                                GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATA
  3   1   2       bld Ga15 5g3  in                       XL471b08ex.3p                                                                                                                                                                                                                                                 GGTCCGGGTTAAAGGAATAATTACAGGACTNGGTTGAGACAAAATGGGTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGNTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTNTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGA
  5   1   2       bld Ga18 5g3  in                       xlk51b14ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGNTTGATTTGTTTAATAAATGCATAAATGTTaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk77p08ex.5p                                                                                                                                                                                                                                                 TGTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACNNTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCANTTCTGATGGACTCTGGNTTTACAtttttttttATATATATANNCAANTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk69g07ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAttttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk129b11ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGNNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGNTCTTGAATTGGCTGGAAANGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAANTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGNGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGNACACCAAGAACTGATCAGACTTGTGCCGCGTNCT
  5   1   2       bld Ga18 5g3  in                       xlk54l07ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCANGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk131h03ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGNAACAGCTGATGNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGNNTGTCTTNNGTNCCATTTCATTCTTTATTTNNTNANNTAGCTGA
  5   1   2       bld Ga18 5g3  in                      xlk138g18ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGNA
  5   1   2       bld Ga18 5g3  in                      xlk117f02ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGNNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGNGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCNGTTCTGATNGNACTCTGGNTTTACAttttttttATATATATGCNAGTTGTTGGGAGANATATAAACATGGNACAGCTGATGCTTGNNTTNTTTAATAAATGCATAAATGTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk58p24ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGNTGNTGGGAGATATATAAACATGGAACAGCTGATNCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga18 5g3  in                      xlk103f10ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGANTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk121c05ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGNNATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGNNGGGNaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk122g07ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGNTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk74p09ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTNGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga18 5g3  in                      xlk140o21ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGNTGGGAGANATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld Ga18 5g3  in                      xlk155d22ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGANTAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk142l01ex.5p                                                                                                                                                                                                                                                 GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCNCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTA
  5   1   2       bld Gas6 5x3                        IMAGE:3473779.5p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATGTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTT
  5   1   2       bld Ga15 5x3                           XL426c05ex.5p                                                                                                                                                                                                                                                  ACCCACGCGNTCCGGGTTTACGAGGACTTGATTGAGATAAAAATGGCTGGAGGCAAGGCTGGCAAAGATACCGGAAAAGCTAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGGCTGCAGTTTCCAGTTGGTCGTATACATAGACTTCTGAAAAACAGAACTACCAGTCATGGACGTGTGGGTGGTACAGCAGCAGTATATACAGCTGCTATTTTGGAATATCTGACTGCTGAGGTCCTTGAATTAGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAANNAAAA
  3   1   2       bld Ga15 5g3  in                       XL486f09ex.3p                                                                                                                                                                                                                                                  TCGGGGTTAAAGGAATAATTACAGGGNCTNGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACNGGAAAAGCCAAGGCAACCTNTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTNGGGAGATATATAAACATGGAACAGCTGAG
  5   1   2       bld Ga15 5g3  in                       XL466g14ex.5p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAANNA
  5   1   2       bld Ga18 5g3  in                      xlk150i01ex.5p                                                                                                                                                                                                                                                  GTGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACANNTNNATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk161d19ex.5p                                                                                                                                                                                                                                                  TGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk161d19ex.3p                                                                                                                                                                                                                                                  TGTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  5   1   2       bld DMZ  5g3  in                         xl294b09.5p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl233k22.5p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAA
  5   1   2       bld DMZ  5g3  in                         xl271d16.5p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld DMZ  5x3                             xl250f01.5p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAAAA
  3   1   2       bld DMZ  5g3  in                         xl294b09.3p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATA
  3   1   2       bld DMZ  5g3  in                         xl233k22.3p                                                                                                                                                                                                                                                  GTTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCNTGATT
  3  -1   2       bld Neu4      in                    IMAGE:3557637.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGGCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTC
  5   1   2       bld Ga15 5g3  in                       XL431o17ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL447g13ex.5p                                                                                                                                                                                                                                                   TCCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL463m23ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAAC
  5   1   2       bld Ga15 5g3  in                       XL463p23ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTANCTTGAATTGACCATCTGTTCAATACTANGTTGTGAA
  5   1   2       bld Ga15 5g3  in                       XL474f14ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL475i17ex.5p                                                                                                                                                                                                                                                   TCCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL487k23ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGANNNAANAAA
  5   1   2       bld Ga15 5g3  in                       XL499f24ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCANCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAANCGTATTANTCCACGTCACTTGCAACTTGCCATCAAAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAANACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTCACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACANCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACT
  5   1   2       bld Ga15 5g3  in                       XL409i20ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCANTCATGGGCGTGTGGGTGGTACAGCANCANTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTANTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTNTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAA
  3   1   2       bld Ga15 5g3  in                       XL410i20ex.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL431o17ex.3p                                                                                                                                                                                                                                                   TTCGGGNTNAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATNCCGGAAAAGCCAAGGCAACCTNTATCACCCGATCCTCCAGAGNTGGTNTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTATGGCTTCCGAAGAAGCC
  3   1   2       bld Ga15 5g3  in                       XL466g14ex.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCNTGATTGTT
  3   1   2       bld Ga15 5g3  in                       XL487k23ex.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACAGGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL499f24ex.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL409i20ex.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCT
  3  -1   2       chi Bla2      in                    IMAGE:7296197.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTNCTATAAAAGCAACTATTGCTGGTGGGTGAGTCATTCACATATACACAAGTCCCTCATTGGAANGAANNGACAGCAGAAAACAGTCTANGCAGAGTCAGGACACCAAGACTGATCAGACTTGTGCGCCGTCTTCTGAAGCTTTTTTGACCAGTTTCACATCATCAAGACTTAATTCCCATTNCAAGCAATGCTGGGGTTNANGTAACAGGCTCCAAGAGCAGTCGAGGACCTGTANATNTTTTTATAAGCATGTGGAAATTAACTGACACGAGCTGATGTATTGCTATGTGATGAAAAAATCCGGGGGCCGCCATCCTATGCATATCTGCTCTACCGCGACG
  5   1   2       bld Ga15 5g3  in                       XL410i20ex.5p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAANAA
  3   1   2       bld Ga18 5g3  in                      xlk120k10ex.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAANCCAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTNGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                      xlk150p12ex.3p                                                                                                                                                                                                                                                   CCACGCGTCCGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAANANNCNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTNGGAGATATATAAACATGGAANNNTGAT
  3   1   2       bld DMZ  5g3  in                         xl276j07.3p                                                                                                                                                                                                                                                   TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGAT
  3   1   2       bld Ga18 5g3  in                      xlk166f23ex.3p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTNNGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNTNCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTNGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                      xlk115b07ex.3p                                                                                                                                                                                                                                                    TTCGGGTNNNNNGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNTGATGCTTGAT
  3   1   2       bld Ga18 5g3  in                      xlk143k23ex.3p                                                                                                                                                                                                                                                    TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTG
  3   1   2       bld Ga18 5g3  in                       xlk69f20ex.3p                                                                                                                                                                                                                                                    TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTNCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTGAT
  3   1   2       bld Ga18 5g3  in                      xlk152l08ex.3p                                                                                                                                                                                                                                                    TTCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGC
  3   1   2       bld Ga18 5g3  in                       xlk75d20ex.3p                                                                                                                                                                                                                                                    TTCGGGTTAAANNNATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGGCTGGCAAAGATNCCGGAANNNNAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGNTCTGCAGTTTCCAGTTGGTCGNATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTTAAATCATGGTATAAAAATACTGCCATTTTGTGGCTTTAATTTAGACCTGGCTGATAATACTCATGGGTTTTTNT
  5   1   2       bld DMZ  5g3  in                         xl242l24.5p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl241l24.3p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTG
  5   1   2       bld DMZ  5g3  in                         xl224h04.5p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5x3                             xl239d21.5p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTGCCTCTAGATTCTGCA
  3   1   2       bld DMZ  5g3  in                         xl242l24.3p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTG
  3   1   2       bld DMZ  5g3  in                         xl224h04.3p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAC
  5   1   2       bld DMZ  5g3  in                         xl241l24.5p                                                                                                                                                                                                                                                    TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAA
  5   1   2       bld Gas5 5x3                        IMAGE:3749007.5p                                                                                                                                                                                                                                                     CGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCA
  5   1   2       bld Ga15 5g3  in                       XL474i07ex.5p                                                                                                                                                                                                                                                     CGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15                               XL470g16ex.3p                                                                                                                                                                                                                                                     GGGTTAAAGGAATAATTACAGGGNCTTGGTNGAGACAAAATGGNTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCNTGGAATATATGACTGCCTGAGGTTTTTGAATTGGCTGGAAATGCTTCCAAAGNCC
  3   1   2       bld Ga15 5g3  in                       XL474i07ex.3p                                                                                                                                                                                                                                                     CGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGGCTGATGCT
  5   1   2       bld Ga18 5g3  in                      xlk115b07ex.5p                                                                                                                                                                                                                                                     TTCGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGNTGTTGGGAGANNTATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk69f20ex.5p                                                                                                                                                                                                                                                     TTCGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCNNAGCAGATGCTTGGNGGNTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCNAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTNTTNANAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga18 5g3  in                      xlk152l08ex.5p                                                                                                                                                                                                                                                     TTCGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld Ga18 5g3  in                      xlk120k10ex.5p                                                                                                                                                                                                                                                     TTCGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNNTTGGTGGNTTTAATGTTACCATGGCTTCCAAGANGNCAGNNCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATNGNNNAGCTGATGCTTGATTTG
  5   1   2       bld Ga18 5g3  in                       xlk75d20ex.5p                                                                                                                                                                                                                                                     TTCGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGCTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCNAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGNNNTGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGANNATCTGT
  5   1   2       bld Ga18 5g3  in                      xlk143k23ex.5p                                                                                                                                                                                                                                                     TTCGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGNTGNTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga18 5g3  in                      xlk166f23ex.5p                                                                                                                                                                                                                                                     TCGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTNCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTaaaaaaaaaa
  3   1   2       bld DMZ                                 rxl264g24.3p                                                                                                                                                                                                                                                     CGGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCTGATT
  3   1   2       bld Gas3 5g3  in                      xlnga003c01.3p                                                                                                                                                                                                                                                      TCGGGTAAAGGGATACTNCAAGACTGAGTGAGACATAATGGCTGGTGTCATGTCTGGCAAAGATACAGGAAGAGCCAAGGCGAACGTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAGAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAATCCCTCATTGAAAAGGAAGGTCAGCAGAAACCAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGAATAAATGTTTGGCTTGAAAAA
  3   1   2       bld Ga15 5g3  in                       XL461b09ex.3p                                                                                                                                                                                                                                                      GGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTAAATCAT
  3   1   2       bld Ga15 5g3  in                       XL513k16ex.3p                                                                                                                                                                                                                                                      GGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCTTGATT
  3   1   2       bld DMZ  5g3  in                         xl277g19.3p                                                                                                                                                                                                                                                      GGGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGATT
  5   1   2       bld Emb1 5x3               IMAGE:6636528-IMAGp.IMAGp                                                                                                                                                                                                                                                       GGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAATTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTA
  3   1   2       bld Ga15 5g3  in                       XL458k24ex.3p                                                                                                                                                                                                                                                       TTAAAGGGAATAATTACAGGACTTGGGTTGAGACAAAATGGCTGGNGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAG
  3   1   2       bld Ga15 5g3  in                       XL484d12ex.3p                                                                                                                                                                                                                                                       GGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL519m01ex.3p                                                                                                                                                                                                                                                       GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTGAT
  3   1   2       bld Ga15 5g3  in                       XL447g13ex.3p                                                                                                                                                                                                                                                       GGTTAAAGGAATAATTGCNGGANNTGGTTGAGACAAAATGGCTGGNGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTNTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL472l19ex.3p                                                                                                                                                                                                                                                       GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCNTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGNTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGA
  5   1   2       bld DMZ  5g3  in                         xl277l15.5p                                                                                                                                                                                                                                                       GGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Bla1 5g3  in                    IMAGE:3379836.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGGACAACAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTNCAAAGACCTAAAGTAAACCGATTAATGCACGTTAATTGCAACTTGCCACGGAAGTAGTGGAAGATTGGATGCTCTTATAAAAGCACCTATTGCTGGCGTGGAGTCATTCCACATAACACAAGNCCCTATTGGAAGAAAGGACAGCAAAA
  5   1   2       bld Emb1 5x3                        IMAGE:6636528.5p                                                                                                                                                                                                                                                        TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCNGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAATTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGCTAAACTAGCTGAATTGACCATCTGTTCAATACTAGGTTGTGAAGGTTGTCGAATAATGTTAAATCATGGTATAAAAATACTGCCCATTTTGTGGGCTTTAATTTACACCTGGGCTGATAATACCTCCTGGGtttttttgtttttttttttAAAACAATACCGGA
  5   1   2       bld Ga15 5g3  in                       XL416n14ex.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGAA
  5   1   2       bld Ga15 5g3  in                       XL484d18ex.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAAA
  5   1   2       bld Ga15 5g3  in                       XL486c24ex.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL519m01ex.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL416n14ex.3p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTG
  3   1   2       bld Ga15 5g3  in                       XL475i17ex.3p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL484d18ex.3p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTGT
  3   1   2       bld Ga18 5g3  in                       xlk53c22ex.3p                                                                                                                                                                                                                                                        TNNAANGNANNANTTACAGGACTNGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATNCCGGAAAANCNAAGNNAACCTCTATCACCCGANCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACNNTGAT
  3   1   2       bld Ga18 5g3  in                      xlk166p04ex.3p                                                                                                                                                                                                                                                        TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATNGCTGGTGGCAAGGCTGGCNNNGATACCGGAAAAANNCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTNGGAGATATATAAACATGGAA
  3   1   2       bld Ga18 5g3  in                      xlk117l11ex.3p                                                                                                                                                                                                                                                        GGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNTNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNAT
  5   1   2       bld Ga18 5g3  in                      xlk117l11ex.5p                                                                                                                                                                                                                                                        GGTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGNGGNTTTAATGTTACCATGGCTTCCAAGAAGCAGTTNCTGATGGACTCTGGTTTTACAttttttttttATATATATATGCNAGTNNTTGGGAGANATATAAACATGGAACAGCTGATGCTTGANTTGTTTAATAAATGCATAATTGTTTGANTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl240c23.3p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCCAAGTTGTTGGGAGATATATAAACCATGGAACCANCTGATGCTG
  5   1   2       bld DMZ  5x3  out                        xl314c22.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaCCCACCTG
  5   1   2       bld DMZ  5g3  in                         xl275f17.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAA
  5   1   2       bld DMZ  5g3  in                         xl276k08.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAA
  5   1   2       bld DMZ  5g3  in                         xl240c23.5p                                                                                                                                                                                                                                                        GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGT
  5   1   2       bld Gas5 5x3                        IMAGE:3747905.5p                                                                                                                                                                                                                                                         TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGACAACAGTCTANGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTAT
  5   1   2       bld Tbd3 5x3                        IMAGE:3548343.5p                                                                                                                                                                                                                                                         TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCA
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749208.5p                                                                                                                                                                                                                                                         TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAA
  5   1   2       bld Tbd5 5x3                        IMAGE:3581047.5p                                                                                                                                                                                                                                                         AAAGGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATTTGTTTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCA
  3   1   2       bld Tbd7 5g3  in                         XL076g18.3p                                                                                                                                                                                                                                                         GTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTNCTGATGGACNCTGGTTTTACTTTTTTTTTATATATATGCAAGTTGTTGGGAGTATATATAAACATGGCAACAGCTG
  5   1   2       bld Ga12 5x3                             XL145i11.5p                                                                                                                                                                                                                                                         GTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGT
  5   1   2       bld Ga15 5g3  in                       XL472l19ex.5p                                                                                                                                                                                                                                                         TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL486c16ex.5p                                                                                                                                                                                                                                                         TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL486c24ex.3p                                                                                                                                                                                                                                                         TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCT
  5   1   2       bld Ga18 5g3  in                       xlk78o21ex.5p                                                                                                                                                                                                                                                         GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNANGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTNTTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGCCANTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk111a12ex.5p                                                                                                                                                                                                                                                         GTTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGNNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGNTTGANTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL471n16ex.5p                                                                                                                                                                                                                                                          CTCCGAATAATTACAGGACTTGGTTGAGACAAAATGGCCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGA
  3   1   2       bld Ga15 5g3  in                       XL486c16ex.3p                                                                                                                                                                                                                                                          TAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCCTGATTG
  5   1   2       bld Ga18 5g3  in                      xlk109e15ex.5p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATNNTTGACTT
  5   1   2       bld Ga18 5g3  in                       xlk53c22ex.5p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNANGNTNGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGNTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTNNNANNNAAAAA
  5   1   2       bld Ga18 5g3  in                       xlk74d03ex.5p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGNTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga18 5g3  in                        xlk5k10ex.5p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNANGNTNGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATNNTTGANTTNNTTAATAAATGCATAAATGTTTGACT
  3   1   2       bld Ga18 5g3  in                      xlk109e15ex.3p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGC
  5   1   2       bld Ga18 5g3  in                      xlk166p04ex.5p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCANAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCNAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  3   1   2       bld Ga18 5g3  in                       xlk74d03ex.3p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTNAATGTTACCANNGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTNATATATATGCAAGTTGTTGNNA
  3   1   2       bld Ga18 5g3  in                      xlk111a12ex.3p                                                                                                                                                                                                                                                          TTAAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCANNCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGNCTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNANNNNNNTT
  5   1   2       bld Ga15 5g3  in                       XL489e03ex.5p                                                                                                                                                                                                                                                           TCCGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18                             rxlk111a10ex.3p                                                                                                                                                                                                                                                           AAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAAGATACCGGAAAAGCCAAGGCAACCTCTATCNNCCGATNCTCNAGANCTNNNNNGCAGTTTCCAGTTGGTCGTATANNCAGNCTTCTGAAAAACAGAACNNCCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGNCTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGNCCTTAAGGTGAAGCGTATTAGTCCNCGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  5   1   2       bld DMZ  5g3  in                         xl278g14.5p                                                                                                                                                                                                                                                           AAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  3   1   2       bld DMZ  5g3  in                         xl278g14.3p                                                                                                                                                                                                                                                           AAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  3  -1   2       bld Tbd4                            IMAGE:4060170.3p                                                                                                                                                                                                                                                            GGCAGACTGAATCCCCGGGGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTC
  5   1   2       bld Ga15 5x3                           XL426o17ex.5p                                                                                                                                                                                                                                                            AAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAAATGCATAAAATGTTTGACTTGGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk166i06ex.3p                                                                                                                                                                                                                                                            AAAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAANNCAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGC
  3   1   2       bld DMZ  5g3  in                         xl277l15.3p                                                                                                                                                                                                                                                            AAGGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGAT
  3   1   2       bld Ga15 5g3  in                       XL489e03ex.3p                                                                                                                                                                                                                                                             GGAATAATNNACAGGACNTGGTTGAGACAAAATGGCTGGTGGCAAGGNTGGCAAAGATNCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGNCTTNTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATNTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGA
  3   1   2       bld Ga15 5g3  in                       XL449c01ex.3p                                                                                                                                                                                                                                                              GGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCTGA
  3   1   2       bld Ga18 5g3  in                      xlk153m11ex.3p                                                                                                                                                                                                                                                              GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGGCTGGCAAAGATACCGGAANANNCCAAGGCANCCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACNTTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGA
  5   1   2       bld DMZ  5g3  in                         xl329e16.5p                                                                                                                                                                                                                                                              GGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld Ga15 5x3                           XL414k08ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTANCTGAATTGACCATCTGTTCAATACTANGTTGTGAAGGTTGTCCAAATAATGTT
  5   1   2       bld Ga15 5x3                           XL426p18ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGANATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGAAAAA
  5   1   2       bld Ga15 5g3  in                       XL449c01ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL468f06ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGANNA
  5   1   2       bld Ga15      in                       XL485e24ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTAATGTAGAGGtttttttttttttGGNANG
  5   1   2       bld Ga15 5g3  in                       XL500h17ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL493c13ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTANTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAANTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL468f06ex.3p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL500h17ex.3p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACCAGCTGATGCT
  3   1   2       bld Ga15                               XL493p10ex.3p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACAGCTGATGCTGATTG
  3   1   2       bld Ga15 5g3  out                      XL495p10ex.3p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAA
  5   1   2       bld Ga15 5g3  in                       XL476o20ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAATGGAATANNANNNNNAA
  3   1   2       bld Ga15 5g3  in                       XL476o20ex.3p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAC
  5   1   2       bld DMZ  5x3                             xl339c15.5p                                                                                                                                                                                                                                                               AAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAA
  5   1   2       bld Tbd1 5x3                             AW765276.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGGTGTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGGACTTGGTTTACATTTTTTNTATATATATTGCAGTTG
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3745711.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCT
  5   1   2       bld Emb4 5x3                        IMAGE:5571643.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAAGCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCCAGTTGTTGGGGAGATGTATAAACATGGAACAGCTGATGCTTGGATTTGTTTATAAATGCATAAATGTTTGACTTGaaaaaaaaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL426k20ex.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGATGGGTATGTCTTATGTGCCATTTCATTCTTTATTTGTTAAACTANCTGAATTGACCATCTGTTC
