Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012767081 Xl3.1-XL467n09ex.5 - 887 ESTs
                                                                       .-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL467n09ex.5                                                              TTTCCTGTCCCTCACAGTGATGCGTTTGCTAATCTGGATCGGATAGGTCGTTAGACGCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGGCCTCTTCCTCCCTGGCTCAGTTGGCATTACAGACCCCTGTGAAAGTGGAAATTTCAGGGTTCACACTGTCATGACTCTGGAGCAGCAGGACATGGTTTGTTACACTGCCCAGACGTTGGTCCGAATTCTCTCACACGGAGGCTACAGGAAGATTTTGGGCCTGGAGGGAGATGCCAGTGCTCTTGCCACAGAAATGTCCACCTGGGATGGTGTCATTGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCTGAAAGGAAAGAAGGAGAGGAGGATGATAACCAGGAAATTGCTGAGGGGGCAGAAGAGGAGGAGAGTATGGAGACACAAGAGTGATACAAAGTTAAAGATTTCACTTGTTCTGGATTGTCCCTCTGTCGCCCCCGGGGCACAACATATTGGGTCTATTTCTGGACCAAATGCCACCAAGTTGCTGTTTTTTGTTCTTAGCTTGTCATGTGACTTCTTCTTTTATATACTGTAGGGATATGTTTTTGCCAGCAATAAATTTTTATTTCACCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012684933                                                                    GTCCCTCACAGTGATGCGTTTGCTAATCTGGATCGGATAGGTCGTTAGACGCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGxxxxTxTxxAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTTACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGGCCTCTTCCTCCCTGGCTCAGTTGGCATTACAGACCCCTGTGAAAGTGGAAATTTCAGGGTTCACACTGTCATGACTCTGGAGCAGCAGGACATGGTTTGTTACACTGCCCAGACGTTGGTCCGAATTCTCTCACACGGAGGCTACAGGAAGATTTTGGGCCTGGAGGGAGATGCCAGTGCTCTTGCCACAGAAATGTCCACCTGGGATGGTGTCATTGTGACCCCTTCAGAGAAGGCCTATGAGAAGCCCCCTGAAAGGAAAGAAGGAGAGGAGGATGATAACCAGGAAATTGCTGAGGGGGCAGAAGAGGAGGAGAGTATGGAGACACAAGAGTGATACAAAGTTAAAGATTTCACTTGTTCTGGATTGTCCCTCTGTCGCCCCCGGGGCACAACATATTGGGTCTATTTCTGGACCAAATGCCACCAAGTTGCTGTTTTTTGTTCTTAGCTTGTCATGTGACTTCTTCTTTTATATACTGTAGGGATATGTTTTTGCCAGCAATAAATTTTTATTTCACCCCxxxAxxAAxAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                   3     5     3     5     3     5     3     5     3     5     4     6     4     6     4     7     4     7     4    13     4    17     7    27    10    45    45   104   149   216   204   276   259   336   304   381   324   388   326   396   335   398   354   404   374   407   378   412   384   414   386   418   387   418   395   421   310   424   397   432   403   435   393   436   422   438   375   439   425   439   422   441   426   444   428   445   432   449   430   457   434   459   432   463   438   465   433   466   433   482   426   486   439   486   439   491   425   496   441   496   413   497   437   499   432   500   426   498   424   500   394   500   351   502   429   504   412   506   392   504   394   510   418   512   392   528   419   543   411   564   436   581   423   592   447   597   402   611   405   610   395   600   354   600   361   586   261   563   294   512   265   491   261   478   258   469   252   444   232   435   247   424   232   409   237   404   268   400   272   401   321   400   280   394   330   395   332   391   342   392   345   389   348   389   346   387   353   386   351   388   359   388   352   385   338   385   353   383   364   389   367   393   362   396   348   395   370   400   362   402   372   400   367   397   367   398   347   403   377   399   371   394   220   393   370   393   378   392   369   392   312   391   343   390   301   389   151   386   241   383   218   380   200   376   119   373   114   364   113   358   118   353    73   306    55   193    39   151    34   118    12    70     7    27     7    15
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCAGAAGGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAGAAGCCTAGTGTGTGTTCTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTACCAGCCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCTGTGGTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATATGTTGTT
                                                                   SNP                                                                                                                                                                                                                          --C----A----
                                                                   SNP                                                                                                                                                                                                                                      C--G--------
                                                                   SNP                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                              ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                          --A-G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                              -T--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----A------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -AC---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C--------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G--G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T--C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T--G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-----G-
                                               BLH ATG     212    1923                                                              
                                               BLH MIN     212     306                                                              
                                               BLH MPR     197     306                                                              
                                               BLH OVR     212      87                                                              
                                               CDS MIN     212      62                                                              
                                               EST CLI     156      62                                                              
                                               ORF LNG     212       8                                                              
  5   1   2       bld Ga15 5g                            XL486j14ex.5p CCGGGATTTGGAGGCGCTCGGGCGGCAACTTCTTTTATTCGCAGCAGCTTTGTGGGAGCAGTGGTGCCGCGGGGGATTGTGGGAAACATCCCTGTGACCTGAACCTACAGCCGCCCGGGACTTCCGGTCTTTCTATTTGTTCTTTACTGAGCTCTGGTCTCTCTCTACaacttgtaacttcctgtgtctgtaacttcctgtgtctgtgacttcctgtgtctgtAACATATAGAGACAGGCCTGGGACTGACTGTATCAACATATAGAGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCANCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGANATCAGTTCAGCANACNCCACCATTAA
  5   1   2       bld Emb9 5g                         IMAGE:7977150.5p                                                  GCGATTGGTGCATTTCCTGTCCCTCACAGTGATGCGTTTGCTAATCTGGATCGGATAGGTCGTTAGACGCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAAACTGTACCACCAAATCT
  5   1   2       bld DMZ  5g3  in                         xl230p21.5p                                                  GCGATTGGTGCATTTCCTGTCCCTCACAGTGATGCGTTTGCTAATCTGGATCGGATAGGTCGTTAGACGCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGAC
  5   1   2       bld Ga18      in                      xlk131e12ex.5p                                                        GATTGGTGNATTTCCTGTCCCTCACAGTGATGCGTTNNNNATCTGGATCGGATAGGTCGTTAGNNNCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGNCGCTTTGGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGNNNTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGNGGGCTCCTACAAGAAAGGGANCATGACCAGNGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGNAAGCCGNTTCTGCTTNGGGCAATAAGGTAGTGGAGNNCCTGNNGNCACAAGAACCCNCAGAAGTTCTCACANNGCTGACAAATGAGACTGGCTTTGAATCAGCTCAGCAGAC
  5   1   2       bld Emb1 5g                         IMAGE:6636355.5p                                                           GCATTTCCTGTCCCTCACAGTGATGCGTTTGCTAATCTGGATCGGATAGGTCGTTAGACGCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCANGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTNTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCCCGCCCTGGGTTTTGAGGAAATGCCCTCCATTTCTAA
  5   1   2       bld DMZ  5g3  in                         xl339j10.5p                                                                                                                      GCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGTAAGAGGGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCC
  5   1   2       chi DMZ       in                         xl271e05.5p                                                                                                                                                 GATTGGTGCATTTCCTGTCCCTCACAGTGATGCGTTTGCTAATCTGGATCGGATAGGTCGTTAGACGCCAAAGCGGGCGGGAGTTGACTGTTCGTCACGCTGATTGGCTCGGGGACCTGCGTTTATAGCCAATAGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACA
  5   1   2       bld Egg3 5g                         IMAGE:6326361.5p                                                                                                                                                                  GATTCCCCGGCGGGTTATATTCCTACAAGAGAGATGTTGGTCTAGTGCGCGCTTTTTGCAGGGTCGAGCTAGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGGTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGGCACTATGCAGTGGATGATAAACCCAACCAGGCAGGCCCCTGGCACTCCATGGGA
  5   1   2       bld Egg3 5g                         IMAGE:6326466.5p                                                                                                                                                                    GATTCCCGGGGTTACTTCCTGTGTCTTTAACTTCCTGTGTCTGTAACTTCCTGTGTCTGTAACATATAGAGACAGGCCTGGGACTGACTGTATCAACATATAGAGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGGCACTCAATGTGGGCCTATN
  3  -1   2       bld Ga11                            IMAGE:3475013.3p                                                                                                                                                                     GTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCA
  5   1   2       bld Em10 5g3  in                    IMAGE:7981987.5p                                                                                                                                                                        TGGGGTGGCGGGATCGGACGAAGTGTCGGTCCGGAATCCCGGGATCTTTTTGCAGGGTCGAGCTGGTGTCGATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTAATTCGCTTTGTGAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACTC
  3  -1   2       chi Ga11                            IMAGE:3474720.3p                                                                                                                                                                         GGAGTTCCGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGCCTTCCCCGGGGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAATGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAGAACCAGCCGAAGTGCTTA
  5   1   2       bld Int2 5g                         IMAGE:8824673.5p                                                                                                                                                                         GCCCGCCGGAGCACAACTAGGCGGGGCCCCGCTTCGAATTCGTCCCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATCGACTCTACTCCTGGATCCTGACTCTGGGTCACTATGCATGATGAACAACCCAACCAGGCAGCCCACTGGCACCTTAATGGTGGCCTACCAAACGCCTGCCCTT
  5   1   2       bld Int2 5g                         IMAGE:8530159.5p                                                                                                                                                                             AAAAANCCCATGATCGNGGGAGATGCATAAATAAAATTCGTCCCCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGCACTTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTCTCTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCATCAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAATATAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTTGCTTTGGGCAATACGGTAGTGGAGACCCTGACGACACTAGAACCCGCATAAGTTCTCACGATGCTGACAAATGATACTGGCTTTGAAATCAGCTCAGCATACGCCACCATTTAAGATCCTTATCACAACTGTACCATCCAATCTCCGACAGCTGGACCCATATTACACTTGGACATCAAGTTGACATAGCGCATGGGAGCCTTCTGCAGCACGTGGTTGAAGAAAAGCTCCCATTCTCATGAAGTTTAATGCGTTGTGAAGACTTAGGATCTGTTCCTGATCGACTTAGTCCCGTTACTGACCTTGGGCCTGTATGATAATCCACACTACGGGATTATGTGACAAATTC
  5   1   2       bld Ga18 5g3  in                      xlk109f05ex.5p                                                                                                                                                                               GTAACTTCCTGTGTCTGTAACTTCCTGTGTCTGTGACTTCCTGTGTCTGTAACATATAGAGACAGGCCTGGGACTGACTGTATCAACATATAGAGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTNACAATGCTAACAAATGAGANTGGCTTTGAGATCAGNTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTNTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNCAGNCATC
  5   1   2       bld Int2 5g                         IMAGE:8821470.5p                                                                                                                                                                                 GGGGGCTCATATAATAGGATGACGTCGATTCGAATTCGTCCCCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTTTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCACGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGTTTTAATCCGGTTGTGAAAGACTTGAGGAGTCGTTTCCTGGATTCGAACCTCTACTCCCTGATCCTGACTCTGGGTCACTATGCATGATGACACCACAGCAGCACTGCACTATGTGCTACAACGCCTGCTACGATTCCTCTCTGCGCTCTTCCCTCCTGCCTC
  5   1   2       chi Egg3 5g                         IMAGE:6869006.5p                                                                                                                                                                                      cccccccccccccccgccgcgccccgccccgcccgccAATTCCCGGGGCAGTTGTCCCTTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGACTCCGGAATGGGACCTAACGCAGGTTTCAGAGCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAGCCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGGAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAAGTTTTAATCCGGTTGTTGAAAGACTTGAGGAATCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCCTGGACCGCTTGGGTCCCTATGCAGTGGATGAACAACCCCAACCAGGGCAGCCCCCGTGGCCGCTTAATGGGTGGCCTTCCAAAACGCCTGGCCCTACCGAATTTCCTCTCTTTGCCGGGCCCTCTTTTCCCTCCCCTTGGGCCTCAAATTTGTGGGCAATTTACNCAAACACCCCCCTTGGTGGGAAACGGGGTGGGAGAAAATTTCCCG
  5   1   2       chi Egg3                            IMAGE:6871599.5p                                                                                                                                                                                          ACGCAATTGGATCGAATTCCCCCGGGGCTTTTTGCAGGGTTGAGCTAGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTNGAATGGCCTTCCCTCGTGTGAAACCCGCCCAGATGATGGCACACTCAGTGGAGCGCTGCTCAAACGGAACAGGATCTGGCTCCTACACAACTGAGCAGGCCTCCATCTTTCTCTGGTAACCAAATTCACAACGTTATGGACATTTTGATTGAAGCCCCTGGAACCTTTTGAAGGCCAATTTAAAAAAGGGCCAACAGGGGGGGTCCCTCCCAAAAAAGGGAAAATGGCCCCTGGGCCCTAAAAGGTTGCCCAAATTTTGGGGGTTTTTTTCTAAAAAAAccccccccccccccggggaaaaccacttttttttctttttgggggtttttaggggggtgtgggaaaacccctgggggggccccccaaaaaacccccccccaaagaattttttttgaaaaggggggaacaaaaaaagaaaaagaggggtgttttttaaaaaaaaaaattnnnaaaaaaaggccccccccccTTTTGGGGGGCGCCTCCCCCCAAAAAAGTGGTGGGGGGGCCCGCAAAGATTTATAGAAAGGTGGGGGGGCCCACCACAAAAAGTTGTTTTTTTGGGGaaaaaaaaaaaatttttttaaaaagagggggcggggggggggggAATAATAAAAAAACACCCCCCAAGGTGTTTTTTTTTTATAAAAAACACAcccccccccccttttttttttaggggggggggggggttttttttttCCCCC
  5   1   2       bld Brn1 5g                         IMAGE:7018886.5p                                                                                                                                                                                           CTGGTCCGGTCCGGATTCCCGGGATGCTTTTTGCAGGGTCGAGCTAGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCACCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTTGAACCTCTAACTCCCCTGGATCCCTTGACCTCTTGGGGGCACCTATGCAGTTGATGAAATAAATCCAACCCGGGCAGGCCCTTGGCCAACTCACATGTTGGGCCTATTAAGCGCTTGGCCTAACAGAAATCCTTTCGCCTG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981674.5p                                                                                                                                                                                              AAGTGCCTATGGCAATGGTCTGGCTGGTTTCGAGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTATTCGCTTTGTGAAAGACTTGAGGAG
  5   1   2       bld Thy  5g                         IMAGE:8547644.5p                                                                                                                                                                                              ATATATTAATTAAGAAATATCCATTATACAAATTCGTCCCCTAGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGTTTTATTCGGTGTTGAAAGACTTGAAGGAGTCGGTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGAC
  5   1   2       bld Egg3 5g                         IMAGE:6323211.5p                                                                                                                                                                                               CGcccccccccccacgccccnccccccGCGTCATTCCCGGGAGAGTTGTCCATTGTGCGGGAGTGGAGGAACGAAGACCGAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAGCCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGGTTGTTGAAAGACTTGAGGAGTCGNGTTTCCTGGGATTCCAAACCTCCTAACTCCCCGGGATCCTGGGACCNTCTTTGGGGTCACTATGCCAGTGGATGTAACAACCCCAACCCAGGGCAGGCCCACTGGGCACCTTAAATGGTGGGCCCTACAAAACGCCTGGCCTTACAGGAATTTCTTCGCCTGGCCGGCCCCT
  5   1   2       bld DMZ  5g3  in                         xl283c02.5p                                                                                                                                                                                               AGAGATTGTTGGTCTAATGCGGCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCNGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGG
  5   1   2       bld Em10 5g3  in                    IMAGE:7982054.5p                                                                                                                                                                                                CCGGTGCGACTGGCACAGTTCGGTCGGGATCCCGGGATCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAAGCACGCACGGTGGTTTGAGGAGAACGCCTCCATTCTACAGTGAAGGTTTTATTCGGTTGGTGAAGACTTGAGGAGTCGGTTCCTGGATTGAACTCTAACTCCTGGATCCTGACCTCTTGGGCACTAGCAG
  5   1   2       chi Emb1      in                    IMAGE:3402516.5p                                                                                                                                                                                                 CACGCGTCCGCGGACGCGTGGGGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGTAATACGCTTCCCACCACCTATCATTGTTACCTCTACCCAATCCCTATTCATTAATCCTtctctcgctctctctctcCTAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGAC
  5   1   2       bld Emb4 5g                         IMAGE:4970655.5p                                                                                                                                                                                                 GGTTTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTTATCCGGNTTNGTGAA
  5   1   2       bld DMZ  5g3  in                         xl322a06.5p                                                                                                                                                                                                  GATTGTTGGTCTAGTGCGGCTTTTTGCAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGT
  5   1   2       bld Gas2 5g                             3.1-6-b11.5p                                                                                                                                                                                                   TCTGGTGGCCNTAAGAATTCGNCACGAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCTTTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTT
  5   1   2       bld Ga15 5g3  in                       XL520a17ex.5p                                                                                                                                                                                                   ATTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGG
  5   1   2       bld Thy  5g3  in                    IMAGE:8546654.5p                                                                                                                                                                                                   ATTGTTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAGTTTTAATCCGTTGTTGAAAGACTTGAGAGTCGTTCCTGGATTCGACCTCTACTCCTGATCTGACTCTGGGTCACTATGCATGATGACCACCCACAAGCAGCACTGGCACTTATGTGTCTTACATCGCTGCCTAACGATTCTTCGCTGCAGCCTCTTTGATACA
  5   1   2       bld Int2 5g                         IMAGE:8823340.5p                                                                                                                                                                                                   CCGATAGTTATCTACGTAACCaaaaaaaaGAATTCGTCCCGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGATCTTGACCTCTTGGGGCACTATGCAGTGATGATATCAACAGCAGCCACTGGCACTCAATGTGCTATAGCGCTGCTACGATCTCGCTGCTGTCTTCTCTGCTCAATTGGCATTACGAAACCCTGTGTGAAGTGGC
  5   1   2       bld Tad1 5g                         IMAGE:6880512.5p                                                                                                                                                                                                      GGGGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGNCAGCTGGACCCAGAATTACACTTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTNTATCCCGGTTGTTTTGAAGACTTTGAGGAGTCGGGTTTCCTGGNATTCGAANCTCTTAACTCCCTGGATCCTGGNACCT
  5   1   2       bld DMZ  5g                              xl335j05.5p                                                                                                                                                                                                      GTTGGTCTAGTGCGGCTTTTTGCAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGGTGGTTT
  5   1   2       bld DMZ  5g                              xl252h11.5p                                                                                                                                                                                                      GTTGGTCTAGTGCGGCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGANGAGAACGCCTCCCATTCTACA
  5   1   2       bld Te2N 5g                         IMAGE:7205298.5p                                                                                                                                                                                                       TTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCCATCTACAGTGAAGGTTTTAAATCCGGGTGTTGAAAGACTTGAGGAGTCGGTTTTCCTGGATTCGAACTCTAACTCCCTGGATCGTGGGACCTCTTGGGGTCCTTATGCCAGGGATGAACAACCCCAACCAGGCCAGCCCCCGGGCCCCTTTAATGGGGGCCCTTA
  5   1   2       bld Ga15 5g                            XL440o11ex.5p                                                                                                                                                                                                       GACCCACGCCGCTCCGGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGTTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTT
  5   1   2       bld FaB  5g3  in                    IMAGE:8070920.5p                                                                                                                                                                                                       TTGTTCTAGTGTGCTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATCTACAGTGAAGGTTTNNATCCNNGTGTGAANGACTGANGAGTCNGTTCCTGGATCGA
  5   1   2       bld Ga18 5g3  in                      xlk110k21ex.5p                                                                                                                                                                                                       ATTGTTGTTCTAGTGTGCTCGTCTCGNGGGCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTTGGNTCCAGNNNNNNCCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGGNGNTNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGNAACCAAAATCAACAACGTTATTGACAATTTGATTNTAGCCCCTGGAACCTTTGAAGNGCAAATTGAAGAGGTGCGACAGGNGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGANTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTTGGGCAATAAGGTAGTGGGAGANCCTGNGGACACAAGAACCCGCAGAAGNNCTCACAATGCTGACAAATGAGACTGGNTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAANCTCCGCAAGCTGGACCCAGAANTACACTTNGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGNACGCACGCTGGNTTG
  5   1   2       bld Ga15 5g                            XL494j24ex.5p                                                                                                                                                                                                          CCCACGTCGTCCGTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCANATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACAC
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975666.5p                                                                                                                                                                                                          TCGGTCCGGATTCCCGGGATGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAAGTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCTACCATCAAGCACGCACAGTTGGTTGAGGAGAACGCCTTCCCATT
