Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL461d05ex.5                         94 END     2           0        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL433e13ex.5.5                      237 PI      90         19      771                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7203937.5                      70 PI      76        116      495                (no blast hit)
     4   0.0    0Xl3.1-xl288k15.3                            4 PI      77        102      483                similar to H2A histone family, member V [Xenopus tropicalis]
     5   0.0    0Xl3.1-xl296g09.3                            2 PI      83        583      771                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012767038 Xl3.1-XL506a21ex.5 - 723 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                              3    13     3    14     4    16     7    23    19    49    34    80   227   358   306   476   365   552   379   563   391   578   474   592   489   598   536   600   578   606   572   611   589   613   588   614   591   624   594   629   610   629   608   633   601   635   614   636   613   638   617   641   619   644   628   653   639   659   638   659   636   660   644   662   647   662   650   664   657   669   654   672   651   674   666   679   664   683   662   683   661   679   663   677   657   674   663   677   663   676   652   674   658   672   648   668   657   671   657   673   647   670   610   668   610   665   543   657   519   654   530   652   526   650   407   641   350   632   305   613   243   564   202   359   199   325   187   305    86   168    19    34    19    33    16    29    14    26    13    23    12    22    12    19     9    15     9    13     7    11     6    11     6    10     6    10     4     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATATATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGCTTGATTTGTTTAATAAATGCATAATTGTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGATGGGTATGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------TG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------CA
                                               BLH ATG     115     552                                                                                                                                                                         
                                               BLH MIN     115      74                                                                                                                                                                         
                                               BLH MPR     115      74                                                                                                                                                                         
                                               BLH OVR     115     133                                                                                                                                                                         
                                               CDS MIN     115      78                                                                                                                                                                         
                                               EST CLI      67      78                                                                                                                                                                         
                                               ORF LNG     115       3                                                                                                                                                                         
  3   1   2       chi DMZ                                 rxl339d08.3p                                                                                                                                                                          AAATAAACACAACAAGCGTCCCCTCTGTGCATCTAGAGTAAGACAGCTATAGCTACAATTAATTCCAGACCCACAGACACCAGCCGAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTTGTA
  3   1   2       bld Ga18      in                      xlk119f15ex.3p                                                                                                                                                                                                                                          AGNNCTTGTGTTCGGGTTAAAGGAATAATNACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAANNNCNAGGCANCCTCTATCACCCGATCCTCCAGA
  3   1   2       bld Ga15                               XL470g16ex.3p                                                                                                                                                                                                                                                     GGGTTAAAGGAATAATTACAGGGNCTTGGTNGAGACAAAATGGNTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCNTGGAATATATGACTGCCTGAGGTTTTTGAATTGGCTGGAAATGCTTCCAAAGNCC
  5   1   2       bld Ga15      in                       XL485e24ex.5p                                                                                                                                                                                                                                                               GAATAATTACAGGACTTGGTTGAGACAAAATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTAATGTAGAGGtttttttttttttGGNANG