Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7973876.3                     924 PI      93       1053     1265                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:6859211.5                     558 PI      91         35     1642                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8640967.5                      54 PI      90       1115     1264                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8640907.5                      32 PI      84       1069     1258                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012767100 Xl3.1-XL438p03ex.5 - 566 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL438p03ex.5                                                     CTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATAAAGTTCGCCTTGTCTTTTTTTGTTTAAAAAAA
                                                  Xl3.1-CHK-1012684980                                                           ACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATAAAGTTCGCCTTGTCTTTTTTTGTTTAxxxxAAAAAAAA
                                                      consensus depths                                                         79    96   119   162   129   180   133   185   138   190   142   191   144   192   148   195   147   195   148   197   149   205   202   206   174   207   206   208   206   208   206   210   208   214   211   216   198   218   210   220   218   222   214   222   215   225   215   225   214   226   217   227   216   227   217   226   217   226   219   226   221   227   220   226   219   226   215   225   219   225   219   226   215   226   215   227   212   228   219   231   218   233   212   232   186   233   197   233   208   234   205   229   205   229   158   226   169   224   199   227   187   226   188   224   187   223   178   222   155   214   154   210   167   210   161   204   101   177   106   164    87   145    66   123    65   113    63   109    62   105    61   101    59    97    60    94    56    93    58    91    53    83    51    77    52    75    50    72    47    69    49    67    46    66    49    68    49    65    47    64    48    63    46    64    46    69    48    71    45    70    45    72    44    73    38    79    38    87    37    86    40    90    40    90    37    90    41    91    40    91    37    93    49    93    46    94    49    98    61   107    59   115    65   118    62   125    60   140    64   148    74   152    75   154    78   161    78   172   102   197   106   208   125   218   133   221   135   226   142   228   178   229   182   234   170   241   186   245   189   246   186   246   186   248   165   250   190   249   197   249   205   249   206   251   206   252   204   250   201   249   205   251   208   250   203   253   211   251   213   249   215   247   214   247   213   246   214   246   213   245   212   244   219   248   216   248   217   246   219   250   221   250   223   250   220   249   218   249   217   247   220   250   218   251   221   252   221   251   217   249   215   248   212   248   213   249   206   249   205   249   207   249   204   248   174   249   179   249   175   247   174   246   176   246   168   244   158   239    82   216    44   129    32    71    28    41     6    18
                                                                   VAR                                                                             TGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAACTGGCCCTTGATATTGAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATT
                                                                   SNP                                                                 --G---------
                                                                   SNP                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C--C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------CT--
                                               BLH ATG      38    1056                                                     
                                               BLH OVR      38      82                                                     
                                               EST CLI      -7      62                                                     
                                               ORF LNG      38      10                                                     
  5   1   2       chi Neu4      in                    IMAGE:3557348.5p TTTTGGTGTTCAACCGCCTTACAAAACCGTCAACCGGGGGGTGACAAAAACCCCACNTGTTCTCATCTTGCCACTCACAGTCTTCACTCATGTCCGTCAGAATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCTCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTTGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAG
  5   1   2       bld Int2 5g3  in                    IMAGE:8820564.5p     CGGTCTTACTCAGGGTAGGGCTGATTATTCAAATTCGTCCCGTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGATGATGTGGATGAGCATATATGAACAAAGTACAGCTAGAGCGCGCTTGGAGGCCCTGACCGATGAGATTACTTCTTGCGTCAGCTGTATGAGAGGAGTTGCGCGAAATGCATCCAGATTTCTGACCCTTCCGTTGTCCTGTCTATGACAACAACGCAGCCTTGACCTGAACGCATCATGCAGAGTCAGAGCTCAGTATGAAGACGTGCACAAGAGTCGTTTAGAATGGAAAACTGTTATTCAAGTTAGTACCCAGA