  5   1   2       chi Te1                             IMAGE:6929478.5p                                                                                                                                                                                                           GGGAGTGCGGCTTTTTCCAGAGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACCAATTGAGACTGGCCTTTGAGATCAGGTTCAGCAAGACGCCCCCCAATTAAAGGTTCCTCCATCAACAACCTGGTGGCCGGCCCCAAAACCCTTACCGCAAAGCCCTTGGGAACCCCAAAAAAGTTTTGCCATTTTTGGGGAACC
  5   1   2       bld Int2 5g                         IMAGE:8824903.5p                                                                                                                                                                                                            GGGCCCACCTTATCACACGAGCCCCGCGCCCCGAATTCGTCCCGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGTTTTATTCTGGTGTTGAAAGACTTGAGGAGTCGTTTCTGGATTCGAACTCTACTCCTGGATCTGGACTCTGGGTCACTATGCATGATGAACAAACCACAGCAGCACTGGCCTTAATGTGGCTACAAACCTGCCTACGATTTTCTGGCGGCGCTTTCTCTCCTT
  5   1   2       bld DMZ  5g3  in                         xl241k01.5p                                                                                                                                                                                                            ATCGATTCGCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTC
  5   1   2       bld Egg3 5g                         IMAGE:6868030.5p                                                                                                                                                                                                             GATTCCCGGGCTTTTTGAGGGTCGAGCTAGTGTCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAATGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGGTGGTTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGTTTNTAAATTCGGTTGTTGAAAGACTTGGAAGAGTCGGTTTTCCTGGGATTTTGAACCNTCCTAACTCCCTGGGATCCTTGNACCCTCTTGGGGGCACTTATGGCAGTTGAATGGAATAAATCCCAACCCAAGGGCAGCCCCACTTGGGCACTTCCAATGTTGGGGCCTTATTAAGCCGGCCTGGCCCTAACAGAAATCCCTCA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975071.5p                                                                                                                                                                                                              TCCCGGGATCTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTGGAGGAGAATGCTTCCATTCTACAGTGAGGTTTTAATCTGGTTGTGAAAGAC
  5   1   2       bld Egg3 5g                         IMAGE:6327021.5p                                                                                                                                                                                                               GATTCCCGGGCTCGAGGGCCGATACGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGACTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCTCTGCCCGGCCTC
  5   1   2       bld Lmb1 5g                         IMAGE:8534621.5p                                                                                                                                                                                                                TGNGGACTACTCTAAAAAATTCGTCCCGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCATTCTACAGTGAAGGTTTTATCCGGTTGTGAAAGACTGAGAATCGGTTTCTGGATCGAACTCTACTTCCTGATCTGGACTCTGGGTCCTTGCAGGAGGACACCCACAGCGGCCTGGACTATGTGCTACACCT
  5   1   2       bld DMZ  5g3  in                         xl255m13.5p                                                                                                                                                                                                                 GCGGCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGG
  5   1   2       bld Ga15 5g                            XL431m04ex.5p                                                                                                                                                                                                                  CCCACGCCGGTCCGCCGAGAGGTTGTCCATTGCTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCANCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGANAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAA
  5   1   2       bld Em10 5g3  in                    IMAGE:7981828.5p                                                                                                                                                                                                                  GCGGCTTTTTCCGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTTGCCGCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATCTACAGTGAAGGGTTTAATTCGGTTGTTGAAGACCTGAGGAGTCGGTTCCTGGAATTGAAC
  5   1   2       bld Egg3 5g                         IMAGE:6324170.5p                                                                                                                                                                                                                   TCCCGGGCCCGGGGTCGAGCTAGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTTCCTGGATTTTGAACCTCTAAACTCCCTGGATCCTTTGACCTCTTTGGGGCACTATGCAGTTGAAGAAATAATCCCAACCAGGGCCAGCCACTGGGCACTCAATGTGGNCCTATAAAGCGCCTGGCCTACAGAATCCCTCGGCTGCTGGGCCTTTTTCCTCCCCTGGGCTCAAGTTGGGCAC
  5   1   2       bld Egg3 5g                         IMAGE:6870751.5p                                                                                                                                                                                                                   GATTCCCGGGCCCGGGGAGCTAGTGCTCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTTGAACCTCTAACTCCCTGGGATCCTTTGACCTCTTGGGGGCACTAAGTGCAAGTGATGAATAATCCCAACGAGGCCAAGCCACCTGGGGCACTCCAATGGGGGCCCTTATAAGGCGGCCTGGCCCTACCAGGATCGCC
  5   1   2       bld Int2 5g                         IMAGE:8821906.5p                                                                                                                                                                                                                   TGTTGCATATTAATTGGGGATTAAGTCCCCTTTTTTAAAACGTCCCGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGTTTCCTGGATTTGAACCTCTAACTCCTGGATCCTTGACCTCTGGGGCACTATGCAGTGATGATATCCAACCAGGCAGCCACTGGCACTCATGTGGCCTATAAGCGCTGCCTACAGATCCTCGCTGCTTGTCTTACCTCCCTGCTCAGTGGCCATACCGGACCCTGTGAAGTGCACCTTCAGGATCCATACCTGTC
  5   1   2       bld Oo1  5g                         IMAGE:6856950.5p                                                                                                                                                                                                                    GCTGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTTGAGGAGTCGGTTTTCCTGGGATTCGGACCCTCTAACTTCCCTGGGATCCTGGGACCTCTTGGGGTCCCTATGGCGTTGGATGAAAAACCCCAACCAGGCCAGGCCACCTGGGCACCTTAAATGGTGGCCCTACAAAACGCC
  5   1   2       bld Em10 5g                         IMAGE:7979122.5p                                                                                                                                                                                                                    GCTTTTTGCAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCTCAGGCACGCCGGTGGTTTGAGGAGACGCCTCCATTCTACGTGAAGGTTTATTCGCTTGTGAAGACTGAGAGTCGTTTCTGATTTGACTCTACTCCTGATCTGACTCTGGGCATAGCGTGAGATATCAACAGCGCATGGCCTCAGTGCTAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976249.5p                                                                                                                                                                                                                    CGGATTCCCGGGATCGAGAGGTTGTCCATTGTGCGGGAGTGTCATTAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCTTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCCACTTTGGAAGCCGTTTCTGCTTTGGGCTATAAAGTATTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACTAATGAGACTGGCTTTGAAATCACCTCAGCTGATGCCACCCTTAAGATCCTTTTCACAACTGTGCCACAAATCTTCCCCAGCCGGACCCGAAATACACTTGGACATCAAATTTCTCAAAGCGCACTGGCAGCATTAAGCACGCTCCTGGTTTGAGAAAATGCTTCCCTTTCACTCTAAGGTTTTATCCGGTGTTAAAACTTTAGGATCGGTTCCGGTTCAACTCTTAATTCTGTACGGGACCTGGGTTTTTCTATGACCTCATCTGTTCT
  5   1   2       bld Em10 5g                         IMAGE:7982799.5p                                                                                                                                                                                                                    GCTTTTTGCAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGGTTGAGGGAGACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTGGAGGAGTCGGTTTCCTGGATTTGACCTCCTACTC
  5   1   2       bld DMZ  5g3  in                         xl243k01.5p                                                                                                                                                                                                                    GCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGT
  5   1   2       bld DMZ  5g3  in                         xl322i10.5p                                                                                                                                                                                                                    GCTTTTTGCAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGG
  5   1   2       bld DMZ  5g3  in                         xl310p20.5p                                                                                                                                                                                                                    CTCGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCNG
  5   1   2       bld DMZ  5g3  in                         xl276k14.5p                                                                                                                                                                                                                    GCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAAC
  5   1   2       bld DMZ  5g                              xl227g09.5p                                                                                                                                                                                                                    GCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAANGTTTTAATTCG
  5   1   2       bld Egg3 5g                         IMAGE:6869671.5p                                                                                                                                                                                                                     GATTCCCGGGGGGTCGAGCTGGTTCCATTGTGCGGGAGTGTGAGGAACGATGACCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTTCGCTTGTTGAAAGACTTGAGGAGTCGGGTTTCCTGGATTTGGAACCTCTAACTCCCTGGGATCCTTGACCCTCTTGGGGGCACTATTGCAGTGGATTGAATTAATCCAACCCAGGGCAAGCCACCTGGGCCACCTCAAATGTGGGGCCTTATTAAACCGCCTTGCCCCTAACAGGAATTCCCCTCCCCCCTGGCCTTGGGNT
  5   1   2       bld Ga15 5g                            XL429g07ex.5p                                                                                                                                                                                                                     CTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCNCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCANT
  5   1   2       bld Ga15 5g                            XL435d21ex.5p                                                                                                                                                                                                                     CTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCNGTTGTTGAAAGACTTGAGGA
  5   1   2       bld Ga15 5g3  in                       XL404f04ex.5p                                                                                                                                                                                                                     CTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTC
  5   1   2       bld Em10 5g                         IMAGE:7979558.5p                                                                                                                                                                                                                     CTTTTTGCAGGGTCGAGCTGGTGTCGATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTNCCATCTACAGTGAGGTTTTAATCGCTTTGTGAAGACTGAGGAGCGGTTTCTGGATTGAACTCTACTCCTGGATCTGACTCTGGGCCTAGCATGAGATATCCACAGCAGCCTGCATCATGTGCTATACCTCTA
  5   1   2       bld Ga18 5g3  in                        xlk7k22ex.5p                                                                                                                                                                                                                     GCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATNNGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGNCACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGANCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGGNACGCACGGNGGNTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTNANTTCGCTTGTTGAAAGACTTGANGNGNCGGTTTCCT
  5   1   2       bld Ga18 5g3  in                      xlk137n06ex.5p                                                                                                                                                                                                                     GCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGNGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTNCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGNCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGNCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGANCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNACNCACGGNGGTTTGAGGNGAANNCCTCCCATTCTACAGNGAAGGTTTAATTCGGTTGNTGAAAGANTTGAGNGNCNGNTTCCTNGATTTGAACCTNNA
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437491.5p                                                                                                                                                                                                                      CGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAATGGAGACC
  5   1   2       bld Ga15 5g                            XL429l19ex.5p                                                                                                                                                                                                                      CGTTCCGGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGANGGGTGAACGAGGACGATGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTC
  5   1   2       bld Ga15 5g                            XL441h20ex.5p                                                                                                                                                                                                                      TCCGCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCANAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCANATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAANATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGACAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCANAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCANCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGA
  5   1   2       bld Tail 5g                         IMAGE:8543829.5p                                                                                                                                                                                                                      AAGAGTACCTAAATAAATTCNTCCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACGCAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCTATCTACAGTGAAGGTTTAATCGCTTGTTAAAGACTGAGGATCGGTTTCTGGATTGAACTCTACTCCTGATCCTGACCTCTGGGACTATCGTGTGAAAATCATCCGCACCCTGCCTCATGGG
  5   1   2       bld DMZ  5g                              xl229o14.5p                                                                                                                                                                                                                      TTTTTGCAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAAC
  5   1   2       bld DMZ  5g                              xl222d03.5p                                                                                                                                                                                                                      CGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTA
  5   1   2       bld DMZ  5g3  in                         xl222c16.5p                                                                                                                                                                                                                      CGTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGG
  5   1   2       bld Em10 5g                         IMAGE:7983696.5p                                                                                                                                                                                                                       TTTTGCGGGGTCGAGCTGGTGTCGATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAAGACGCCTCCCATCTACAGTGAAGTTTTTATTCGCTTGTTGAAGACTTG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981103.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGATGCCTCCCATTCTACAGTGAAGGTTTTTATCCGGTTGTTA
  5   1   2       bld Emb9 5g                         IMAGE:7974303.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCATTCTACAGTGAAGGTTTATCCGGTTNGTGAAGACTTGAGAGTCGTTCCTGGATCGAACTCTACTCCCCTGATCTGACTCTGGGC
  5   1   2       bld Emb9 5x                         IMAGE:7978553.5p                                                                                                                                                                                                                       CTCGAGGGCCGAGAGGTTGTCCATTGTGCTGTGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTACCAAAATCAACAACTTTATTGACAATTGATTGTAGCCCCTGGGAACCTTTGAGTGGCAAATTGAAAAGTGGCGACCAGTTGGGCTTCTTCCAAGAAAAGGGACCATG
  5   1   2       bld Emb9 5g                         IMAGE:7974596.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAAGATGCCTCCCATTCTACAGTGAAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981346.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGTCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAAGTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAAGAGAATGCCTCCAATCTACATGAAGGTTTTAATCCGGTTGTTGAAAACTTGAGGATCGGTTTCTGGATCGAACTCTAACTCCTGA
  5   1   2       bld Em10 5g                         IMAGE:7982367.5p                                                                                                                                                                                                                       TTTTTCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCAAACCTACGCAGCTGGACCAGAGTTGCATTTGGAATCAAAGTCTACAGAGCGCACTGGCAGCATCAGGCCGCACGGTGTTTGAGGAGACGCTCCCATCTACAGGAAGGTTTTATTCCTGTTGAAGATTGAGAGTCGTTCCG
  5   1   2       bld Em10 5g                         IMAGE:8321668.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCCCTTTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAACGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACTCTTGGAACATCAAGTTCTACAGAGCGCACTGGCAGCCATCAAGAACGCCCGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTAATCC
  5   1   2       bld Em10 5g                         IMAGE:8319550.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCCTCCCATCTACAGTGAAGGTTTTAATCCGGGTTGTG
  5   1   2       bld Ga18      in                      xlk110h10ex.5p                                                                                                                                                                                                                       TTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGNGAACGAGGACGTGGACGTGGCCGCTTTGNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACaaaaaaaaGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGNCACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTNGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCNAGCTGGANCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGNACNCACGGTGGNTTGAGGNGAACGCCTCCCATTCTACAGTGAAGGTTTTAATNNGGTTGTTGAANG
  5   1   2       bld DMZ  5g3  in                         xl265h16.5p                                                                                                                                                                                                                       GTCTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTAC
  5   1   2       bld Ga15 5g                            XL471a11ex.5p                                                                                                                                                                                                                        CGCTCCGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGA
  5   1   2       bld Ga15 5g3  in                       XL485p12ex.5p                                                                                                                                                                                                                        TCCGGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGA
  5   1   2       bld Em10 5g                         IMAGE:7980793.5p                                                                                                                                                                                                                        TTTTCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATNCAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGTTTTAATTCGC
  5   1   2       chi Em10                            IMAGE:7979520.5p                                                                                                                                                                                                                        TTTTCCGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCATGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACAGAACCAAGATCTGGCTCCTACGACAACTGAGCAGGCCTCCATTCCTTCTCTGGTAACCAAGATCAATAGCGTTATTGACAATATGGTTGTAGCCCCTGGAACCTCTGATGTGCACATTGAAGAGGTGCGACAGGTGGGCTCCCTAAAGAAATGGACACTGTCCGCTGGCCATACTGTTGCAAACTTGGTTGTCATTGTAAAATATCCTCCCTAACTCTGAAAGACGTTTCTGCTTTAGGCAATAAAGTACTTGAGACCATGACGACTCAAAACCTCCTGAATTCTTCCAATACTGCAAATGAAACAGGCTTTGAATACTTCCCCGAAACACCATTAGGTCCTCATCAAACCGAGCTATTAATTCGGCAGTAGACCAAATTGATTGGTCTCAAATTCCGCTATCCATCTTACTAAAGGACCCTGTATTTTGAGGGACACTCCCTTCACTGGAAGGTATTCCTTTCAAATTCCAGTACTTCGATAAGGGTACCACTATTTGAACTGGCAAACTAAATACCACCCTCCC
  5   1   2       bld Emb1 5g                         IMAGE:6864791.5p                                                                                                                                                                                                                         CTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTTCTGGATTCGAACCTCTAACTCCCCTGGATCCTGGGACCTCTTGGGGTCACCTANTGCAGTGGATGAAACAACCCCAAACCC
  5   1   2       bld Ga15 5g                            XL469h22ex.5p                                                                                                                                                                                                                         CTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAAC
  5   1   2       bld Ga15 5g3  in                       XL483p13ex.5p                                                                                                                                                                                                                         CTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGAT
  5   1   2       bld Te2N 5g                         IMAGE:7767061.5p                                                                                                                                                                                                                         CTCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCATTCTACAGTGAAGGTTTAATCCGGNNTGTGAAGACTTGAGAGTCGGTTCCTGGTTCGAACTCTAC
  5   1   2       bld Em10 5g                         IMAGE:7980711.5p                                                                                                                                                                                                                         TTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAAGCACGCACGGTGGTTTGAGGAGAACGCCTCCATTCTACAGTGAAAGTTTAATTCGGTTGTTGAAGACTTGAGGAGTCGGTTCCTGGATTTGACCTCTACT
  5   1   2       chi Em10                            IMAGE:8318078.5p                                                                                                                                                                                                                         AGGGGGTTTCGGTCCAGATGCCCGGGATCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACATGAACCATCCTAAGTTCTTACAATGCAAACAAATGAGACTGGCTTTGATATCAGTTCAGCAGACGCCATCATTTATGGTCCTTATTACCACTGTGCTCTCCAACTTACGCAAGCTGGACCATGAGTGCATTTGAACATAAATTTCACATAGTCACTGTCATCCTCATGATCTACTGTAGATGATAAATCTCCTCCATTTACAATGATGTTTCATCTCTGTCTCAAAACTATAG