  5   1   2       bld Ga15 5g3  in                       XL473g01ex.5p                                                                                                                                                                                                                                                                GTTTAACGAGGACTTGATTGAGATAAAAATGGCTGGAGGCAAGGCTGGCAAAGATACCGGAAAAGCTAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGGCTGCAGTTTCCAGTTGGTCGTATACATAGACTTCTGAAAAACAGAACTACCAGTCATGGACGTGTGGGTGGTACAGCAGCAGTATATACAGCTGCTATTTTGGAATATCTGACTGCTGAGGTCCTTGAATTAGCTGGAAATGCTTCCAAAGACCTTAAGGTAAAGCGTATTAGTCCCCGTCACTTGCAGCTTGCCATTAGAGGTGATGAAGAATTGGACGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTTATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCACTGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAANAAAAANA
  5   1   2       bld Ga15 5g3  in                       XL485p14ex.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGANATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL490n18ex.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL471n16ex.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL473g01ex.3p                                                                                                                                                                                                                                                                GTTTAACGAGGACTTGATTGAGATAAAAATGGCTGGAGGCAAGGCTGGCAAAGATACCGGAAAAGCTAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGGCTGCAGTTTCCAGTTGGTCGTATACATAGACTTCTGAAAAACAGAACTACCAGTCATGGACGTGTGGGTGGTACAGCAGCAGTATATACAGCTGCTATTTTGGAATATCTGACTGCTGAGGTCCTTGAATTAGCTGGAAATGCTTCCAAAGACCTTAAGGTAAAGCGTATTAGTCCCCGTCACTTGCAGCTTGCCATTAGAGGTGATGAAGAATTGGACGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTTATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCACTGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCANGGAACAGCTGATGCTTGATTGTT
  3   1   2       bld Ga15                               XL483p24ex.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCNTGATTGT
  3   1   2       bld Ga15 5g3  in                       XL485p14ex.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  3   1   2       bld Ga15 5g3  in                       XL490n18ex.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGCT
  5   1   2       bld Ga18 5g3  in                      xlk151g10ex.5p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGANTTGTTTNATAAATGCATAAATGTTTGACTT
  3   1   2       bld Ga18 5g3  in                      xlk121m14ex.3p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNCNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCNTGAT
  5   1   2       bld Ga18 5g3  in                      xlk131f06ex.5p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATGCNAGTTGTTGGGAGNNATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk105b05ex.3p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  5   1   2       bld Ga18 5g3  in                      xlk153m11ex.5p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTT
  5   1   2       bld Ga18 5g3  in                      xlk121m14ex.5p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGNCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGNTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATATGCAAGTTGTTGGNGANATATNANCATGGANNAGCTGATGCNTGANTTGNTT
  3   1   2       bld Ga18 5g3  in                      xlk151g10ex.3p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAA
  5   1   2       bld Ga18 5g3  in                      xlk105b05ex.5p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTNTTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  3   1   2       bld Ga18 5g3  in                      xlk131f06ex.3p                                                                                                                                                                                                                                                                GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNNAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNNATGCTTG
  3   1   2       bld DMZ  5g3  in                         xl237o19.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  3   1   2       bld DMZ                                 rxl238o19.3p                                                                                                                                                                                                                                                                AATAATNACAGGACTNGGTTGAGNCAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGCTTNTGATGG
  5   1   2       bld DMZ  5g3  in                         xl230p16.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAtttttttttATATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAATTGTTTGACTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl324j17.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAANCATGGAACCAGCTGATGCT
  5   1   2       bld DMZ  5g3  in                         xl237o19.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGAAAA
  5   1   2       bld DMZ  5x3                             xl290n03.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGA
  5   1   2       bld DMZ  5g3  in                         xl324j17.5p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCNGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCANATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATANATGTTTGAC
  3   1   2       bld DMZ  5g3  in                         xl230p16.3p                                                                                                                                                                                                                                                                AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTTATATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  5   1   2       bld Ga18 5g3  in                      xlk150p12ex.5p                                                                                                                                                                                                                                                                 AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGNTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGNTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk145b09ex.3p                                                                                                                                                                                                                                                                 AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNCAAGGCTGGCAAAGATACCGGAANNNNNAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCNNNCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAANNNNGATGCTTGATT
  5   1   2       bld Ga18 5g3  in                       xlk61n22ex.5p                                                                                                                                                                                                                                                                 AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGNNANGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGANGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGNTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACAtttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTNNaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk145b09ex.5p                                                                                                                                                                                                                                                                 AATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGNTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGNTTTACATTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATNNTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  3   1   2       bld DMZ  5g3  in                         xl272g22.3p                                                                                                                                                                                                                                                                  TAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCCTGAT
  5   1   2       bld Ga15 5g3  in                       XL519f21ex.5p                                                                                                                                                                                                                                                                   AATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL519f21ex.3p                                                                                                                                                                                                                                                                   AATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAAACATGGAACAGCTGATGC
  5   1   2       bld Ga18 5g3  in                      xlk166i06ex.5p                                                                                                                                                                                                                                                                   TAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGNAAGNTGGCAAAGATACCGGAAAAGCCAAGGNAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATNCTTGGTGGNTTTAATGTTACCTTGGCTTCCAAGAAGNCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGANATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTT
  5   1   2       bld DMZ  5g3  in                         xl268n02.5p                                                                                                                                                                                                                                                                   AATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCANACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAANACTTAAATTCCCATTTCAAAGCANATGCTTGGTGGTTTTAATGTTACCNTGNCTTCCNNNAANCCANTTCTGATGNACTCTGNNTTTACNTTTTTTTNA
  5   1   2       bld Ga12 5x3                             XL143f04.5p                                                                                                                                                                                                                                                                    GTTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  5   1   2       bld Ga12 5g3  in                         XL201b14.5p                                                                                                                                                                                                                                                                    ATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTC
  3   1   2       bld DMZ  5g3  in                         xl238c08.3p                                                                                                                                                                                                                                                                     TTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  5   1   2       bld DMZ  5g3  in                         xl238c08.5p                                                                                                                                                                                                                                                                     TTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  3   1   2       bld DMZ  5g3  in                         xl302e13.3p                                                                                                                                                                                                                                                                     TTACAGGACTTGGNTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  5   1   2       bld DMZ  5g3  in                         xl302e13.5p                                                                                                                                                                                                                                                                     TTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  5   1   2       bld Gas6 5x3                        IMAGE:3438009.5p                                                                                                                                                                                                                                                                      TACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTG
  5   1   2       bld DMZ  5g3  in                         xl221l15.5p                                                                                                                                                                                                                                                                      TACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl221l15.3p                                                                                                                                                                                                                                                                      TACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACCATGGAACCAGCTGATGCT
  3   1   2       bld DMZ  5g3  in                         xl268n02.3p                                                                                                                                                                                                                                                                      TACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCCAAGTTGTTGGGAGATATATAAA
  5   1   2       bld Ga10 5x3                        IMAGE:3558171.5p                                                                                                                                                                                                                                                                       CAGGACTTGGTTGAGAAAAAATTGCTGGTGGCAAGGCTGGCAAAGATACCCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTT
  5   1   2       bld Neu7 5g3  in                         XL006b11.5p                                                                                                                                                                                                                                                                       GCAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCT
  3   1   2       bld Ga12 5g3  in                         XL216g14.3p                                                                                                                                                                                                                                                                       GCAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTGTTTAATAAA
  5   1   2       bld Ga12 5g3  in                         XL216g14.5p                                                                                                                                                                                                                                                                        CAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTG
  5   1   2       bld Ga15 5g3  in                       XL512i08ex.5p                                                                                                                                                                                                                                                                        CAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL512i08ex.3p                                                                                                                                                                                                                                                                        CAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACATTTTTTTTATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTGTT
  5   1   2       bld Ga15 5x3                           XL473o17ex.5p                                                                                                                                                                                                                                                                        CAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGCGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCATGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTGaaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl250m14.5p                                                                                                                                                                                                                                                                        CAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGTTTTACAttttttttATATATATGCAAGTTGTTGGGAGATATATAAACATGGAACAGCTGATGCTTGATTTGTTTAATAAATGCATAAATGTTTGACTTG
  3   1   2       bld DMZ  5g3  in                         xl250m14.3p                                                                                                                                                                                                                                                                        CAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTAGGCAGAGTCAGGACACCAAGAACTGATCAGACTTGTGCCGCGTTCTTCTGGAAGCTATTTTTGACCAGTTTTCACATTCATCCAAGACTTAAATTCCCATTTCAAAGCAGATGCTTGGTGGTTTTAATGTTACCTTGGCTTCCAAGAAGCCAGTTCTGATGGACTCTGGT