  5   1   2       bld Int2 5g                         IMAGE:8824638.5p           GCCCCCCCTGAGTACCATAGGGACGCTATGATACGAATTCGTCCCCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAGAGGAGTTGCGCGAAATGCATCCAGATTTCTGACACTTCCGTTGTCCTGTTCTATGGACAACAACCGCAGCCCTTGACCTTGGACGGCCATTCAATGGCAG
  5   1   2       bld Emb4 5g                         IMAGE:4957532.5p                    GACGCGTGGGTCGTCCCACGCGTCCGGTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGGCAGCTTGACGGGCTGGGACAGGACAAGATGCGC
  5   1   2       bld Emb4 5g                         IMAGE:4681607.5p                    GGACGCGTGGGTCGCCCACGCGTCCGGTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAAGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAAGAGGAGTTGCGCCGAAATGCGATCCCAAGATTTCTGACACTTCCCGTTGGTCCTGGCCAATGGAACAACAACCGCCAGCCCTTGGACCTGG
  5   1   2       bld Emb4 5g                         IMAGE:5571596.5p                      CCACGCGTCCGCCCACGCGTCCGTGTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGGCCTGGTGGAGGGACTTCCAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCCGCTAAAGAAGGATGGGGATGAGGCATATATGAACCAAGTACAGTTAGAGGCGCGCCTGGGAGGCCCCTGACCCGATGAGATTAACTTCTTGGCGTCAGCTGTATGAAAAAGGAGTTTGCCCGGAAATGCCAATCCCAAATTTTCTGACCCCTTCCGTTGGCCCCGCGCCAATGGACCAACAACCGCCGGC
  5   1   2       bld Lu1                             IMAGE:4057512.5p                       AACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACACTACCGCACCAGCGAGCGCTGCCCCCCGCTCCGGCGGGCTTCAGCATGCTTCTCGTACAGCAGGCGCCCCCATGGNCGAGTNAGAAGCCAGCTCCGCTATCTTTCAGACCTGGGGTCCAGCTATGNGAGGAGNCCTCCAGGTTCNGGGAGCCGGCATACAGGAAAGCGGTTTTGGGGGGCGCCAGGTGTGGGAATCTGCGGGGAATCACAATCGGGTCAGCGTCAACCCAGAGCTCTCCTGGCACCGCCTCAACTCTGGAGATCGACCGCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTGCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCATGCACCTGCGCCTGCAGCTAGACTGCCTGTGACACGACAAGATGAGCGTGGAATCTGGGCTGGGAAATATGCAGGGCCTGTTGGAGGAT
  5   1   2       bld DMZ  5g3  in                         xl329k01.5p                          ATTCGAATTCGGGCACGAAGGCAACTTTCTCACGNTAGTCTCATCTGCCACTCACAGCTCCACCATGNTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTG
  5   1   2       bld Emb9 5g                         IMAGE:7974881.5p                            TCGGTCCGGATTCCCGGGGATAGCACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGTAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTTCCTGCAGAACCAGAAGACCACATGCAGCAACATGGACGGTATGATTGAAGCCTACATTAGCTACCTGTGCCGCCAGCTTGATTGCCTGGGATAGGTAAAGATGCGCTTGGAAGCTGATCTGGGAAATATGCTAGGCCGGGTGGATGACTTCTAGAATAATATGTTAGAAGATATTACCAGACCCTCATAGAAAAGAATGAATCTTCTTGCTAACGATGGAGGTGGATGAGGTTATATGAAATATCTCAGTTAAAGTCCGTG
  5   1   2       bld DMZ  5g3  in                         xl278l03.5p                             ATTCGAATTCGGGCACGAGGGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTG
  5   1   2       bld Emb3 5g                         IMAGE:3399300.5p                              CACGCGTCCGCCCACGCGTCCGACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTATGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCCAGGGCCTGGTGGACGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4058087.5p                               CACGCGTCCGCCCACGCGTCCGCTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGGATAAGACTCTCAACAACAAGTTCGCCTCTTTTATT
  5   1   2       bld Te2  5g3  in                    IMAGE:7207862.5p                                 GGTTCCCGGAATTTCCCCGGGATCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGGATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACGATGAGATAACTTTCTGCGCAGCTGTATGAAGAGGAGTGCGCGAATGNCATCCAGAATTCTGACACTTNCGTTTGTCTGTCTATGGACAACACCGCAGCCTTGACCCTGACGCATCATTGCGAAGTCAAAGNTCAGTATGAGACGTTGCCCACAGAAGCGTTATAAGTGGGAAAAATGTTCAGTTAAGTACAGAACGGCAAATAACACGGTGTCCTTGGGGTACGGGAA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959216.5p                                      CCCACGCGTCCGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGTCAGGACAAGATGCGCTTGGAA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7974902.5p                                       GTCCGGATTCCCGGGATCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGGAATTTACTGACGCACAGAGCTAGAGATGAATTTGTCTGCTGAAAAGGATGTGGATGAGCAATATGAACAAGTACATCTAAGGCCGCTTGGAGGCCTGACGATGAATTAATTCTGCTCACTTGATAA
  5   1   2       bld DMZ  5g3  in                         xl305k24.5p                                       CCATCGATTCGCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld Tbd7 5g3  in                         XL080o09.5p                                         GCACGAGGCAACTTCTCACGTAGTACGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACA
  5   1   2       bld Lu1  5g                IMAGE:4632885-IMAGp.IMAGp                                             TGTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAAC
  5   1   2       bld Emb9 5g                         IMAGE:7978283.5p                                              GTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGGAGGAGTTGCGCGAAATGCAATCCCAGGATTTTCTGAC
  5   1   2       bld Emb9 5g                         IMAGE:7977739.5p                                              GTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGGATGAGGCATATATGAATCAAAGTACAGCTAGAGGGCGCGCTTGGAAGGCCT
  5   1   2       bld Emb9 5g                         IMAGE:7976637.5p                                              GTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGATATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGATATTAACAGACGCACAGAGCTAGAGAATGAATTGTTCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACTAAGTACAGCTAGAGGCGCGCTTGGAGGTCCTG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976220.5p                                              GTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGAACTTCAGAAAAATATGAAGATGAAATAACAGACGCACAGAGCTAGAGATGAATTTGTCTGCTGAAGAGGATGGGATGAGCATATTGAACAATACAGCTAGAGGCGCGCTGGAGCCTGACGAGAAATAACTCTGCGTACTGTAGAAAGAGTGCCGATGCATCCAATTCAACCTCGTGCTGTCTGAAAAACGACCTGACGACGCCTTGCAGTAATCTTGAATTCAAAACCTA
  5   1   2       bld Emb9 5g                         IMAGE:7974454.5p                                              GTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAAGACTTCTAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCCTAGAGAATGATGTGTCCTGCTAAAGAGGAGGTGGAGAAGGCTATATGAAAAAATACAACTAGAGGGTCCTTGGAGGCCCTGACCGAGAAATAACTCCTGCGTCACTGATGAAAGGATTCGGCAAAGGCACCCGATTTTGACC
  5   1   2       bld FaB  5g                         IMAGE:8073466.5p                                              GTAGCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAAACAAGTACAGCTAGAAGCGCGCTTGGAGGCCCTGACCGATGAGAATAACTTCTTGCGTCAGCTGTATGAAGAAGAGTTGCGCGAAATG
  5   1   2       bld DMZ  5g3  in                         xl334b05.5p                                              GTAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCT
  5   1   2       bld DMZ  5g3  in                         xl331l07.5p                                              AGCAACTTCTCACGGTAGTTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCT
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200731.5p                                               TAGCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCATGGCCTGGTGGAGGACTTCAAGATAAATATGAAGATGAAATAACAGACGCACAGAGCTAGAGAATGAAATTG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4632885.5p                                               TAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCNCAACAACAAGTTCGCCTTTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAG
  5   1   2       bld Te2  5g                         IMAGE:7393990.5p                                               TAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAANGAAGGATGTGGATGAGGCATATATGAAACAAGTACAGCTAGAGGCGCGCTGGNAGGCCCNTGACGATGAGATAACTTTCTGCGTCAGCTGTATGAAGAGGAGTGCGCNGAATG
  5   1   2       bld Int2 5g                         IMAGE:8530872.5p                                               TAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCC
  5   1   2       bld DMZ       in                         xl322f04.5p                                               ATCGATTCGCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGG
  5   1   2       bld DMZ  5g3  in                         xl319h09.5p                                               TAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTT
  5   1   2       bld DMZ  5g3  in                         xl320h09.5p                                               GAGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGNCCGTCANATCGNCCAAAGTCACCTACCGCACCAGCAGCGNTGCCCCCCGCTCCGGCGGCTTCANCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCANCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCNGGAGCGGCTACAGNAGCGGTTTTGGGGGCGCAGGTGTGGNATCTGCGGGAATCACATCGGTCAGCGTCNACCAGAGCCTCCTGGCACCCCTCAANCTGGAGATCGACCCTTCCATCCANCAAGTCAGGACCGAGGATAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAG
  5   1   2       bld DMZ       in                         xl330d08.5p                                               ATCGATTCGCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGA
  5   1   2       bld Tbd3 5g                         IMAGE:3548761.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAAAGCCTCCTGACACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCATGACCGAGGAGAAGGAGCAGATCATGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGAAGCATCAGAACAAGATGCTATAGACCATGAGGAGGCTG
  5   1   2       bld Neu4 5g                         IMAGE:4085465.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCA
  5   1   2       bld Neu4 5g                         IMAGE:4085350.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGACGAGAAAGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAAGTGCCGTTT
  5   1   2       chi Emb4                            IMAGE:5570265.5p                                                AGCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACCGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGAATGCGCTTGGAATCTGAGCTGGCAAATATGCAGGGCCCTGGTGGAGGACTTCCGGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAACAAGCATGTGCGTGCCGGCATATACTAAaccccgtaccccccacaggcgccccttggagggccccgccccAACGAAACTTACTTTTCCTGCCCCCACTTTGCACGACACAGGAGCTCCCCCCCAACTACCACCCCCTAAATCACCGACCGTTCCACGCCGTCCCTGCACGAAGGGCACAAAAGGCCCGGTTACCCCC
  5   1   2       bld Ga15 5g3  in                       XL454l17ex.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAG
  5   1   2       bld Ga15 5g3  in                       XL472g13ex.5p                                                AGCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAG
  5   1   2       bld Ov1  5g                         IMAGE:8329482.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAACAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAAGATGTGGATGAGGCATATATGAACAAGGTACAGCTA
  5   1   2       bld DMZ  5g3  in                         xl282i14.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGG
  5   1   2       bld DMZ  5g3  in                         xl279p21.5p                                                AGCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld DMZ  5g3  in                         xl337l23.5p                                                GCAACTTCTCACGTAGTTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCT
  5   1   2       bld Tbd2 5g                         IMAGE:3199706.5p                                                 GCAACTTCTCACGTAGTCGCATCTGCCACTCACAGTTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGTGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTGTACTGCTGAAGAAGATGTGGATGAGGCATATATGAACAAAGTACAGCT
  5   1   2       bld Neu4 5g                         IMAGE:4085605.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGNGACAGGACAAGATGCGCTTGGAA
  5   1   2       bld Emb4 5g                         IMAGE:5572035.5p                                                 TCACCTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGAAGGCCCTGGGACAGGACAAGAATGCGCTTGGAATCTGAGCCTGGGAAATATGGCAGGGCCCGGTGGGAGGACTTCCCTAATCAAATATTGAAGATGAAAATTAACGGACGCCAAGAAGCTAAGAAAATGAAATTTGGCCCTGGCTGAAAAAAGGAAGTGGGATTGAGGCATTATCTGGACGCCACGTGATCGGTTTGGGAGGCGGTGCTTTGGAAGGCCCCCGTGACCCCGACCGGAAAATTACCTTCCTGGGCGGCCCGCCCTGCCACGAAAAGACGGAATCAGGTTCGCAAACTGCAAATTACCCCACCTTTCTTGACACATCTCCAGTGGGGGGCGGAGCTCATGCCACAAACCCAACTCCCAGGTNTTTCAACGGAGGGACGCGGCCATGAGTGAGGGAATATCNTAGCCGCTTCCGCCTCACAGGACAATTCTCTATACTCATCACGACCCCCTGTATAGAACGCCCCAA
  5   1   2       bld Ga15 5g3  in                       XL512k22ex.5p                                                 CAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGNTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGANATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATG
  5   1   2       bld Emb9 5g                         IMAGE:7977688.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCTTACATTGTCAACCTGCGCCGCCATCTTGACT
  5   1   2       bld Emb9 5g                         IMAGE:7977033.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACT
  5   1   2       bld Emb9 5g                         IMAGE:7976353.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATTTGACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCTGACCGATAAGATTACTTCTTGCGTAACTGTATAAAGAGAATTGCGCGAATGCAT
  5   1   2       bld Emb9 5g                         IMAGE:7977872.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGTTATCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGGAATCTGAGCTGGGAAAATTGCAGGGCCTGGTGGAGGATTTCAAGAATAAATATGAAGATGAAATTAACAGACGCAGGAGCTAGAGAATTAATTTGTCCTTGCCTGAATAAGATGTGGATGAGGCATATATGAATAATCTACAGCTAGAGGCGCGCTTTGAAGGCCCTGACCGTATGAAATTAACTTTCTGGCCTCATCTGTTTTAAACATGAGTTTTCATCAATT
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975881.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7974967.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGATTTTGTCCTGCTAAAGAAAGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAAGCCCTGACCGATGAGATAACTTCTTGCGTCAGCTG
  5   1   2       bld FaB  5g3  in                    IMAGE:8070235.5p                                                 GCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAAACAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATA
  5   1   2       bld Int2 5g                         IMAGE:8526498.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCTGCTGAAGAGGATGTGGATGNGCATTATGAACAAGTACACTAGAGCGCGCTTGAGGCCTGACGATGAATTACTTCTGCGTCACTGTAGAAAGAGTGCGCGATGCATCCAATTCTGAACTTCGTGCCGTTTGGCACACGCACTTGACGAGCTCTGCGAGTCAATCATANATTGCAAACCTTAAGGAAATTTCATAT
  5   1   2       bld DMZ       in                         xl236j05.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGC
  5   1   2       bld DMZ  5g3  in                         xl229b13.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGANGNCC
  5   1   2       bld DMZ  5g3  in                         xl231p19.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCT
  5   1   2       bld DMZ  5g3  in                         xl325c01.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAG
  5   1   2       bld DMZ  5g                              xl316f21.5p                                                 CAACTTCTCACGTAGTCTCATCTGCCACTTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGC
  5   1   2       bld DMZ  5g3  in                         xl260b17.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCG
  5   1   2       bld DMZ  5g3  in                         xl261l24.5p                                                 CAACTTCTCACGGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTG
  5   1   2       bld DMZ  5g3  in                         xl250j13.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAG
  5   1   2       bld DMZ  5g3  in                         xl240l16.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGC
  5   1   2       bld DMZ  5x3  out                        xl326p03.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCANAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAG
  5   1   2       bld DMZ  5g3  in                         xl336l23.5p                                                 GCAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGC
  5   1   2       bld DMZ  5g3  in                         xl338h16.5p                                                 GCAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGC
  5   1   2       bld Tbd1 5g                              AW765169.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGCCTGGTGGAGGACTTCCAGAATAAATATGAAGATGA
  5   1   2       bld Emb4 5g                         IMAGE:4203788.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTG
  5   1   2       bld Ga15 5g3  in                       XL460k17ex.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTAT
  5   1   2      seed Ga15 5g3  in                       XL482m19ex.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGA
  5   1   2       bld Ga15 5g3  in                       XL498i03ex.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGT
  5   1   2       bld Ga15 5g3  in                       XL418i04ex.5p                                                  CAACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976746.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGGAGCCCTGACCGATGAGATTAACTTCTTGC
  5   1   2       bld Emb9 5g                         IMAGE:7977593.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCCCTCTTAGCTCCACCATGTCCGTCAGATCAACCAAAGTCACCTATCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCAGGAATCACATCGGTTAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCATCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCACCTCTTTCATTGACAAGGTGCGTTTCCTGAAG
  5   1   2       bld DMZ  5g3  in                         xl230e19.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTT
  5   1   2       bld DMZ  5g3  in                         xl260b16.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTG
  5   1   2       bld DMZ  5g                              xl262d02.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGA
  5   1   2       bld DMZ  5g                              xl225h21.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld DMZ  5g3  in                         xl234a23.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGC
  5   1   2       bld DMZ  5g3  in                         xl258n23.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGA
  5   1   2       bld DMZ  5x3  out                        xl226c12.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCT
  5   1   2       bld DMZ  5g3  in                         xl241h02.5p                                                  CAACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCT
  5   1   2       bld Emb3 5g3  in                    IMAGE:3398674.5p                                                   AACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAATATGAAGATGAGATAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATTGTGATGAAGCATATATGGAACAAGTACAGCT
  5   1   2       bld Emb3 5g3  in                    IMAGE:3400577.5p                                                   AACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGGGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAATGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTGCTGCAGAACCAGAAGACCACACGCAGCAGCATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGGCAGCTAGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAGATGTGCATGGCCTGCTGGAGGACTTGAAGAATAAATTGGATGATGAGATATCCAGACGCGAGAGCTGAAGCGAGGGATATGTCCTGATG
  5   1   2       bld Kid  5g                         IMAGE:4032398.5p                                                   AACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAAGAATGAATTTTGGCCTGCTGAAAAAAGGAATGTGGATGAAGGCATATATGAAACAAAAGTGACAGCTAAAAGGCGCGCCTTGGAGGGCCTTGAACCGAATGAGATTAAACTTCCTGGCGTCCACCTGTTTGAAAAAGGGAATTGCCGCGAAAATGGCAATTCCCAGAATTTTCTGAAACCTTTCCGGTTGGTCCCTGGTCTAATGGGAACAACAAACCGGGCAGCCCTTTGAACCTTGGGAAACGGGCATTCATTTTGCCAAAAGGGGTTCCGNGACCTTCCCN