  5   1   2       bld Em10 5g                         IMAGE:8318293.5p                                                                                                                                                                                                                         TGTCTGTAACATATAGAGACAGGCCTGGGACTGACTGTATCAACATATAGAGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAAGCTGGACCCAGAGTTGCATTTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTTCGGT
  5   1   2       bld Ga18      in                      xlk137i11ex.5p                                                                                                                                                                                                                         TTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTNCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCNTTGGACATCAAAGTNCTACAGAGCGCACTGNNAGCCATCAGCACGCACGGTGGNTTGAGGAGNNNNCTCCCATNTACAGTGAAGNNNTTNATTNGCTTGTTGNAAGACT
  5   1   2       bld Ooc3 5g                         IMAGE:3436667.5p                                                                                                                                                                                                                          TCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAAATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCCGTTCTGCTTTGGGCCATAAGGTAGTGGAGACCCTGAGGACACAATACCCG
  5   1   2       bld Emb1 5g                         IMAGE:5156107.5p                                                                                                                                                                                                                          TCGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTTAATCCGGTTGTTGAAAGACTTTGAGAGTCGGTTTTCCTGGATTCGAACCTCTAAACTCCCTGGGATCCTGGAACCTCTTTGGGTCACTNATGGCCGTGGATGAAACCACCCCCAACCAAGGGCAGCCCATTGGGCCACCTTTAATGG
  5   1   2       bld Ga15 5g3  in                       XL449i05ex.5p                                                                                                                                                                                                                          TCCGGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCNAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGA
  5   1   2       bld Ov1  5g                         IMAGE:8332412.5p                                                                                                                                                                                                                          CCCACGCGTCCGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGGACATCAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTT
  5   1   2       bld Em10 5g                         IMAGE:8319809.5p                                                                                                                                                                                                                          TTCCGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTNGAGAGACGCNTCCCATTCTCAGTGAAGGTTTTATTCGTTGTGAAAGACTGAGAAGTCGTTTCTGGATTGAACTCTACTCCTGATCCTGACTCTGGGG
  5   1   2       bld Tbd1 5g                              AW765190.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAG
  5   1   2       bld Tbd1 5g                              AW765275.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTTCGCAAGCTGGACGCA
  5   1   2       bld Egg3 5g                         IMAGE:6323779.5p                                                                                                                                                                                                                           CCGGGGGTCGAGCTGGTGTCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAAACAAGGCAGCCACTGGCACTCAATGTGGGCCTATAAGCGCTGCCCTACAGATCCCTCGCTGCTGGGTCT
  5   1   2       bld Ga15 5g3  in                       XL435f14ex.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTC
  5   1   2       bld Ga15 5g3  in                       XL474m17ex.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGG
  5   1   2       bld Ga15 5g3  in                       XL514e14ex.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCC
  5   1   2       bld Ga15 5g3  in                       XL438i22ex.5p                                                                                                                                                                                                                           CCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTC
  5   1   2       chi Emb9                            IMAGE:7974283.5p                                                                                                                                                                                                                           GGTCCGGATTCCCGGGATCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCATACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCATGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCATATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAATGGACAATGTCCGCAGGCCATAATGTTGCAGACTCTGGTTGTCATTCTAAAGATCCTCCCCACATTGAAAGCCGTTTACTCTTTGGGCATTAAGGCAGTTGAGACCTCGATGACACTATAACTAGCATAAGTTCTTACAATGCTAATCGAATGAGACTGGTTTATAAATCAGTTCAGCATACGCTACTATTAAGGTCTCGTCAGATAGTGTTGTCAAACTAAACATGCTTGATTCATATTTCATTGGTACACTATATTCTACTAACGCCTTGAAGCTAGTTTACTTTTGGGGTTGAAGAAACCTTCTCTTATAATTGAAGTTTATACTCTGTTTATATTCGCGAATGGTTCAGATTGAACTAACTTTTATACTAATTTTGGGGCTATTTG
  5   1   2       bld Em10 5g3  in                    IMAGE:7983264.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTAC
  5   1   2       bld Em10 5g                         IMAGE:7982925.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCACTCTACAGTTGAAGTTTTAATCCNGGTTGTGAAAGACT
  5   1   2       bld Em10 5g3  in                    IMAGE:7981176.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATCTACAGTGAAGGTTTTAATCCGGTTGNTTGAAGACTGAGAGTCGGTTTCTGGTTTCGACTCTACTNCTGGATCTGGGACTCTGGTCATAGC
  5   1   2       bld Em10 5g                         IMAGE:8318583.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGTGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTA
  5   1   2       bld Em10 5g                         IMAGE:8318863.5p                                                                                                                                                                                                                           CGAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACA
  5   1   2       bld DMZ  5g3  in                         xl253a03.5p                                                                                                                                                                                                                           CAGGGAACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGNAAGGTTTTAATTC
  5   1   2       bld DMZ  5g3  in                         xl258i05.5p                                                                                                                                                                                                                           CCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174085.5p                                                                                                                                                                                                                            GACGCGTGGGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAATGTCCTCATCACAACTGTGCCGTCAAACCTACGCAAGCTGGACCTCAGAGTGCATTNGGACATCATAGTTCTACAGAGCGCACTTNCAGCCATCAGGCACTCACTGTGGTTTGATGAGAACGGC
  5   1   2       chi Egg3                            IMAGE:6867807.5p                                                                                                                                                                                                                            GATTCCCGGGGAGGTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGACTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGCGAAGGTTTTATCCGGGTTGGTCGAAGACTTGAGGAGCTCGGTTTCCTGGGATTCTAACCCGCTACCTTCCCGGAATCCCGCAGACCTCCGGGGGTCACCCACGCCAGGGGACGCAATCACCCCCTCTCCTACGCAAGCCGCCCGGGGCACCTTTAACCGGTGGGGCCTTTCAACAGGGCCGGCCCCCTAAGAAAATTccccccccctggtcccggccccccatcttctccccccACGGGGCGTTTAAATTTGGGGGCACGAAAAAAACGAATTCCCC
  5   1   2       bld Egg3 5g                         IMAGE:6868044.5p                                                                                                                                                                                                                            GATTCCCGGGGCTAGTGTCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGGCCTATTAACGCTGGCCTACAGATCCTCGGCTGCTGGGTCTTTTCCTCCCCTGGGCTCAAGTTGGGCATTTACAGAACCCCCTTGTGGGAAAGTGC
  5   1   2       bld Ga15 5g                            XL490p23ex.5p                                                                                                                                                                                                                            CAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCANAGTTGCATTTGGACATCAAAGTTCTACANAGCGCACTGGCAGCCATCANGCACGCACGGTGGTTTGAGGANAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCNGTT
  5   1   2       bld Ga15 5g3  in                       XL519a04ex.5p                                                                                                                                                                                                                            CAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCC
  5   1   2       bld Emb9 5g                         IMAGE:7974281.5p                                                                                                                                                                                                                            CAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAGAGGTGCGACAGGCGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAATGTCCTCATTCACAACTGTGCCGCTCAACCTACGCAAGCTGGACCCATAGTTGCATTTGGACATCTAATTTCTTCAGAGCTCATTGGCATCTATCAGGCACTCACTGTGGGTTGATGAAACGCCCCCATTCCTAAGTGAAGGTATTAATCACTTGTTTAAAGATTGAAGATCCTGTTCCTGGATTGAACCTTAACTCCTGGATCTATTCTTCTAGGGAG
  5   1   2       bld Ga18 5g3  in                       xlk79j06ex.5p                                                                                                                                                                                                                            TCCAGGANGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGNTCTACAGAGCGCACTGNNAGCCATCAGGNACGCACGGNGGTTTGAGGAGAANNNCTCCCATTCTACAGTGAAGGTTTTAANTCGCTTGTTGAAAGANTTGAGGNGNCGNTTTCCTGGATTGA
  5   1   2       bld Ga18 5g3  in                      xlk120i02ex.5p                                                                                                                                                                                                                            TCTCGAGGNCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNCNNTTTGGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTNGNTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGT
  5   1   2       bld DMZ  5g3  in                         xl242i15.5p                                                                                                                                                                                                                            CAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGT
  5   1   2       bld DMZ  5g3  in                         xl243o04.5p                                                                                                                                                                                                                            GAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGA
  5   1   2       bld DMZ  5g3  in                         xl321p14.5p                                                                                                                                                                                                                            CAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGT
  5   1   2       bld DMZ  5x3  out                        xl270b20.5p                                                                                                                                                                                                                            GAGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTG
  5   1   2       bld DMZ  5g3  in                         xl225i22.5p                                                                                                                                                                                                                            CAGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGT
  5   1   2       bld DMZ  5g3  in                         xl327a17.5p                                                                                                                                                                                                                            CAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTC
  5   1   2       bld DMZ  5g3  in                         xl331g08.5p                                                                                                                                                                                                                            CAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATT
  5   1   2       chi Egg3                            IMAGE:6324491.5p                                                                                                                                                                                                                             TTCCCGGGGGTCGAGCTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTAACAATGCTAANCAATGAGACTGGCTTTGAGATCAGTTCAGCAGAACGCACCATTAAAGGTCCTCATCACAACTGTGCCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAAGGGCATTGGGAGCCCTTCAGGCAACCCCCGGGGGTTTTTAGGAAAAACCCCTTCCCATTTTTAAAGGGGAAGGGTTTTAATTTCCCCTTGGTTGGAAAAAAATTTTGGGGGAAACCCGGTTTTCCCGGGGGATTTGAAAACCCCTTAAAATCCCCCCGGGAAATCCCTTGGGACCCCTTCTTGGGGG
  5   1   2       bld Eye1      in                    IMAGE:6948523.5p                                                                                                                                                                                                                             TCCGGAATTCTCCGGATCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGTTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAAACAGGGCAGCCACTGGCACTTTATGGTGGCCTACAAACGCTGGCCTACAGAATTCTCGCTGCCGGGCTTCTTCNCTCCCCTGGCTCAGTTGGGCATTACAGAACCCTTGGGGAAAAGTGGAAATTTCTCAGGGTTCCAACACTGTTCATGAACTCCTGGAGACANNCCGGGACATTC
  5   1   2       bld Em10 5g                         IMAGE:7983595.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGTTTTAATCCGGTTGTTG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975985.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCT
  5   1   2       bld Emb9 5g                         IMAGE:7977817.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCCTGAGGACACAAGAAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTTATCACAACTGTGCCACCAAATCTCCCGCAAGCTGGACCCAGATTTACACTTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGGAGAATGCCTTCCATTCTACAGTGAAGGTTTTAATCCCGTTTGTT
  5   1   2       bld Em10 5g                         IMAGE:7980805.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCNGTTGTTGAAGAACTTGAGAGTCGGTTTCTGGATTCGAACTCTAA
  5   1   2       bld Emb9 5g                         IMAGE:7975853.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCTTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCATGCACC
  5   1   2       bld Emb9 5g                         IMAGE:7977617.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7974980.5p                                                                                                                                                                                                                             CGGATTCCCGGGATGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCATTCTACAGTGAAGGTTTTATTTCGCTTGGTGAAAGACCTTGAGAGTCGGTTTCTTGGATTTGAACTC
  5   1   2       bld Em10 5g                         IMAGE:7979279.5p                                                                                                                                                                                                                             AGGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATCTACAGTGAAGGTTTTTATCCNNGTGTGAANNGACTGAGAGTCNGTTC
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db32e09.y1                                                                                                                                                                                                                              gggtcgacccacgcgtccgcccacgcgtccgTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAAGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATC
  5   1   2       bld Emb4 5g                         IMAGE:5572159.5p                                                                                                                                                                                                                              GGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCCTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGGTTTAATCCGGGTGTTGGAAAGACTTGAGGGAGTCGGGTTCCTGGAATCAAACCTCTAACTTCCCTGGATCCGGGAACCTCTTGGGTCACTAAGGCGGGGGATGAACAACCCCAGCCGGGGAGGCCCTGGGGAACTTAATGGGGGCCTACAAAAGGATTCCCCT
  5   1   2       bld Te2N      in                    IMAGE:7202618.5p                                                                                                                                                                                                                              TAACATATAGAGACAGGCCTGGGACTGACTGTATCAACATATAGAGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGGAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGGAAATTGAAGAGGTGCGACAGGTGGGCTCCCTACAAAAAAGGGGACATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTTCGGTTGTTGAAAGACTTTGAGGAGTCGGTTTTCCTGGGATTTGAACCNTCTAACTCCCTGGATNCTTGAACCTTCTGGGGGGCACTTATGCAGGTGATTGAATTAATCCCAAACC
  5   1   2       bld Te2  5g                         IMAGE:7210677.5p                                                                                                                                                                                                                              GGGCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCATCCCATTCTACAGTGAAGGTTATTATCCNNGTTGTG
  5   1   2       bld DMZ  5g                              xl290h03.5p                                                                                                                                                                                                                              GGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAG
  5   1   2       bld Egg3 5g                         IMAGE:6324359.5p                                                                                                                                                                                                                               GATTCCCGGGGTTGCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAAGGTTTTAATCGGGTTGNTGAAAGACCTGGAAGGAGTCGGGTTTCCCTGGAATTCGAAAACCTCTAAACTCCCCTGGGAATCCCGGGGACCCTCCTTTGGGGTCCACCCTATGCCCAAGGGGAATGA
  5   1   2       bld Em10 5g                         IMAGE:8318141.5p                                                                                                                                                                                                                               GGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGG
  5   1   2       bld Spl  5g                         IMAGE:8460370.5p                                                                                                                                                                                                                               GGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCATTCTACATGAAGGTTTATTTCGCTGTGAANGACTGAGATCGTTTTCTGATTGACTCTACTCCTGGATCTGACTCTGGGCATTGCATGTGATATCCACAGCAGCCTGCACTAGTGCTATACCGCTAGATCCCTGCGTCTCTCTNGCATGCTA
  5   1   2      seed Ga15 5g                            XL467n09ex.5p                                                                                                                                                                                                                                GACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGGCACTATGC
  5   1   2       bld Ga15 5g                            XL469k09ex.5p                                                                                                                                                                                                                                ACGAGCTGGTGGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGA
  5   1   2       bld Ga15 5g                            XL518c14ex.5p                                                                                                                                                                                                                                GACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGCTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTT
  5   1   2       bld Ga15 5g3  in                       XL519c06ex.5p                                                                                                                                                                                                                                GCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGG
  5   1   2       bld Te2N 5g                         IMAGE:7767941.5p                                                                                                                                                                                                                                GCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTNCCCATCTACAGTGAAGGTTTTAATCCGNTTTTGTGAAGACTTGAGGAGTCGGTTTCCTGA
  5   1   2       bld DMZ  5g3  in                         xl337i05.5p                                                                                                                                                                                                                                GCCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGA
  5   1   2       bld Egg3 5g                         IMAGE:6870792.5p                                                                                                                                                                                                                                 CCCGGGAGAGGTGTCATTGCGCGGGAGTGTGAGGAACGAAGATCCGAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGGACCTCTTGGGTCACTATGCAGGGGATGAACAACCCCAACCAGGCAGCCACTGGGAACTTAATGTGGGCCTACCAAACGCTGTCCCTAAAGATTCTTCGCCTGCCGGGGCCTCTTTCCTTCCCTGGGGCTCAGTTTGGACATTTAC
  5   1   2       bld Ga15 5g                            XL412k13ex.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGA
  5   1   2       bld Ga15 5g                            XL433m23ex.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGA
  5   1   2       bld Ga15 5g                            XL467g08ex.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCANAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAA
  5   1   2       bld Ga15 5g3  in                       XL514b20ex.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCACAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGGTTGTTGAAAGACTTGAGGA
  5   1   2       bld Emb9 5g                         IMAGE:7974272.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCATGCACGCACGCTGGTTAGAGGAGATTGCCTCCCATTCTACAGTGAAGGTTATATCCGGTTGTTGAAAGACTGAGGAGTCGGTTTCTGGATCCAAACTCTAACTCCTGGACCTGGACTCTTG
  5   1   2       bld Em10 5g                         IMAGE:8321510.5p                                                                                                                                                                                                                                 GATAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTTCTACAGAGCGCACTGGCAGTCATCATGCACGCACGCTGGTTTTGAGGAGA
  5   1   2       bld Em10 5g                         IMAGE:8321917.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGTTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGTTTTAATCCCGGTGTTGAAAGACTTGAGGAGTCGGT
  5   1   2       bld Ga18 5g3  in                      xlk162k12ex.5p                                                                                                                                                                                                                                 GNNNNNCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGNTTTGAGATCAGTTCAGCAGACGNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGGNACGCACGGNGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTNATTCGCTTGTTGAAAGA
  5   1   2       bld Ga18      in                      xlk159l22ex.5p                                                                                                                                                                                                                                 CGAGGNCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNCNNTTNNNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGANCCTGAGGNCACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGGNACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGNCGGNTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACNAGGCAGCCACTNGNACTTAATGTGGNCTANAAACGCTGCCTACAGATTCTCGCTGCCGGCNNTTCCTNCCTGGCTCAGTNGNNANNACAGACCCTGTG
  5   1   2       bld Ga18      in                      xlk122d01ex.5p                                                                                                                                                                                                                                 CGAGGNCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTNGNTCCAGANNNNNCCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGANCCTGAGGACACAAGAACCNNCAGAAGNTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACNNCACCATTAAGATCCTTATCACAACTGTACCACCNAATCTCCGCAAGCTGGNNCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAG
  5   1   2       bld DMZ  5g3  in                         xl229e19.5p                                                                                                                                                                                                                                 ACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTG
  5   1   2       bld DMZ  5g3  in                         xl222n02.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTANTGGAGACCCTGAGGACACAANAACCCGCANAANTTCTCACAATGCTGACAAATGANACTGGCTTTGAAATCANCTCANCANACNCCACCATTAANATCCTTATCNNAACTGTACCNCCNANTCTCCNCNNNCTGG
  5   1   2       bld DMZ  5g                              xl274m05.5p                                                                                                                                                                                                                                 ACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGG
  5   1   2       bld DMZ  5g3  in                         xl224k24.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGG
  5   1   2       bld DMZ  5g3  in                         xl331f07.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGG
  5   1   2       bld DMZ  5g3  in                         xl339l04.5p                                                                                                                                                                                                                                 CCGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTG
  5   1   2       bld Ov1  5g                         IMAGE:5073906.5p                                                                                                                                                                                                                                  ACCCACGCGTCCGATTGTGCGGGAGTGTGAGGAACGAAGATCCGAACCATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGT
  5   1   2       bld Emb1 5g                         IMAGE:6632933.5p                                                                                                                                                                                                                                  CGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAAGCACGCACGCTGGGTTGAGGAGAATGCCTCCCATTCTACAGGGAAAGTTTTTAATCCGGGTTGTTTGAAGGATTTGAAGGAGTCGGGTTTCCTGGGATTCGAACCCTCTAACTCCCCTGGGATCCTGGGAACCTCTTGGGGTCACCTATGGCCAGTGGATGGAACAAACCCCCAACCCAGGGGAAGCCCCCTTGGCAAAA
  5   1   2       bld Ga15 5g3  in                       XL441j17ex.5p                                                                                                                                                                                                                                  CGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTG
  5   1   2       bld Emb9 5g                         IMAGE:7977602.5p                                                                                                                                                                                                                                  CGAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTAGA
  5   1   2       chi Emb9      in                    IMAGE:7975041.5p                                                                                                                                                                                                                                  CGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACTTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGAACATGTCCGCTGGCCATAATGGTTGCAAACTTGGTTGCCATTCCAAAAATCCTCCCCCCCTTGAAACCCTTTTCGCCTTTGGGCTTTAGGGTGTTTGAAACCCTGGGGACccaaaaaccccccaaaattttttacaatgctaaaaaaagagaaccgggtttgaaaaccttttccccaaaccccccccTTAGGGTCCCCTTAAAAATGTGGCCCCAAACCTTCCAAGTTGGCCCCAAGTTTCATTTGAAATAAAATTTTTAAAAGGCCCGGGGGCCCTTTGGCCCCCCGGGGGTTTGGAGAAAccccccccTTTCCCGGGGGGGTTTTA
  5   1   2       bld Ga18      in                      xlk129j14ex.5p                                                                                                                                                                                                                                  ACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGNTCTACAGAGCGCACTGNCAGCCATCAGGNACGCACGGNGGTTTGAGGAGAACNCCTCCCATTCTACAGTGAAGGNTTTAATTCGCTTGTTGAAAGACTTGAGGAGNCGGTTNCTGGNTTTNAANCTCTAACTCCCTNGATCCNNGACCTCNTGGGCACTATGCAGTGA
  5   1   2       bld Ga18 5g3  in                      xlk163g12ex.5p                                                                                                                                                                                                                                  ACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGNTGCATTTGGACATCAAAGNTCTACAGAGCGCACTGGCAGNCATCAGGCACGCACGGTGGTTTGAGGAGAANGNCTCCCATTCTACAGTGAAGGNTTTAATTCGCTTGTTGAAAGANTTGAGGNG
  5   1   2       bld Ga18 5g3  in                      xlk143n10ex.5p                                                                                                                                                                                                                                  TCGAGCTGGTGTCCATTGTGCGGGAGTNCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTNCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGANCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGGNACGCACGGTGGTTTGAGGAGAANNNCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGANTTNAGGAGNCGGNTTCCTGGATTTGAACCTCTAACTNCCTGG
  5   1   2       bld Emb1 5g                         IMAGE:6636050.5p                                                                                                                                                                                                                                   GAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCANAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGCTGGGTTTGAGGAAGATGCCTCCCATTCTACAGTGAAGGTTTTTAATCCGGTTGTTGAAAGACTTTGAAGGAGTCGGNTTTCCTGGATTCGAACCTCTAACTCCCCTGGATCCTGGACCTTCTTGGGTAAGTCGCTGGCTCCAGATTTGAATTTTAAGGGGTGGGTCCCTGGTTCCGTCCCTGGGGTTTTCCTTCGGG
  5   1   2       bld Egg3 5g                         IMAGE:6323539.5p                                                                                                                                                                                                                                   CCCGGGAGGTGCCATTGTTCGGGATGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACTATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGGCACTTAATGTGGCCCTACCAAACGCTGCCCTACAGAATTCTTCGCTGCCCGGCCTCTCTTTCCTCCCA
  5   1   2       bld Ga15 5g                            XL520e03ex.5p                                                                                                                                                                                                                                   GAGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGA
  5   1   2       bld Em10 5g                         IMAGE:8319546.5p                                                                                                                                                                                                                                   GAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATCTACAGTGAAGTTTTAATTCGGTGTTGAAGACTTTGAGAGTCGTTTCCTGGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5047727.5p                                                                                                                                                                                                                                    AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCAC
  5   1   2       bld Neu7 5g3  in                         XL005k16.5p                                                                                                                                                                                                                                    AGGCTGGTGTCCTTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATNATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCC
  5   1   2       bld Ga15 5g                            XL429h06ex.5p                                                                                                                                                                                                                                    AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGGTTTCCTGGATTCGAACCTCTAACTCCCTGGGATCCTGGACCTCTTGGGGTCACTATGCANTGATGAACANCCCAACCAG
  5   1   2       bld Ga15 5g3  in                       XL514g12ex.5p                                                                                                                                                                                                                                    AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCNAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATG
  5   1   2       bld Ga18      in                      xlk166p11ex.5p                                                                                                                                                                                                                                    GCCGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNCNNNTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGGNNNTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACNNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGNNNCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCNCACTGGCAGNCATCAGGNACGCACGCTGGNTTGAGGAGAATGCNTCCCATTCTACAGTGAAGNNTTTNATCCNGTTGTTGAAAGANTTGAGGNGNNGGTTTCCTNGNTTCGAAC
  5   1   2       bld DMZ  5g3  in                         xl290o04.5p                                                                                                                                                                                                                                    AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGG
  5   1   2       bld DMZ  5g3  in                         xl257i04.5p                                                                                                                                                                                                                                    AGAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAANGTTTTAATCCGG
  5   1   2       bld Ga12 5g                              XL144i18.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACAC
  5   1   2       bld Ga15 5g                            XL472c10ex.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGG
  5   1   2       bld Emb9 5g                         IMAGE:7977302.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGAATTCGAACCTCTAACTCCCTGGATCCTGGAACCTCTTGGGTCACCTATGCATGATGACATCCATCAAGCAGCACTGGCCACTTAATGTGGCCTTACAAACGCTTGCCTACGAGATTCTCTCTCGTCG
  5   1   2       bld Em10 5g                         IMAGE:7979590.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGATGCCTCCCATCTACAGTGAAGGTTTAATCCNNGTGTGAANGACTGAGAGTCNGTTCCTGGATCGAACTCTACTCCCTGATCTGGACTCTGGGTCCTAGCATGATGACACCACCAGCACCCTGCACTATGTGCTACACCTGCTA
  5   1   2       bld Emb9 5g                         IMAGE:7977806.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGCACGCACGCTGGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTAATCCGGTTGTGGAAAGACTTGAGGAGTCGGTTCCTGGATTCGAAACCTTCTAACTCCCTGGATC
  5   1   2       bld Em10 5g                         IMAGE:8319992.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATCTACAGTGAAGGGTTTATCCGGNNTGTGAAAGACTTGAGAGTNGTTTCCTGGATCGAACTCTACTCCCTGATCTGGACTCTGGGTA
  5   1   2       bld Em10 5g                         IMAGE:8317428.5p                                                                                                                                                                                                                                     GAGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCATTCTACAGTGAAGGTTTAATCCGGTTGTTGAAGACTTGAGAAGCCGG
  5   1   2       bld Ga18      in                      xlk130k11ex.5p                                                                                                                                                                                                                                     GGCCGAGNGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNCNNTTNNNNCCAGAANNNACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGNTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACNNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAANTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGGNACNCACGCTGGTTTGAGGAGAANNCCTCCCATTCTACAGTGAAGGTTTTAANNCNGGNNTTGAANNA
  5   1   2       bld Egg3 5g                         IMAGE:6323647.5p                                                                                                                                                                                                                                      CCCGGGGTCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAAGCGCTGCCTACATCCCT
  5   1   2       chi Tad1                            IMAGE:6877143.5p                                                                                                                                                                                                                                      AGGTTGTCCATTGTGCGGGAGTGTGAGGAACTAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAAAATGGGACCTAACGCATGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCACGCCTCAATCCTTTCTTTGGTAACCGAAATCAACAACGTTATTGACAATTTGATTGTATCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACTAGATAGGGACCATGACCAGTGGGCATAATGTTGCAGACTTGGCTGTCATCCTAGAGATACTTCGCACGTTGGAAGCCGATGCTGCTTTGGGCAATAAAGTACTGGACGACTCTGAGGACACTAGAACCCCGCAGAAGTTCTCACGATGCTGACCAATGAGACTGGGCTTTGAATCAGCTCAGCAGACGGCACCATTCAGAATCTTATCCCAGCTGTAGCACCAAATCTCCGCCATGCTGGACCCCTAATTTCACTTGGGACATCAAAAGTTCTAAAGAGCCGCACTGGGCAGGCCATCAGGGCACCCACCCCTGGGTTTTGAAGAAAAATGGGTTTCCCCATTTCTTACAAGTTGGAAGGAATTTTAATTCCCGGCTGGGTGTGGAAACAACATGGGAAGGAAAATTGCGGTTTTCCCCCGGGAATTCCCCAACCCCTCTTAGT
  5   1   2       bld Sp1  5g                         IMAGE:5513036.5p                                                                                                                                                                                                                                      AGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAANGGTTTAATCCGGTTNGTGAAAGACTTGANGAGTCGGTTTCCTGGAN
  5   1   2       bld Te2  5g                         IMAGE:7211472.5p                                                                                                                                                                                                                                      TCCCCGCGAATTNNCCCGGGATGTGAGGAACGAAAATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAAACACCAACCCAGCAAGCACTGGCAACTAATGTGGGNTACAAACCCTGCCTACAGATTCTCGCG
  5   1   2       bld Ga15 5g3  in                       XL478f17ex.5p                                                                                                                                                                                                                                      AGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGT
  5   1   2       bld Ga15 5x3  out                      XL496d05ex.5p                                                                                                                                                                                                                                      CTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTANCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAANAACCAGCAGAAGTTCTTACNATGCTAACAAATGAGACTGGCTTTGAGATC
  5   1   2       bld Ga15 5g                            XL463l15ex.5p                                                                                                                                                                                                                                      CTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGANAACGCCTCCCATTCTACAGTGAAGGTTTTTAATTC
  5   1   2       bld Ga15 5g                            XL501c10ex.5p                                                                                                                                                                                                                                      CTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCANAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAA
  5   1   2       bld Em10 5g                         IMAGE:7979592.5p                                                                                                                                                                                                                                      CTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTATTCGCTTTGTGAAGACTTGAGATCGGTTTCCTGGATTGAACTCTACTCCCTGATCNNTGACTCTGGGCCTATGCATGATGATATCCACAGCAGNCTGCATCATGTGCTAA
  5   1   2       bld Em10 5g                         IMAGE:8321823.5p                                                                                                                                                                                                                                      CTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAAACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCTAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCCACAGAGCGCACTGGCAGCCATCAGGCACGCCCGGTTGGTTGGAGGAAACGCCCTCCCAACTACAGTGAAAGTTTTAATTCCCTTGTTA
  5   1   2       bld Em10 5g                         IMAGE:8321337.5p                                                                                                                                                                                                                                      AGGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCACGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTGT
  5   1   2       bld Ga18 5g3  in                       xlk80l21ex.5p                                                                                                                                                                                                                                      GCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTNCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGNCACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGACGNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGANCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGNACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTNAAANACTTG
  5   1   2       bld Ga18 5g3  in                        xlk5m07ex.5p                                                                                                                                                                                                                                      CGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTNNNNNCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGGNNNTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGANCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGNTTTGAAATCAGCTCAGCAGACGNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGNANCCAGAATTACACTTGGACATCAAAGNTCTACAGAGCGCACTGGCAGCCATCAGNACNCACGCTGGTTTGAGGAGAANNCCNCCCATTCTACAGNGAAGGTTTNATCCNNTNGNTGNAAGA
  5   1   2       bld Ga18 5g3  in                      xlk122l23ex.5p                                                                                                                                                                                                                                      AGCTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGANNNNACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGNTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGNTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTNGCTTTGAGATCAGTTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGNNCCAGAGNTNCATTTGGNCATCAAAGTNCTACAGAGC
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749602.5p                                                                                                                                                                                                                                       TGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAANCAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAA
  5   1   2       bld Emb1 5g                         IMAGE:6864479.5p                                                                                                                                                                                                                                       TGGCGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACTATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGGTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATTCCTTGAACCTCTTGGGGGCACTATGCAGTTGATGGAATAATCCCAACCAGGGCAGGCCACCTGGGCACTCCAATGGGGGCCCTATTAAGCCCCTGGCCCTACAGAAATCCTTCGCCC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7201878.5p                                                                                                                                                                                                                                       TGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGNAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGAACTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCATTGTGGCCCTATAACCCCTGCCTACAAATCCCTCGCTGCCTGGGCTTTTTCCCCCC
  5   1   2       bld Em10 5g3  in                    IMAGE:7981810.5p                                                                                                                                                                                                                                       CTGGTGTCCTTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTATTCGGTTGTTGAAGACTGAGGAGTGGTTTCCTGAATTGACCTCTACTCCCTGATCTTGACTC
  5   1   2       bld Ga18 5g3  in                      xlk149d21ex.5p                                                                                                                                                                                                                                       CNGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTNACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGNACTCAATGTGGCCTATAAGCNCTGCCTACAGATCCTCGCTNCTGGNCTTTTNCTCCCTGGCTCAGTTGNNATTACAGACCNNNTGAAAGNGGNAACTTCAGGGTNCATACTGTC
  5   1   2       bld Ga18 5g3  in                      xlk108g10ex.5p                                                                                                                                                                                                                                       CNNGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGNNNCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNCAGNCATCAGGCACGCACGGTGGTTTGAGG
  5   1   2       bld Ga18      in                       xlk77h18ex.5p                                                                                                                                                                                                                                       CGAGNGNTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAANTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACNCACGCTGGTTTGAGGAGAANGCCTNCCATTCTACAGTGAAGGTTTTAANNCNGGTTGTTGAAAGANTTGAGGAGTCGGTTTCCTGGATTCGAANCTCTAACTCCCTNGATC
  5   1   2       bld Em10 5g                         IMAGE:8321790.5p                                                                                                                                                                                                                                        GTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTATCCGGNTTNGTGAAGACTG
  5   1   2       bld Ga18      in                       xlk51a15ex.5p                                                                                                                                                                                                                                        CGAGAGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTNNNNNTNNCTCCAGANNNNACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCNNCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGANCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCNNACTGGCAGCNATCAGGNACGCACGCTGGTTTGAGGNGAA
  5   1   2       bld Ga18      in                       xlk68e22ex.5p                                                                                                                                                                                                                                        CTGGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTNNNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGNTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGNCACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGANCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANNACGCACGGTGGTTTGAGG
  5   1   2       bld DMZ  5g3  in                         xl243p04.5p                                                                                                                                                                                                                                        GTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTT
  5   1   2       bld DMZ  5g3  in                         xl292i02.5p                                                                                                                                                                                                                                        GTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGT
  5   1   2       bld DMZ  5g3  in                         xl312e14.5p                                                                                                                                                                                                                                        GTTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTT
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3549822.5p                                                                                                                                                                                                                                         GNAGCCCATTGTGCGGGAGTGTGAGGAACTTTGATCCGAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGTCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAAAAGTTCTCACGATGCTGACAAATGAGACTGGCTTNGAAATCAGCTCAGCAGACGCCACCCTTAAGATCCTTAACACAACTGGACCACCCAAACTT
  5   1   2       bld Emb4 5g                         IMAGE:5570304.5p                                                                                                                                                                                                                                         TTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAAGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGGTTGTTGAAAAACTTGAAGGAATCCGGTTTCCCTGGATTCGAAACCTCTTAACTTCCTGGGATCCTGGGACCTTCTTGGGGTCACTATGGCAGTGGATGGAACAAACCCAACCCAGGCAAGCCACTTGGCCACTT
  5   1   2       bld Emb1 5g                         IMAGE:6630643.5p                                                                                                                                                                                                                                         TTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTTAATCCGGGTTGTTGAAAAACTTTAAGGAAGTCGGGTTTCTGGGATTCCAAACCTCTAAACTCCCTTGTGATCCTGGGAACCTCCTTGGGTTCACCTATGGCCAGTGGAC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6873651.5p                                                                                                                                                                                                                                         TTGTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGGAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCCAATTCTCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCCTGGTTTTGAGGGAGAATGCCTCCCATTCTACAGTGAAAGGTTTTAATCCGGGTTGTTGGAAAGACTTGAAGGGAATCGGGTTTTCCTGGGATTTCAAACCTCTAAACTCCCCGGGATCCTGGAACCCTCTTGG
  5   1   2       bld Emb1 5g                IMAGE:6635446-IMAGp.IMAGp                                                                                                                                                                                                                                         ATTGGCCCGGGGGAGGAGTCGACGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGCTTGAGGAGAATGCCTCCCCATT
  5   1   2       bld Ga15 5g                            XL478i15ex.5p                                                                                                                                                                                                                                         GTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTC
  5   1   2       bld Ga18 5g3  in                      xlk152o16ex.5p                                                                                                                                                                                                                                         GGTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGGNACNCACGGTGGTTTGAGGAGAANGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGANTTG
  5   1   2       bld Ga18      in                      xlk140d14ex.5p                                                                                                                                                                                                                                         AGAGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTTNNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGNTCTACAGAGCGCACTGGCAGCCAT
  5   1   2       bld Ga18      in                       xlk64d07ex.5p                                                                                                                                                                                                                                         AGNGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTNNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGNNTTGAGGAGTCNG
  5   1   2       bld Ga18      in                      xlk130a11ex.5p                                                                                                                                                                                                                                          GGTTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTTGNNTCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGGNNNTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGNCTCAATCCTTTNCNTTGNNAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAG
  5   1   2       bld Ga18      in                      xlk140i05ex.5p                                                                                                                                                                                                                                          GTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNNACNCACGGTGGTTTGAGGAGAACNNCTNCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGANTTGAGGAGNCGNNNCCTGGATTTGAANCTCTAACTCCCTGGATCCTNGACNNNNTGGGGNNNTATGCAGNG
  5   1   2       bld Ga18 5g3  in                      xlk127b16ex.5p                                                                                                                                                                                                                                          GTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGNTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTNNAGCAGANNNCACCATTNANGGTCCTCATCACNA
  5   1   2       bld DMZ  5g                              xl227i19.5p                                                                                                                                                                                                                                          CCATCGATTCGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGA
  5   1   2       chi Emb4                            IMAGE:5571467.5p                                                                                                                                                                                                                                           CCACGCGTCCGGNGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCCTACAACAACTGAGCAGGGCCTCAATCCTTTCTTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGAAACCTTTGAAGTGGCAAATTGAAGAGGTGCGACAGGTGGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAAACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAAACCCGCAGAAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGAATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGTTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGACATGGTTTTGTTACACTGCCCAAACGTTGGGTCCGAATTCTCTCCCCCGGAGGCTTAAAGGAAAATTTTGGGGCTGGGGAGGGAAAT
  5   1   2       bld Em10 5g                         IMAGE:7982343.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCTTCCCATCTACAGTGAAAGTTTTATCCGGGTGTTGAAAGACTGAG
  5   1   2       bld Emb9 5g                         IMAGE:7977607.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAAGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTAACAGTGAAAGGTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGGTTTCCCTGGATTTGAACCCTCTAACTC
  5   1   2       bld Em10 5g                         IMAGE:8321699.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGTTTTAATTCGCTTGTTGAAAGACTTGAGGAG
  5   1   2       bld Ga18 5g3  in                       xlk67g21ex.5p                                                                                                                                                                                                                                           GTGTCCATTGTGCGGGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGNNCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGGTGGTTTGAGGAGAANGCCTCCCATTCTACAGTGAAGGTTTTNATTCGGTNGTTGAAAGACTTGAGGAGNCGGTTTCCTNGNTTTGAANCTCTAACTCCCTNG
  5   1   2       bld DMZ  5g                              xl283h09.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAG
  5   1   2       bld DMZ  5g3  in                         xl315l06.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGT
  5   1   2       bld DMZ  5g3  in                         xl301m21.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAA
  5   1   2       bld DMZ  5g3  in                         xl274f20.5p                                                                                                                                                                                                                                           GTCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTT
  5   1   2       bld Tbd7 5g3  in                         XL074p03.5p                                                                                                                                                                                                                                            GCATTGTGCGGGAGTGTGAGGAACGAAGNATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCA
  5   1   2       bld Ga15 5g3  in                       XL442p21ex.5p                                                                                                                                                                                                                                            TCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGANATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACCGTG
  5   1   2       bld Ga15 5g3  in                       XL460p22ex.5p                                                                                                                                                                                                                                            TCCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGATCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCCGGTTGTTGAAAGACTT
  5   1   2       bld Ga18 5g3  in                      xlk108a10ex.5p                                                                                                                                                                                                                                            TTGTCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNGNNNTTTNNTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGGNNNTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGNTTTGAAATCAGCTCAGCAGACGNCACCATTAAGATCCTTATCACAACTGTACCACCNAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGCTGGTTTGAGGAGAANNCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAGANTTGANNGTCGGTTNCTNGGATTCG
  5   1   2       bld Ga18 5g3  in                      xlk156d07ex.5p                                                                                                                                                                                                                                            GTCCATTGTGCGGGAGTGTGAGGNANNACGATCAGGAACATGAGGGGNGAACGAGGACGTGGACGTGGCCGCTTTGGNCCAGAATGGGACCTAACGCAGGNTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGNGTGAAANCCGCCCCAGATGATGGCACACTCAGNGAGGNGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGNAACCAAAAT
  5   1   2       bld Gas8 5x                         IMAGE:3517212.5p                                                                                                                                                                                                                                             CATTGTGCGGGAGTGTGAGGTATACGAACATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATGTGATTGTAGCCCCTGGAACCTTGGAAGTGCAAATTGAAGAGGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGG
  5   1   2       chi Emb1                            IMAGE:6635446.5p                                                                                                                                                                                                                                             CCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTANAGATCCTTCCCACTTTGGGAAGCCCGTTTCTGGCTTTGGGCAATAAGGGTAGTGGGAGACCCCTGAAGGACACAAGAAACCCCGCAGAAAGGTTCTCCACGATGCTTGACAAAATGAGAACTGGCCTTTTGAAAATCAGCCTCAGGCAGGACGGCCCCCCATTTAAGGATCCTTTTATTCACAAACTGGTACCCACCAAAATCTTCCCGCCAAGCTTGGGACCCCAAGAAATTTACAACTTTGGGAACCATCCAAAAAGTTTCCTAACCAGAAGCCGGCAACTTGGGGCAAGTCCCATTCAAGCCGATCGCCAACCGGCTGGGATTTTGGAAGGAAAGAAATGGCCCTTCCCCATTTTCTAACCGGTGGAAAGGGTTTTTTACATCCCCGGTTTGGTTGGAAAAAAACTTTGAAGGGAAGTCCCGGTTTTCCCTGGGAATTTCCAAAAACCTTCTAAAACTTCCCTTGGGAAATCCTTGGGAACCCTCCTTTGGGGGTTCCACTTAATGGCCAAGTGGGTTGAAAACCAAACGCCCAACCTCAGGGGCAAGCCCCCCCTGGGGCACCTTTTTAATgggggggggCCCTTAACCAAAAACGCGCTGGGGGCCTTAAAACAAGAATATTTCTTTTC
  5   1   2       bld Emb1 5g                         IMAGE:6635671.5p                                                                                                                                                                                                                                             CCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCANAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGGTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTTCGCTTGTTGAAAGACTTGAANGAGTCGNGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAAATATCCAAACAAGGCAGCCCACTGGGCACTCAATGGTGGCCCTATAAAGCGCTGCCTTACAGNATCCTTCCGCTGGCGGGGCCTTTTCCTTCCCTGGGCTCAA
  5   1   2       bld Egg3 5g                         IMAGE:6866728.5p                                                                                                                                                                                                                                             GATTCCCGGGGGGAGTGTGAGGTCGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGANGAGTCGGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGGCACTATGCAGGGGATGAATAAATCAACCAGGCAACCCACTGGGCACTCCAATGTGGGCCCTATAAAGCGCTTGCCCTACAGGATCCCTCGGCTGGCC
  5   1   2       bld Emb9 5g3  in                    IMAGE:7973950.5p                                                                                                                                                                                                                                             GTCCGGATTCCCGGGATCGAGGACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCTAGCTGGACCCAGAGTTGCATTTGGACATCAAAAGTCTACAGAGCGCACTGGCAGCCATATGCACGCACGGTGGTTGAGGAGACGCCTCCCATCTACGTGAAGTTTTATTTCCTTGTGAAAACTGAGGAGCGGTTTCTGGATTGACTCTACCCCTGATCTGACTCTTGGGCCTTGGTGTAATAACCACGGCGCCCGGCTCATGGGCAAACCTCTAAATCCCCGCGTTTCCCCGTCATGCTAAACCGAAATGCATGGTTATTA
  5   1   2       bld Em10 5g3  in                    IMAGE:7981221.5p                                                                                                                                                                                                                                             CCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCATTCTACAGTGAAGGTTTAATTCGCTGGTGAAGACTTGAGAGCGGTTTNCTGATTTGAACTCTACTCCCTGATCCTGACTCTGGGCACTTGCAGGATGATATCAACAGGAGCCTGCATCAA
  5   1   2       bld Em10 5g                         IMAGE:8321148.5p                                                                                                                                                                                                                                             CCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAAGTTTAATCCG
  5   1   2       bld Brn3 5g                         IMAGE:8541121.5p                                                                                                                                                                                                                                             CCATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAGGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCAGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGNCAGCTGGACCCAGAATTACACTTGGACATCNAAGTCTACAGAGCGCGCTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCATTCTACGTGAAGTTTTATCCGTTGTTGAAGACTTGAGATCGTTTCCTGATCGAACTCTACTCCTGATCTGGACTTCTGGTCCATGCATGAGACACCCACAGCAGCCTGCACTAGG
  5   1   2       bld Em10 5g3  in                    IMAGE:7980360.5p                                                                                                                                                                                                                                              CATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCACGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAAATCCGGTTGTTGAA
  5   1   2       chi Emb1                            IMAGE:5154958.5p                                                                                                                                                                                                                                               CCACGCGTCCGGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCCAACTGGAAGGCCCGTTCTGCTTTTGGGCATTAAGGTAGTTGAAAACCCTGAGGGACCCAAGAACCCGGCCggaagttttttaaaaaggtttaccaaaagggaaaagggcttttgaaaaacagtttcaacaaaaccccccccctttagggggcccccatcaaaaatgggggccgcccccaaaccttacccaaaaggggggaccccaAAAATTGGAATTTTTGGAACAATCAAAAGGTTTTTAAAAAAAGGcccctgggggcccccctttggggccccccccgggggggttttttaaaaaaaaaaaaacccccccccctttttttaagggggggaggggtgttttttaacccccccctgtgggggaaaaaaaacctttgggggggggggCCGCCTCTCCC
  5   1   2       bld Egg3 5g                         IMAGE:6868642.5p                                                                                                                                                                                                                                               TCCCGGGGGGAGTGTGAGGAACCACGATCAGGAACATGAGGGGTGAACTAGCACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAAATCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAAGCGCTGCCTACAGATCCTCGCTGCTGGTCTTTTTCCTCCCTGGCTCAATTGGCATTACAGAACCCCTTGTGAAAGTGGCAACCTTCCGGGTTCATACTGTCATGAACTCTGGAAGCAACA
  5   1   2       chi Emb9                            IMAGE:7978465.5p                                                                                                                                                                                                                                               GTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGTTTCAGACTCTTCGTCCTCACATTCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGGAACCAAGATCTGGGCTCCTACAACAACTGAGCAAGGCCTCCATTTCTTTCTCTGGGTAACCAAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCCTGGAAACTTTGAAGTGCAAATTGAAGAGGTGCCGACAGGTGGGCTCCTAACAAAAAAGGGAACAATGTCCGCTTGCATAATGGTTGCAGAACTTGGTTGTCTTCCAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTACGTAGTTGAGACCCTGAGGAACAGGATCCAGCGAAAGTCTTCATGCTACCATAGTACTGGCTTGTAATCGTAACCGAAGGCATCATTATAGGTTAATCCAACGTGCCCCGAACCATAGTGACTGGGACCGAGTTGCATTGTATTTCAGTCCTAAAGCACATGGCGCG
  5   1   2       bld Ga18 5g3  in                      xlk134a18ex.5p                                                                                                                                                                                                                                               TCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTTGNNTCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGNCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCNTGGAACCTTTGAAGNGCAAATTGAAG
  5   1   2       bld DMZ  5g3  in                         xl314g14.5p                                                                                                                                                                                                                                               TCGATTCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGAC
  5   1   2       bld DMZ  5g3  in                         xl245o02.5p                                                                                                                                                                                                                                               ATTGTGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAA
  5   1   2       bld Emb4 5g                         IMAGE:5543288.5p                                                                                                                                                                                                                                                CCACGCGTCCGCCCACGCGTCCGCGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGNTTTTAATTCGGTTGTTGAAAGACTTTGAGGAGTCGGNTTTCTGGGATTTGAACCTCTAACTCCCTGGATCCTTGACCCTCTTGGGGCACTATGCAGTGGATGAATAATTCCAACCAGCCAACCCACTGGCAACTTCATGGGGGCCCTTATAAACGGCTGGCTACAGAACCCTCGCCTGGCTGGGCCTTTTTCCCTCCCCTGGGG
  5   1   2       chi Egg3                            IMAGE:6325410.5p                                                                                                                                                                                                                                                CCCCGGGACTGACTGTATCACATATAGAGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAACGTTTTACTTCGCTTGAAGAGATACTAATTCCACTCTGGTTGAAAGAACTGTGAAGAGAGCCGGTTTCCCTGGAATTTGAAACCTCTAAACTCCCCTGGAATCCTTTTGACCTCTTGGGGGCACCTATGCGGTGGATGAATAAATCCAAACCAGGGCAGCCCACTGGGCAACTTCAATGTGGCCCATATAAGCCGCCTTGCCTAACAGATCCCTCCGCCTGCTGGGCCTTTTTCCTCCCCTGGGCCTCAGTNTGGGGAATTACAGGACCCCCC
  5   1   2       bld Em10 5g                         IMAGE:7979161.5p                                                                                                                                                                                                                                                 GGGATGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCAATCTACAGTGAAGTTTTATCCGGTTGTTGAAGACTTGAGAGTCGGTTCCTGGATCGAACTCTACTCCTGGATCCTGACTCTTGGTCCTAGCATGATGACACCCACCAGCACACTGGCCTATGTG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075051.5p                                                                                                                                                                                                                                                 GGCCGGATTCCCGGGATGACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTNCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGANGAGTCGGTTTCCTGGATTCGAANCCTCTACTCCTGGATCTGGGACCTCTGGTCACTATGCATG
  5   1   2       bld Ga18      in                       xlk75a23ex.5p                                                                                                                                                                                                                                                 TCCATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNCNNTTNNNNCCAGAATGGACCTAACGCAGGNTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGNGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCNCACTGNCAGCCATCAGGNACGCACGCTGGTTTGAGGAGAATNNCTNCNATTCTACAGTGAAGGTTTTAANNCCGNNNTTGAAAGA
  5   1   2       bld Ga15 5g                            XL444l19ex.5p                                                                                                                                                                                                                                                   TGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGTTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGNATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACNAAACGCTGCCTACAGA
  5   1   2       bld Ga15 5g                            XL464m03ex.5p                                                                                                                                                                                                                                                   TGCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCT
  5   1   2       bld Neu7 5g3  in                         XL018n01.5p                                                                                                                                                                                                                                                    CACGAGGGTGAGGAACGAAGNATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTG
  5   1   2       bld Ga15 5g3  in                       XL432a19ex.5p                                                                                                                                                                                                                                                    GCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGGAGTCGGTTTCCTGGATTCNAACCTCTAACTCCCT
  5   1   2       bld Ga15 5g3  in                       XL434f16ex.5p                                                                                                                                                                                                                                                    GCGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCCTGGATTCGAACCCTCTAACTCCC
  5   1   2       bld Ga18      in                       xlk66j20ex.5p                                                                                                                                                                                                                                                    ATTGTGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTNNNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGNACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGNTTTAAT
  5   1   2       chi Egg3                            IMAGE:6871331.5p                                                                                                                                                                                                                                                     TCCCGGGGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGCCACTGAGATGTCACCCTGGGGACGGTGTCATTTGTGACCCCCTTCAGAGAAAGGGCCTATGAGAAAGCCCCCCTGAAGAGGAAAAGAAAGGAGAAGGAAGGACGTATTTACCCCAGGAAAAATTCCCAGAAAAGGTGGCCTGAAAAAAATAGAAGGGAAAAGTTTATGGGGAAGACCCCCAAGC
  5   1   2       bld Ga15 5g                            XL432c09ex.5p                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCNA
  5   1   2       bld Ga15 5g                            XL436g16ex.5p                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGTTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCCTCTAACTCCCTGGATCCTGGACCTCT
  5   1   2       bld Ga15 5g                            XL445n02ex.5p                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAA
  5   1   2       bld DMZ  5g3  in                         xl221l21.5p                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAAATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGG
  5   1   2       bld DMZ  5g3  in                         xl322e19.5p                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGC
  5   1   2       bld DMZ  5g3  in                         xl307d19.5p                                                                                                                                                                                                                                                     CGGGAGTGTGAGGAACGAAAATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGAC
  5   1   2       bld Em10 5g3  in                    IMAGE:7983143.5p                                                                                                                                                                                                                                                      GGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGTTTTAATTCGCTTGTTG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981675.5p                                                                                                                                                                                                                                                      GGGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATNCAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTTATCCGGTTGTTGAA
  5   1   2       bld DMZ  5g3  in                         xl242p10.5p                                                                                                                                                                                                                                                      GGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATT
  5   1   2       bld DMZ  5g3  in                         xl315p11.5p                                                                                                                                                                                                                                                      GGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAA
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202124.5p                                                                                                                                                                                                                                                       GGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTATCCGGTTGTTGAAGACTTTGAGAGTCCGTTTCCTGGATTCCAACTCTACTCCCTGGATCCTGAACCTCTTGGGTCATTTGCAGTGATGAACACCCAC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7765022.5p                                                                                                                                                                                                                                                       GGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGGAGAAATGCTCCATTCTACAGTGAAGGTTTTATCCGG
  5   1   2       bld DMZ  5g3  in                         xl280e15.5p                                                                                                                                                                                                                                                       GGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGAC
  5   1   2       bld DMZ       in                         xl292p06.5p                                                                                                                                                                                                                                                       GGAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTT
  5   1   2       bld Ga10 5g3  in                    IMAGE:3558347.5p                                                                                                                                                                                                                                                        GAGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATC
  5   1   2       bld Ga15 5g3  in                       XL459i14ex.5p                                                                                                                                                                                                                                                        CTCCGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGGATGAA
  5   1   2       bld Ga18      in                      xlk145k19ex.5p                                                                                                                                                                                                                                                        TGCGGGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNCNNTTTNNNCCAGANNNNACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGNTTTGAAATCAGCTCAGCAGACNNCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCNCACTGNCAGCCATCAGNACGCACGCTGGTTTGAGGAGAATNNCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGNTTCCTGGATTCGAANNTCTAACTCCCTGGATCCTGGACCTNNTGGGTCACTATGCAGNGAT
  5   1   2       bld Ga18      in                      xlk131j11ex.5p                                                                                                                                                                                                                                                        GGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGANCCAGAGNTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACNNACGGTGGTTTGAGGAGAANGCCTCCCATTCTACAGTGAAGGTTTTAANTCGCTTGTTGNAAGACTTGNG
  5   1   2       bld Em10 5g                         IMAGE:8321578.5p                                                                                                                                                                                                                                                         TGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCATGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAG
  5   1   2       bld Ga18      in                       xlk53c11ex.5p                                                                                                                                                                                                                                                         TGNNNAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNGCNNTTNNNNCCAGAATGGACCTAACGCAGGNTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGNAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGNCCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNACGCACGCTGGTTTGAGGAGAANNCCTCCCATTCTACAGTGAAGGTTTAATCCGGTTGTTGAAGACTTGANGA
  5   1   2       bld Ga18 5g3  in                      xlk131b11ex.5p                                                                                                                                                                                                                                                         GGAGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNTCCAGNANNNACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTNNTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGANCATGAGGACACAAGAACCAGCAGAAGNNTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGANNNCNCCATTNANGGNCNTCATCNC
  5   1   2       bld Ga18 5g                           xlk121d20ex.5p                                                                                                                                                                                                                                                         GGNGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGANNNNACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNNACGCACGGTGNNTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGANTTGAGGAGTCGNTTTCCTGGNTTTGAANCTCTAACTCCCTNG
  5   1   2       bld DMZ  5g3  in                         xl293f13.5p                                                                                                                                                                                                                                                         AGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTG
  5   1   2       bld DMZ  5g3  in                         xl292f13.5p                                                                                                                                                                                                                                                         AGTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGA
  5   1   2       bld Neu4 5g                         IMAGE:4085394.5p                                                                                                                                                                                                                                                          GTGTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAAGACCAAGAACCCG
  5   1   2       bld Egg3                            IMAGE:6869717.5p                                                                                                                                                                                                                                                          GATTCCCGGGTGCGAGGACGACTCTCGGAAATGAGGGGTGAACGAGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTAACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGCCTTATAAACGCTGCCTACAGATCCTCCGCTGCTGGGTCTTTTTCCTCCCCGGGCTCAGTTTGGCATTACAGAACCCCCGTTGAAAATGGGCAACCTTCAGGGGTTCATAATTT
  5   1   2       bld Em10 5g                         IMAGE:8321825.5p                                                                                                                                                                                                                                                          GTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACCAGAACCAGCAGAAGTTCTTACAATGCTTACAAATGAGACTGGCTTTGAGATCAGTTCAACAGACGCCACCATTAATGTCCTCATCACAACTGTGCCGCCAAACCTACTCAAGCTGGACCCAGATTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGTCATCATGCACGTCACGGAGGTTTGAGGAAAACGCCTCCCATTCTAAGCGAAGGTTTTATTTCTCTTGTGAAAAACCTGACGATCGGTTTCCTGGATTTGAACCTC
  5   1   2       bld Ga18 5g3  in                       xlk75l10ex.5p                                                                                                                                                                                                                                                          AGTGTGAGGAANGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTNNTCCAGAATGNGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGNTGTTGAAAGANTTGAGGAGTCNGNNTNCCTGNATTTGAANCTCTAACTCCCTNG
  5   1   2       bld Emb4 5g                         IMAGE:4970428.5p                                                                                                                                                                                                                                                           TGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCC
  5   1   2       bld Ga15 5g                            XL478j14ex.5p                                                                                                                                                                                                                                                           TGAGGAACGACGATCANGAACNTGANGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCATGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCANGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGTAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTT
  5   1   2       bld Emb4 5g                         IMAGE:4680672.5p                                                                                                                                                                                                                                                            GTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGGTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGGGGAGACCCTGAAGACACAAGAACCCGCAGAAAGTCTCACC
  5   1   2       bld Ga15 5g3  in                       XL437b16ex.5p                                                                                                                                                                                                                                                            GTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCNAACCTCTAACTCCCCTGGNATCCTGGAC
  5   1   2       bld Ga15 5g3  in                       XL462n13ex.5p                                                                                                                                                                                                                                                            GTGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGAACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACC
  5   1   2       bld Emb9 5g                         IMAGE:7974841.5p                                                                                                                                                                                                                                                            GTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAAAACGCCTCCCATTCTACAGTGAAGGT
  5   1   2       bld Em10 5g                         IMAGE:7979028.5p                                                                                                                                                                                                                                                            GTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATNCAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTGAGGAGTCGGNTTCCTGGATTTGAACTTCTACTCCCTGGATCTTGA
  5   1   2       bld Ga18      in                      xlk138o13ex.5p                                                                                                                                                                                                                                                            GGAGTGTGAGGAANGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNNNNNTTTNNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCANNNCGCACGCTGGNTTGAGGAGAATNCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGANTTGAGGNGTCGGNTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTG
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3550277.5p                                                                                                                                                                                                                                                             TGTGAGGAACGAAGACCGAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGAC
  5   1   2       bld Ga15 5g                            XL412j19ex.5p                                                                                                                                                                                                                                                             TGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGG
  5   1   2       bld Ga15 5g3  in                       XL479d23ex.5p                                                                                                                                                                                                                                                             TGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTG
  5   1   2       bld Ga15 5g                            XL479e20ex.5p                                                                                                                                                                                                                                                             TGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCCTGGATCCCTTGACCTCTTGGG
  5   1   2       bld Ga15 5g3  in                       XL514b06ex.5p                                                                                                                                                                                                                                                             TGAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGGATTCGAACCTCTAACTCCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCA
  5   1   2       bld Ga15 5g                            XL434m18ex.5p                                                                                                                                                                                                                                                             CGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTG
  5   1   2       bld Em10 5g                         IMAGE:8320415.5p                                                                                                                                                                                                                                                             CGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATCTACAGTGAAGGTTTAATTCGCTTGTGAAGACTTGAGAGTCGTTTCTGGATTGAACTCTACTCCTGATCTTGACTCTGGGCACAGCATGAGATATCCACAGCACCCTGGCTCATGTGCTTAC
  5   1   2       bld Te2  5g                         IMAGE:7392033.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCCATCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTCGAACCTCTACTCCCTGGATCCTGGACCTCTGGGTCACTATGCAGTGATGAACAC
  5   1   2       bld Em10 5g                         IMAGE:7983029.5p                                                                                                                                                                                                                                                              TGAGGACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCATGCACGCACGCTGGTTTGAGGAAAATGCCTCCCATTCTACAGTGAAAGGTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGT
  5   1   2       bld Em10 5g                         IMAGE:7980792.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTNCCATTCTACAGTGAAGGTTTTTATCCGGTTTGTGAAAGACTTGAGGAGTCGGTTTTCTGGNATCGAACCTCTAACTCCCT
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976268.5p                                                                                                                                                                                                                                                              GAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGACGCCTCCCATCTACAGTGAGGGTTTAATTCGGTGTTGAAAACTGAGAATCNGTTCTGGATTTGACTCTACTCCCTGATCTTGACTCTTGGGGCTATGCATGTGAAAACCACCAGGCACCCTGCCTCTGGGGCTAAACCTCCAAAATCTCCGCTGTTTTCCCCGCCATGGATAAACCCGGAAGGCATTTGG
  5   1   2       bld Em10 5g                         IMAGE:8319173.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGAA
  5   1   2       bld DMZ  5g3  in                         xl304j04.5p                                                                                                                                                                                                                                                              GAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGA
  5   1   2       bld DMZ  5g3  in                         xl318d18.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAATCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGA
  5   1   2       bld DMZ  5g                              xl248g21.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCNGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGANTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAAT
  5   1   2       bld DMZ  5g                              xl255c07.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGA
  5   1   2       bld DMZ  5g3  in                         xl227h01.5p                                                                                                                                                                                                                                                              GAGGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAANGTTTTAATCCGGTTGT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048306.5p                                                                                                                                                                                                                                                               AGGAACGACGATCCGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCCGCCAAACTACGCAAGCTG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048308.5p                                                                                                                                                                                                                                                               AGGAACGACGATTATGACCATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGACTTCCCTCGTGTGAAACCCGCCCCATATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGCGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAATCCGTTTCTGCTTTGGGCATTAAGGTAGCTGAGACCATGAGGACACTATAACCAGCATAAGTTCTTACAATGCTAACCAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGGTCTCATCACGACTGTGGCGCCAAAACTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGGCAGCATCAGG
  5   1   2       bld Oo1  5g                         IMAGE:6639726.5p                                                                                                                                                                                                                                                               TGCAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCANAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGANGAGTCTGTTTCCTGGATTTGAACCTCTAACTCCCTGGNATCTTGACCNNTCTGGGCACTATGCAGTGATGAATAATCCANCCAGCAGNCACTGGCACTNCATGTGGGCTATAAGCGCTGCCTACAGATCCTCGCTGCTGGTCTTTTCCNTCCTGCCTCAGTTGCCATTACAGACCCCCTGGGAAGTGGCAACTTCAGGGNTCATACTGTCATGACTCTGGAGCACCAGGACATGGGTTTGGTACACTGCCCCAGACGGTTGGTCCGGATTTCTCTCACACGGAGCCTAACAGGGAAC
  5   1   2       bld Emb9 5g                         IMAGE:7978252.5p                                                                                                                                                                                                                                                                GGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCACGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTC
  5   1   2       bld Em10 5g                         IMAGE:7983502.5p                                                                                                                                                                                                                                                                GGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGTTTTATCCNNGTGNNTGAAGACTGAGGAGTCGGTTCCTGGATCGAACCTCTACTCCTGGNATCTGGGACTCTGG
  5   1   2       bld Ga18      in                      xlk108f21ex.5p                                                                                                                                                                                                                                                                TGTGAGGAANGAAGATCCGAAACATGAGGGGNGAACGAGGACGTGGCCGNNNNNTTTGCTCCAGNNNNNNCCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGNCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGNCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGCTTCTNNTTTGGGCAATAAGGTAGTGGAGANCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGNNCCAGAATTACACTTNGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGNNACGCACGCTGGNTTGAGGAGAATGNCTNCCATTCTACAGTGAAGGTTTAATCCNNNTGTTGAAAGANTTGAGGAG
  5   1   2       bld DMZ  5g                              xl255i05.5p                                                                                                                                                                                                                                                                GGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGNAAGGTTTTAATCCGGTTGTTGAAAG
  5   1   2       bld DMZ  5g                              xl287k09.5p                                                                                                                                                                                                                                                                GGAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCC
  5   1   2       bld DMZ  5g3  in                         xl330d04.5p                                                                                                                                                                                                                                                                GGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACT
  5   1   2       bld Ga15 5g                            XL432m13ex.5p                                                                                                                                                                                                                                                                 GAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGGCACTATGCAGTGATGAAATAATCCCAACCAGGCAGCCACTG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7765443.5p                                                                                                                                                                                                                                                                 GAACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATCTACAGTGAANGTTTAATCCCCGGTGTGAAGACTGAGGAGCGGTTTCTGGATCGAACTCTACTCCTGGATCTGGACTCTTGGTACTATGATGATGACACCCACAGCAGCCTGCACTATGTGCTAAACCTGCTCGATCCGTGCGCTCTCTCTGCTATGATACACCGGAATGATCAGTCCCGCGACT
  5   1   2       bld Em10 5g3  in                    IMAGE:7982111.5p                                                                                                                                                                                                                                                                 GGACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTGA
  5   1   2       bld Ga15 5g3  in                       XL403i16ex.5p                                                                                                                                                                                                                                                                  AACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCANATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCANAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCCTGGATCCTTGACCTCTTGGGGGCACTAT
  5   1   2       bld Em10 5g                         IMAGE:7983494.5p                                                                                                                                                                                                                                                                  GACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTTATCCGGTTGTTTGAAGACTTGAGGAGTCGGGTTCCTGGNATCGAACCTCTAACTCCCTGGATCCTGGGACCTCTGGGTCATATGCAGTGATGAACACCCA
  5   1   2       bld FaBN 5g                         IMAGE:8077259.5p                                                                                                                                                                                                                                                                  GACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACNTTGGACATCAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCATTCTACAGTGAAGGTTTAATCCNGTCGTTGAAGACTTGAGAGTCGGTTTCCTGGATTCAAACTCTAACTCCTGGATCCTGACTCCTGGGCACTAGCAGTGATGAA
  5   1   2       bld DMZ  5g3  in                         xl243g14.5p                                                                                                                                                                                                                                                                  AACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCT
  5   1   2       bld DMZ  5g3  in                         xl319n22.5p                                                                                                                                                                                                                                                                  AACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACT
  5   1   2       bld DMZ  5g3  in                         xl274k01.5p                                                                                                                                                                                                                                                                  AACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTT
  5   1   2       bld Em10 5g                         IMAGE:8320322.5p                                                                                                                                                                                                                                                                   ACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTTGGGCATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAGTTCTACAGAGCGCACTGGCAGCCCATCAGCACGCACGCTGGTTTGAAGAGAATGCTCCCCATCTACATGAAGGTTTTAATCGGTTGTTGAAAGACTTGAGAGCGGTTTCCTGAATTCAACTCTACTCCTGGATCTGGACCCTTGGTCATTGCATGAGAACACCAACAGGCACCCTGCACTAGTTGCTAAACCTCCTCAATCTCG
  5   1   2       bld Ga18 5g3  in                       xlk66a16ex.5p                                                                                                                                                                                                                                                                   GANCGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGNTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGNCTTGAGGNGNCGGTTCCTNGNTTTGAACCTCTNACTCCCTGG
  5   1   2       bld DMZ  5g3  in                         xl239a09.5p                                                                                                                                                                                                                                                                   ACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTG
  5   1   2       bld DMZ  5g3  in                         xl239h15.5p                                                                                                                                                                                                                                                                   ACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTG
  5   1   2       bld Ga15 5g                            XL411l23ex.5p                                                                                                                                                                                                                                                                    CGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAA
  5   1   2       bld Ga15 5g                            XL444i09ex.5p                                                                                                                                                                                                                                                                    CGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAANATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCANACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCANCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCANGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCC
  5   1   2       bld Ga15 5g                            XL458i24ex.5p                                                                                                                                                                                                                                                                    CGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACC
  5   1   2       bld Ga15 5g3  in                       XL470p13ex.5p                                                                                                                                                                                                                                                                    CGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTG
  5   1   2       bld Ga15 5g3  in                       XL407j23ex.5p                                                                                                                                                                                                                                                                    CGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTACCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAA
  5   1   2       bld Ga15 5g                            XL448h14ex.5p                                                                                                                                                                                                                                                                    CGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACT
  5   1   2       bld Emb9 5g                         IMAGE:7974296.5p                                                                                                                                                                                                                                                                    CGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTTGAAGACTTGAGGAGTCCGTTCCCTGGATTCGAACCTCAAACTCCTTGGATCCTGACTCTTGGGTACTATGCGTGATGAACAACCCACCGGCAC
  5   1   2       bld Em10 5g3  in                    IMAGE:7981798.5p                                                                                                                                                                                                                                                                    CGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATT
  5   1   2       bld FaBN 5g                         IMAGE:8076897.5p                                                                                                                                                                                                                                                                    ACGAAGATCCGAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTTATCCNGTTNNGTGAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACNNTCTACTCCTGNNATCTGGA
  5   1   2       bld DMZ  5g3  in                         xl249n22.5p                                                                                                                                                                                                                                                                    CGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAAGGTTTTAATTCGCTTGTTGAA
  5   1   2       bld Egg3 5g                         IMAGE:6323560.5p                                                                                                                                                                                                                                                                     CCCCGGGGACAGGAAGTGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGGAGGAGGAACGCCCTCCCATTCTACAGTGGAGGGTTTAATTCGCCTTGGTGAAAAGAATTGAGGGAGCCGGGTTTTCCGGGAATTTGAAACCTCTAACCCTCCCCTGGAAATCCTTTGAACCTTCTTTGGGGGGCAACTAAGTGCCAGGGGAATGAAAATAAATTTCCCAAACCCCAGGGG
  5   1   2       bld Emb9 5g                         IMAGE:7976861.5p                                                                                                                                                                                                                                                                     GAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGC
  5   1   2       bld Ga18      in                      xlk127h11ex.5p                                                                                                                                                                                                                                                                     CGACGATCAGGAACATGAGGGGNGAACGAGGNCGTGGACGTGGCCGCTTTNNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGNTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGNTTTANTTCGCTTGTTGAAAGANTTGAGGAGNCGGNTTCCTGGATTNA
  5   1   2       bld Ga12 5g3  in                         XL212n03.5p                                                                                                                                                                                                                                                                       GAGGCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGG
  5   1   2       bld Em10 5g                         IMAGE:8321385.5p                                                                                                                                                                                                                                                                       AGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTGCCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCACGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGA
  5   1   2       bld Ga18      in                       xlk64i19ex.5p                                                                                                                                                                                                                                                                       AACGAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNGNNNTTTNNNCCAGANNNNNCCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACGCACGCTGGTTTGAGGAGAATNNCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGANTTGAGGAGNCNG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959953.5p                                                                                                                                                                                                                                                                         ATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTG
  5   1   2       bld Ga15 5g3  in                       XL458b14ex.5p                                                                                                                                                                                                                                                                         ATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAG
  5   1   2       bld Ga18      in                      xlk145h11ex.5p                                                                                                                                                                                                                                                                         GATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGNTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGNCATCAGGNACGCACGGTGNNTTGAGGAGAACGNCTNCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGNCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTG
  5   1   2       bld Ga18 5g3  in                      xlk118e08ex.5p                                                                                                                                                                                                                                                                         GATCAGGAACATGAGGGGNGAACGAGGACGTGGACGTGGCCGCTTTGNNCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGNCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGNCCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGNACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTNATTCGCTTGTTGAAAGACTTGAGG
  5   1   2       bld Egg5 5g3  in                    IMAGE:3431727.5p                                                                                                                                                                                                                                                                          TCCGAAACATGAGGGGTGAACGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGGAGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTTCGCAAGCTGGACCCAAAATTACACTTGGACATCAAAGTTCTACAAAGCGCA
  5   1   2       chi Eye1                            IMAGE:6947502.5p                                                                                                                                                                                                                                                                          CCGGAATTTGCCGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAAGCACGCACGGTGGTTTGAGGAGAACGCCTCCCACTCTACAGTGAAAGTTTTAATTCGGTTGTTGAAAAACTTGAGGAGTCGGTTTCCTGGATTTGAACCCTCTAACGCCCTGGATCCCTTGAACCTCTTTGGGGGCACCTATGCAGGGGAATGGAATAATTCCCCACCCAGGGTTAGGCCAACTGGGGCACTTTAAATGGCGGGCCTTAAAAAAGGCGGCTTGGCCTCAACCAGAAAACACTCCGCC
  5   1   2       bld Ga18      in                      xlk121k06ex.5p                                                                                                                                                                                                                                                                          GAAGATCCGAAACATGAGGGGTGAACGAGGACGTGGCCGNGNNNNTTNNTCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGANCATGACCAGTGGCCATAATGTTGCAGACTTGGNTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNCAGCCATCAGGNACNCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTNATCCGGTTGTTGAAAGANTTGAGGAGNCGNTTCCTGGATTCGAANCTCTNACTCCCTGGATCCTNGACNNTNGGTCACTATGCAG
  5   1   2       chi Ga15      in                       XL456l16ex.5p                                                                                                                                                                                                                                                                           GACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGG
  5   1   2       bld Ga18 5g3  in                       xlk72a17ex.5p                                                                                                                                                                                                                                                                           ATCAGGAACATGAGGGGNGAACGAGGACGTGGACGTGGCCGCTTTNNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGNTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGNTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNNCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTNNTACAGAGCG
  5   1   2       bld Egg3 5g3  in                    IMAGE:3378576.5p                                                                                                                                                                                                                                                                            AGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTGTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTTCCCATCTACA
  5   1   2       bld Egg3 5x3  out                   IMAGE:3377761.5p                                                                                                                                                                                                                                                                            AGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACT
  5   1   2       bld DMZ  5g3  in                         xl296j23.5p                                                                                                                                                                                                                                                                             GGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTGCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGANGAGTCGGTTTCCTGGATTTGA
  5   1   2       bld Ga18 5g3  in                      xlk117k22ex.5p                                                                                                                                                                                                                                                                                GANCATGAGGGGNGAANNAGGNCGTGGACGTGGCCGCTTTNNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGNTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGNTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGANCAGNTCAGCAGACNNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGNTCTACAGAGCGCACTGGCAGCCATCANNNACGCACGGNNGNTTGAGGAGANCGCCTCCNATTCTACAGTGAANGTTTTAATTCGCTGTTGAAAGA
  5   1   2       bld Neu7 5g                              XL034i19.5p                                                                                                                                                                                                                                                                                  ATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGAC
  5   1   2       bld Tbd3                            IMAGE:3548517.5p                                                                                                                                                                                                                                                                                       GGGTGAACGAGGACTTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCATGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCTAGTGAAACCGGCCCCATATGATGGCACACTGACCGAGGAGCTGCTCATACGAAACCAATATCTGTCC
  5   1   2       chi Emb1                            IMAGE:6636188.5p                                                                                                                                                                                                                                                                                       ccacgcgtccgcccacgcgtccgcccacgcgtccgcccacgcgtccgcTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCCAGAATACACTTGGACATCAAAGTTCTACAGAGCGCACTGGGCAGCCATCAAGGACGCACGCTGGTTTGGAGGAGAATGGCCTCCCATTCTAACAGTGAAAGGTTTTATCCCGGTTGGTTGAAAAAATTTGAAGGAAGCCGGTTTTCCTGGAATTCAAACCCTCTAAACTCCCCGGGAACCCTGGAACCTCCTTGGGGCCCCTTTAGGCCGGGATTGAAAAAACCCAAACCGAGGGAGCCcctgggggacctttaatggggggctctaaaaaagcctggcccaaaaaaattttccggtgggggggggttttttccccccccGGGGGCTA
  5   1   2       chi Egg3      in                    IMAGE:3379319.5p                                                                                                                                                                                                                                                                                          GAGGGGTGAACGAGGACGTGGCCGCTTTGGCTCCATAATGGGACCTAACGCATGTTTCAGACCCTTCGTTCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCATATGATGGCACACTCAGTGAGGCGCTGATCATACTGAACCAATATCTGGCTCCTACAACAGCTGAGCACGCCTCCATTCTTTCTCTGACTACCACATTAACCATCGTCACTGACTCTATCATTGTGGCCCGTGCATCCTTGGAAGTGCATGTCGACTAGGTGCGACTTGTGGTCATCCACGATATATGGACGATGCTGGCTGGACATACTGCCGCTTACTTCGCCTTAATGCTCAAGATTCTCAGAACGGTGGACACA
  5   1   2       bld Ga18      in                      xlk137d02ex.5p                                                                                                                                                                                                                                                                                            TGAACGAGGNCGTGGACGTGGCCGCTTTGNTCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAANCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTNCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGNTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTNCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGNTCAGCAGACGNCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAANCTACGCAAGCTGGACCCAGAGTTGCATTTGGNCATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGNACNCACGGNGGTTTGAG
  5   1   2       bld Ga15                               XL435j09ex.5p                                                                                                                                                                                                                                                                                             CGAGGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAAC
  5   1   2       bld Ga18      in                       xlk75k13ex.5p                                                                                                                                                                                                                                                                                             GGTGAACGAGGNCGTGGCCGNNNNNTTTGNNCCAGAATGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGANNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGANCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNNACGCACGCTGGTTTGAGGAGAATGNCTCCCATTCTACAGTGAAGGTTTTAATCCNGGTTGTTGAAAGACTTGAGGAGNCGGTTTCCTGGATTCGAANCTCTAACTCCCTGGAT
  5   1   2       bld Egg5      out                   IMAGE:3430679.5p                                                                                                                                                                                                                                                                                              CGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCT
  5   1   2       bld Tbd3      in                    IMAGE:3550276.5p                                                                                                                                                                                                                                                                                              CGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGTGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACA
  5   1   2       bld Ga10      in                    IMAGE:3558110.5p                                                                                                                                                                                                                                                                                                   ACGTGGCCGTGGCCGCTTCGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTA
  5   1   2       bld Ooc1                   IMAGE:3745045-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                             CGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCCTGGACCTCTTGGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGGCACTTAATGTGGGCCTACAAACGCTGCCTACAGATTTCTCGCTGCCGGGCCTCTTCCTCCCTGGCTCAGTTGGCATTACAGACCCCTGTGAAAGTGGAAAT
  5   1   2       bld Egg3                            IMAGE:6869239.5p                                                                                                                                                                                                                                                                                                               CGATTCCCCGGGCAGAATGGGACCTATCGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACNTCCTGGATCCTTGACCCTCTGGGGCACTATGCAGTGATGAATAATCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAAGCGCTGCCTACAGATCCTCGCTGCTGGTCTTTTCTCCCTGGCTCAGTTGGCATTACAGACCCCTGTGGAAGTGGCAACTTCGGGGNTCATACTGGCATGACTCCTGGACAACAAGGACTTGGTTTGGTTACCCTGCCCCAGACGTTGGGTCCGAAATCTTCTCCCACCGGAAGGCTAAAAGAAGGGA
  5   1   2       chi Egg3                            IMAGE:6324815.5p                                                                                                                                                                                                                                                                                                                AAAACGGCCTGCCGTCGAAGCCCCACCCNNNCCGATTGGATCGATTCCCGGGCTCAATTCCCTTTCATACCAGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGACCGCTGGCCATAATGTTGCAGACTAGGATGTCATTACACAGATCCTCCCCACCCTGCACCACCTGAACGGATACGACTTCTATTGTCCACACACCATGCCGGCGCGGGACCCAGGAGAAATCCTTCTACTGCAATACCTCTGACACAATCTTCAATAACCACTcccccccccaggcccagacagcccccaccccaccccacacagctcacacgtcagccacccTCAAAGACCCTGACCGTTCTAATTAAACTCCTCCCCACCACACCAACGCCTCCTCTTACTCACTCCAACCACCTACAATAGATATCCACACACATCCAAGAGAGTCACATCCCTCTTGCACCCACCTCCCCCCTCTCTTCATTCTCCCAACACGGTGCGACAAATGACGCGTCCCGATCGACCGCACAGAGGACTCTTTACCACCCTAATACGTCTCAATAACACAACGCCCGCCGCCTTCGTGGCAAAATGATACCCGTCAACACTCACAGTAATCCCAACATAGCGAGCACTCTCACGCCACCCATCATCGTCCCCGCAATGCGACCACGTCTCCGCCACCCACGGGCTATAGCCCTGTATCACGCACACAACGACCGCACGACGTGAATAATACAACTCACACAACATCACTTCCACCGCCCTTACTGAGCCCTGCATTGACCGCCCAAGAAACGACCCGCACGATTCAACCATCTCCACTCTCCCCCGACCTAAACACAGTGTACTCACCTACTACAAAAGGTGACCCGGAATGCGGCACTAATGTCTCTCACATACTCCGCTTTCCTTCGCACACACGCGATCTATCACATGCTTCAAAGCACTCTCATACTGCCAGCAGGCCACAGACGCCACACaaaaaaaaaTAGCTTCGAGTGACACCCTCAATACAGAGTGGAGCTACACTCCTAAAANNNGGGCAGAGACGAAGAACGCTCACTATTACTACGCAATACGCAACCACCTCACGTAGACACTCCCGGCGCGTGACACACGCACACATCATACCTCCTATCTGCCGCCCCTCACTACTA
  5   1   2       chi Em10                            IMAGE:8319377.5p                                                                                                                                                                                                                                                                                                                CGAGCTGGTGTCCATTGTGCGGGAGTGCGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTGACCTCTTGGGGCACTATGCAGTGATGAATATCC
  5   1   2       bld Int2                            IMAGE:8527391.5p                                                                                                                                                                                                                                                                                                                   GAGACCATAGAATAAATGCGTCCCGCAGGGTNCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATA
  5   1   2       bld Egg6                            IMAGE:4436049.5p                                                                                                                                                                                                                                                                                                                     TGGCTCCAGAATGAGACCTAACGTAGGGTTCGGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCATACGAAACCAAGATCTGGCCCCTACAACAACTGAGCATGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCCACAGGCGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTATGGAAGACGTTTCTGCTTTGGGCAATAAGGTACTGTAGACCCTGAGGACACAGGAACCCACATAAGTTCTCACGATGCTGACAAATGAGACTGGCTATGAAATCATGTCCATAGACGTCACCATTAGGATCCTTATCACAACTGTACCACCCAATCTCCGCAAGCTGGACCCA
  5   1   2       bld Ga18      in                      xlk141f13ex.5p                                                                                                                                                                                                                                                                                                                          TCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGNGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCNNACTGGCAGCCATCAGNACGCACGCTGGTTTGAGGAGAATNNCTCCCATTCTACAGTGAAGGTTTNATCCGGTTGTTGAAAGANTTGAGGAGNCGGTTTCCTGGATTCGAACCTCTAACTNCCTGGNNC
  5   1   2       bld Ga18      ?                       xlk161n23ex.5p                                                                                                                                                                                                                                                                                                                           CCAGANNNNNCCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGGNNNTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGNTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGANCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNACGCACGCTGGTTTGAGGAGAATGCCTNCCATTCTACAGTGAAGGTTTTNATCNNGTTGTTGAAAGANTTGAGGAG
  5   1   2       bld Egg3                            IMAGE:6870454.5p                                                                                                                                                                                                                                                                                                                                GATTCCCGGGAACCAGGTTTCATACCCTTCGTCCCTCACATTCCCTTTGATTTCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTTGAGGAGTCGGGTTTCCCTGGAATTTAAACCTCCAAACTCCCCGGGGATCCTGGACCCCCTTGGggggcccctattggcgggggaagggaaaaaatcccaccccggggggggccccctgggggaccttcaattggggggccctaataaaaagggccgggccccaaaaaaaaaaccccccccccggggcgggggggctttttcccccccccccccgggggctacaaaggggggggatttaaaaaaaaacccccctttgttgaaaaaaaggggggcaaacctcctcctgggggggTGT
  5   1   2       bld Egg3                            IMAGE:6326357.5p                                                                                                                                                                                                                                                                                                                                   GTCGATTCCCGGGTTTCAGGGTCTTTCTGAGAGGCATTCCCTTTGATTTCCATGTCTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAAGCGCTGCCTACAGATCCTCGCTGCTGGTCTTTTCCTCCCTGGCTCAGTTGGCATTACAGACCCCCTGTGAAAGTGGCAACTTTCAGGGGTTCATACCTGTCATGGACTCTGGAAGCCAGCAGGAACATGGGTTTTGGTTACACCGT
  5   1   2       bld Gas8                            IMAGE:3516001.5p                                                                                                                                                                                                                                                                                                                                           GCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCAATCTACAGTGAAGGGTTTAAATCCGTTGGTGAAAGACTTGAGGAGTCGGGTTCCTGGATTCGAACCTATAACTCCCTGGATCCTGGACCTATTGGGTCACTATGCAGAGATGAACAAACCAACCAGGCAGCACCTGGCACTT
  5   1   2       bld Gas8                            IMAGE:3516097.5p                                                                                                                                                                                                                                                                                                                                           GCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTATGAAATCAGCTCAGCTGACGCCACCATTAAGATCCTTATCACATCTGTACCACCAAATCTCCGCATGCTGGACCCAGAATTACGCTTGGACATCTAAGTTCTACATAGCGCACTGGCAGCCATCAGGCACGCACGCTTGGTTGAGGGAAATGCCAGCCAATCTACAGTGAAGGTTATATTGCTGTTGTTGAGAGACTAGAGGATATGGGTTTCTGGTATAGCACCATTAACTCACATGATCATGTCACTCATGGGT
  5   1   2       chi Em10                            IMAGE:8321515.5p                                                                                                                                                                                                                                                                                                                                           CGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGT
  5   1   2       bld Emb4                            IMAGE:5516314.5p                                                                                                                                                                                                                                                                                                                                            CGCAGTTTAGACCCTTTGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCNGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGNGTCACTATGCAGTGATGAACAACCCACCAGGCAGCACTGGCACTTATGTGGCTACAACGCTGCTACAGATCTCGCTGCGGGCTCTTCTCCCTGCTCAGTGGCATAN
  5   1   2       bld Gas5      in                    IMAGE:3749402.5p                                                                                                                                                                                                                                                                                                                                              ACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCTGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTNTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCT
  5   1   2       bld Ooc1                             Ooc1-db29b11.y1                                                                                                                                                                                                                                                                                                                                                         gggtcgacccacgcgtccgcccacgcgtccggtGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTTCCATTCTACAGTGAAGGTTTTAATTCGGTTTGTGAAAGACTTG
  5   1   2       bld Neu2                            IMAGE:2942321.5p                                                                                                                                                                                                                                                                                                                                                           TCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGTTATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAAGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGAAAGCCATTTCTGCTTTGGGCATTAAAGTAGTTGAAACCATGAAGACACAANAACCAGCAGAAGTTCTTACAATGCTAACAAATAAGACTGACTGTAAGATCAGTTCAGCAGACACCACCATTAAAGTCCTCATCACAACTATACCACCAAACCTACACAAGCTAAACCCAGAATTACATGTNAACATCAAAGTTCTACAGAGCGCACTAACAGCCATCGAACACACACGAGAGTTTGAAGATAACTCCTGCCATTCTACAGTGAAAGTTGTAATTCGATTA
  5   1   2       bld Ooc1      in                     Ooc1-db27c02.y1                                                                                                                                                                                                                                                                                                                                                               gggtcgacccacgcgtccgcccacgcgtccggaAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAAGCACGCACGCTGGTTTGAGGAGAATGCCNCCATTCTACAGTGAAGGTTTTTATCCGGTTGTTGAAAGACTTGAAGGGTCGG
  5   1   2       bld Lmb1                            IMAGE:8533417.5p                                                                                                                                                                                                                                                                                                                                                                CCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAAATGCTCCCACTCTACAGTGAAAGTTTTAATCCGGTTGTTGAAGACTTGAGGAGTCGGTTTCCTGATTCAAACCCTAACTCCCTGGATCCTGGACCTCTTGGGTCCTATGCCATGATGAAAAACCCAACCGGGCCGCACTGGTACTTATGTGGCTAAAAACCTGCCTAAAAATTTGGTGCGGCCCCTCCTCCTGGTCATGGGAATAAAAC
  5   1   2       bld Ga18      in                      xlk108b16ex.5p                                                                                                                                                                                                                                                                                                                                                                    CACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAANCGGCCCCAGATGATGGCACACTGAGCGAGNNNNNCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGNNAGCCATCAGNNACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGNTTTAATCCGGTTGTTGAAAGANTTGAGGAGNCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGNCACTATGCAGTGATGAACAACCNAACCAGGNAGCCACTGGNACTTAATGTGGNCTACAAACGCTNNCTACAGATTCTCGCTGC
  5   1   2       bld Ga15      in                       XL471p20ex.5p                                                                                                                                                                                                                                                                                                                                                                     CATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAG
  5   1   2       bld DMZ       in                         xl236h04.5p                                                                                                                                                                                                                                                                                                                                                                                          CGATTCGAATTTCGGCACGAGGGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCG
  5   1   2       chi Lmb1                            IMAGE:8534482.5p                                                                                                                                                                                                                                                                                                                                                                                                  AAANNNNCCTGAATNNGNTAAGAAGTACTAATTAAATTCNTCCCGAGCGAGGCGCTGCTCAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCAGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCGCTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCCTGGGTCACTATGCAGTGAATAACAACCCAACCAGGCGACCACTGGCCTTTATGTGGGCTAAAACGCTGCTACAAATTTCGCTGCGGCCTCTTCTTCTGGCTCAGTTGGATTAAAAACCCGTGAAAGGGAAATTAAGGTCACCTGTCTGATCGGAGCACAGAATGTTGTTCACTCCCAACTTGTCCATTTTCCACGAAGTAAGAAATTGGGCTGGGAAACC
  5   1   2       bld DMZ       in                         xl252e03.5p                                                                                                                                                                                                                                                                                                                                                                                                  TGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGCTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAAGCGCTGCCT
  5   1   2       bld DMZ       in                         xl264l19.5p                                                                                                                                                                                                                                                                                                                                                                                                   GGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCACACTGGAAGCCGTTTCTGCTTTGGGCATTAAGGTAGTTGAGACCATGAGGACACAAGAACCAGCAGAAGTTCTTACAATGCTAACAAATGAGACTGGCTTTGAGATCAGTTCAGCAGACGCCACCATTAAGGTCCTCATCACAACTGTGCCGCCAAACCTACGCAAGCTGGACCCAGAGTTGCATTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGGTGGTTTGAGGAGAACGCCTCCCATTCTACAGTGAAGGTTTTAATTCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTTGAACCTCTAACTCCCTGGATCCTTGACCTCTTGGGGCACTATGCAGTGATGAATAATCCAACCAGGCAGCCACTGGCACTCAATGTGGCCTATAAGCGCTGCCTA
  5   1   2       bld DMZ       in                         xl296h23.5p                                                                                                                                                                                                                                                                                                                                                                                                     CCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGG
  5   1   2       bld DMZ       in                         xl300b21.5p                                                                                                                                                                                                                                                                                                                                                                                                         CCTCGTGCCGAATTCGGCACGAGGTGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGGCCTCTTCCTCCCTGG
  5   1   2       bld DMZ       in                         xl319n14.5p                                                                                                                                                                                                                                                                                                                                                                                                                GTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGGCCTCTT
  5   1   2       bld DMZ       in                         xl281o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                GAGAGACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGGCCTCTTCCTCCCTGGCTCAGTNGGCATTACNGACCCCTGTGAAAGT
  5   1   2       bld Emb1      in                    IMAGE:3402246.5p                                                                                                                                                                                                                                                                                                                                                                                                                    CACGCGTCCGAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTCGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAAGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTCTAATNCCGTTGTTGAAAGACTTGAGGCAGCGGTTTCCTGGATTCGAACCTCTAACTCACTGATCCTGG
  5   1   2       bld Egg3                            IMAGE:6326610.5p                                                                                                                                                                                                                                                                                                                                                                                                                    GTCGATTCCCCGGGTGATGGACACTTTCCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACGATGCTGACAAATGAGACTGGCTTTGAAATCAGCTCAGCAGACGCCACCATTAAGATCCTTATCACAACTGTACCACCAAATCTCCGCAAGCTGGACCCAGAATTACACTTGGACATCAAAGTTCTACAGAGCGCACTGGCAGCCATCAGGCACGCACGCTGGTTTGAGGAGAATGCCTCCCATTCTACAGTGAAGGTTTTAATCCGGTTGTTGAAAGACTTGAGGAGTCGGTTTCCTGGATTCGAACCTCTAACTCCCTGGATCCTGGACCTCTTGGGTCACTATGCAGTGATGAACAACCCAACCAGGCAGCCACTGGCACTTAATGTGGCCTACAAACGCTGCCTACAGATTCTCGCTGCCGGCCTCTTCCTCCCTGGCTCAGTTGGCATTACAGACCCCCTGTGAAAAGTGGAAATTTCAGGGGTTCACACTGGTCATGACCTCTGGAGCAAGCAAGACATGGGTTTGGTTACACTGGCCCAGAACGTTGGGTCCCGAATTCTTCTCCACACGGGAGGCCTACAGCGGAAGATTTTTTGGGGCCCTGGAAGGGAAGATGCCCAGTGGCTCCTTGCCCACCAGGAATTGTCCCCACCTGGT
  5   1   2       bld Ga15                               XL429b09ex.5p