  5   1   2       bld Thy  5g                         IMAGE:8547400.5p                                                   AACTTCTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGATATATGAACAAGACAGCTAGAGGCGCGCTGGAGGCCTGACGATGAGATACTTCTGCTCACTGTATGAGAGAGTGCGCGAATGCATCCAGATTCGACCT
  5   1   2       bld Tbd4 5g                         IMAGE:4059281.5p                                                    ACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCGCCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTGCTGGCACCCCTCAACCTGTAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTGTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGTGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAGTGAATATGTCCTGCTGAAGAACGATGTGGATGAGGCATATGTGAACAAAGTACAGATAGATGCGCGCTTGGAGGCC
  5   1   2       bld Emb4 5g                         IMAGE:5537405.5p                                                    ACTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAGCTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCCATCCCAGAATTCGGACACTTCCGGTGTCCTGTCTATGGACAACAACCGCCAGCTTGGACTGGACGGCATCATTGCAGAGGGCAGAGCTTCAGTATGAAGACGTGGCCAACAGAAAGCCCGTTTTAGAACGGGGGAAAACCGGGTATCCAGGGTAAAGTACCCACGAAACTGCCGG
  5   1   2       bld Emb4 5g                IMAGE:4683896-IMAGp.IMAGp                                                     CTTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCA
  5   1   2       bld Ga18      in                      xlk159j08ex.5p                                                     AGCAACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGNNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNGCNNTTGGAGGCCCTGANCGATGAGATTAACTTCTTGCGNNNNNNTATGAAGAGGAGTTNCGCGAAATGCAATCCCAGATTTCTGACACTTCCGNTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGANGGCATCATTNCAGAGGTCAGAGCTCAGTATGAAGACG
  5   1   2       bld Ga18      in                      xlk130f16ex.5p                                                     TAGCAACTTCTCACNNNNNNCATCTNNCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCGNNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGNTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGNNCTGGGACAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNGNCTGGTGGANGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGNTGANGCATATATGAACAAAGNACAGCTAGAGGCNNNNTTGGAGGCCCTGACCGATGAGATTAACT
  5   1   2       bld Ga18      in                       xlk72f04ex.5p                                                     ANCAACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCNACCTGCGCCNNCAGCTTGACGGCCTGGGACANGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGNGGAGGACTTTAAGAATAAATATGAAGATGAAANTTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGNGGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNGNNCTTTGGNGGCCCTGACCGANGAGNNTAACTTCNT
  5   1   2       bld Ga18 5g3  in                      xlk154m14ex.5p                                                     CAACTTCTCACGTAGNCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGNNTNNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGNTTGACGGCCTGGGANAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGGGNCTGGTGGAGGNCTTCAAGAATAAATATGAAGATGAAATTAACAGANGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGG
  5   1   2       bld Ga18      in                      xlk156f14ex.5p                                                     AGCAANTTCTCACNNNNNNCATCTGCCACTCACAGCTCCACCATGNNNNTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCNACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAANTTGTCCTGCTGAAGAAGGANGTGGATGAGGNATATATGAACNAAGTACAGCTAGAGGNGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGNNNNNNTATGANGAG
  5   1   2       chi Emb3      in                    IMAGE:3399529.5p                                                      CACGCGTCCGGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATGCTCGGGAATGACATCGGGCAcgaggggggcgagggggctgacacggggggaggtggggagcgagggTGGCGTGGAAGACATGAGGACG
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3548581.5p                                                      TTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAG
  5   1   2       chi Emb4                            IMAGE:4683896.5p                                                      TTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGACCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGCTTTGGGGGCGCACGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGTCTCCTGCGACCCCTCAACCTGGAGATCGACCCCTCCATCCACCAACGTCAGGAGCGAGGGAGAAGGAGCACATCCAGACTCTGAACAACAAGCTCGCCTATTTCCTTGACAAGGGTGCAGTTTCCTGGAGCCAGCACAACAAAATGCTCGAAACCCAGTGGGAATCTCCTGGGGCACCCACGAAGACCCACACGCCAACCCACCTGCGACGGCCACTGTCTGAAAGACTACCATCAAGCAACCCGTGCGCCGGCCATGCTTTGACTGGGCCTCGGCGCACCCGGTACAACGAATGGCGCGGTTGGCGCAACCCCCGGAGGACTGGCGCAAAAATAATTGGCAAGGGCGCGCCCTCGAGTGGGGAGAGGCGGATTTCTCCACCCAAATACGAACATTAATCGCTCAACACACACTTGGAAATCTTCCCAGACAGCGGGGACGCCCGCCGTGTTCGGCCAATAGTCGTAACCGCAACGAACAAAACGCTCCATACGCTGTCTGGGTGCCCCCGCCCGCGGCCGTCGTCAAGCCCGCCCGAAGAGAGCGCGGTCGCTGGTTGTTAGCGCACAACTCGAGACAAGTGGCCCCCCAGCGCCCCTGTCACCGCTCTGCAGAAACGCGCACAACGAGGGAGACTAAAAGCTTTNTCTCCACAGACAATCGCATGTGTCGTCGGCCCCTCTGTCTCGGCGAAAAAAGAGGCCCGCCCCCACTCGCGCCCACCACCTCATACGCGTGGCACGACGACATTACACACAGGACTTTNTTCCCGCCACGGGCGTGTAGGACCGTCATCGGCCCCCTCGAGCCCACGCGTCTAAGACCTATATAGGAGGGCAGAGCTGTGAGGTGCCGTGCGAGCGCAACAAAGCCGTTACGTCCATACTCACACCCCGCGCATTAAGGTCGCCTTCTGCACAAGACAATCTTATCCGCCCCCCGCNCATCCCGTTACCTTCGGTACGTATTAACGGGGCGCCACACATTGACAGGAGCCGNTCATAGCACACCTCCTGCAGACACGCCGGCGCGCAGGGGCTTTACCTCCACACTGCGGG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975017.5p                                                      TTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGNAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACGATGAGATTAATTCTTGCGTCAGCTTATGAA
  5   1   2       bld Emb9 5g                         IMAGE:7974557.5p                                                      TTCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTTAGAATAAATATGAAGATGAAATTAACAGAAGTCCAGAGCTAGAGAATGAATTTGTCTGCTGAAGAAGATGTGGATGAGGCATATATGAACAAAGTACAGCTAAAGGCG
  5   1   2       bld Ga18      in                       xlk52d22ex.5p                                                      ANCAACTTCTCACGTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCNGNNNNCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGNNNNNACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGANCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNNCTGGTGGAGGANTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGNNGTGGANGAGGCATATATGAACNAAGTACAGCTAGAGGCGNNNTTGGAGGCCCTGACCGATGAGANTNACTTCNTGCGTNNG
  5   1   2       bld Ga18      in                      xlk162f01ex.5p                                                      CAACTTCTCACGTAGNCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNNCTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGANGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCNNNNTTGGAGGCCCTGACCGATGAGATTAACT
  5   1   2       bld Ga18      in                      xlk136f01ex.5p                                                      AGCAACTTCTCACGTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGCNNTTNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGANCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGNTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGNNCTGGGACAGGACAAGANNNGCTTGGAATCTGAGCTGGGAAANATGCAGGGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAANTAACAGACGCACAGAGCTAGAGAATGAATTTNTCCTGCTGAAGAAGG
  5   1   2       bld Ga18      in                      xlk121n17ex.5p                                                      AGCAACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNGNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAACCTGCGCCNNCAGCTTGACGGNCTGGGACAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAG
  5   1   2       bld Tbd1 5g                              AW871721.5p                                                       TCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGTGACANGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGC
  5   1   2       bld Emb4 5g                         IMAGE:5514057.5p                                                       CTCACGTAGTCTCACTCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTGGGNAGGGCCTGACGATGAGATTACTTTCTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAAATGCATCCAGAATTCTGACACTTCCGTGTCTGN
  5   1   2       chi Emb9 5x                         IMAGE:7975473.5p                                                       TCTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCATGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCTACCCTTCCATCCAGCAAGTCATGACCGAGGAGAATGAGCAGATCAAGACTCTCAATAACTAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGTAGTATCATATCAAGATGCTGGAAACTAAGTGGAATCTCCTGCATAACCAGAAGACCACTCGCTAGCATCATGGACGGCTAGTTTGAAGCCTACATCATCTTCTTGCGCCGCTAGCTTGATCGTCTTAGACAGGATCAATATGCGCTTGGAATTTGAGCTGGGAAATAGCATGGCCTGTTGGAGGACTTTAGATTAATTTGATTTGAATTTATCTTAGCTCGTATCAGAGCTATAATTTCCTTTGCTAAGAGGATGTGGATGAGGTAATTTTACTAAAGTAATCTTGATAGCTCCTATGAGGTCATACCTAGAAATTACTCTGCTTTTA
  5   1   2       bld Ga18      in                      xlk109j22ex.5p                                                       AACTTCTCACGTAGNCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGAANCTGAGCTGGGAAANATGCANNNNNTGGTGGAGGANTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGNGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGANGAGGCATATATGAACAAAGTACAGCTAGAGGCNNGCTTGGAGGCCCTGACCGATGANAT
  5   1   2       bld Ga18      in                       xlk51m07ex.5p                                                       AACTTCTCACGTAGNCGCATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNNNNNTTGGAGGCCCTGACCGATGAGATNA
  5   1   2       bld DMZ  5g3  in                         xl259d16.5p                                                       CTCACGTAGTCGCATCTGCCACTCACAGCTTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAG
  5   1   2       bld DMZ  5g3  in                         xl226b18.5p                                                       CTCACGTAGTTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld Neu1 5g3  in                      Neu1-27H3-1.5p                                                        CTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGTACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTAATCCTGGAGATCGACCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCT
  5   1   2       bld Emb9 5g                         IMAGE:7977118.5p                                                        CTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGA
  5   1   2       bld Emb9      in                    IMAGE:7974978.5p                                                        CTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTACTTCTTGCGTCGCTGTATGAAGAGGAGTT
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976529.5p                                                        CTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATAACTTCTTGCGTCAC
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975078.5p                                                        CTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGAACGATGAGATTAACTCTTGCGTCACCTGTATGAAGAAGAGTTGCGCGA
  5   1   2       bld Int2 5g                         IMAGE:8530414.5p                                                        CTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTACTTTCTGC
  5   1   2       bld Ga18      in                        xlk7l07ex.5p                                                        AACTTCTCACNTNNCNCATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCGGNNCNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGANGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGANGTGGANGAGGCATATATGAACAAAGNACAGCTAGAGGCNNNCTTGGAGGCCCTGACCGATGAGATTAACTTCNTGCG
  5   1   2       bld Ga18      in                      xlk151o10ex.5p                                                        AACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGNCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGNNNCTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGNNGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNNNNCTTGGNGGCCCTGACCGATGAGATTAACT
  5   1   2       bld Ga18      in                      xlk149k24ex.5p                                                        AACTTCTCACNTNTNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCNCNCTTGGAGGCCCTGANCGATGAGATTAACTTCTTGCGNNNNNNTATGAAGAGGAGNTGCGCGAAATGCAATCCCAGATTTCTGACACTTNCGTTGTCCTGTCTATNGACAACAACCGCAGCCTTGACCTGGACNGCATCATTGCAGAGGTCAGAGCTCAGTATGA
  5   1   2       bld Ga18      in                      xlk164c02ex.5p                                                        AACTTCTCACGTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNCNNCCCCCCGCTCCGGCGCTTCNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGNCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGNGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCNCTTTGGAGGCCCTGACCGATGAGANTAACTTCTTGCNNNNGNGTNTGAAGAGNGTTGCGCGAAANNNANTCCCAGATTTNCGA
  5   1   2       bld Ga18      in                      xlk155f01ex.5p                                                        AACTTCTCACNNNTNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGNNATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGNCCTGACCGATGAGATTAACTTCTNGCNNNNNNGTATGAAGAGGAGTTGCGCGAAATGNAATCCCAGATTTCCGACACTTCCNNTGTCCTGTCTNTGGACAACAACCGCAGCCTTGACCTGNACGGCATCATTNCAGANGTCAGAGCTCAGTATGAAGACGNTGCCAACAAGAGCCGTTTAGAAGNGGAAANNATGTNTCAAGNTAAGNNCCNAGANNTGCAGACATCAGCTGGTC
  5   1   2       bld DMZ  5g3  in                         xl282f24.5p                                                        CTCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCANGGCCTGGTGGAGGACTTCAANAATANATATGANNATGAAATTAANANANNCA
  5   1   2       bld DMZ  5g3  in                         xl277e07.5p                                                        CTCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200134.5p                                                         TCACGTAGTCGCATCTGCCACTCACAGCTTTCCCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTNTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCACGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATNTGGAACAA
  5   1   2       bld Emb4 5g                         IMAGE:4683598.5p                                                         TCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGGAGGGCCTGGACCGATGAGAATAACCTTCCTTGCGTCAACCTGTATGGAAGAAGGAGTTGCCGCCGAAATGGCAATCCCCAGAATTTCTGGAACACCTTCCCGNTGGTCCTTGGTCCAATGGGACAAACAAACCGGCAGGCCTCTTGAACCTGGGGAACGGCCATTCCATTGTGCCAGAAGGGGTTCAAAAGGCTCTCCCC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203105.5p                                                         TCACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTNATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGGACACTTTCCGTTGTCCTGTCTATGGANCAACAACCGCAGCCTTGGACTTGGACGGCATTCATTTGCCGAG
  5   1   2       bld Emb9 5g                         IMAGE:7974304.5p                                                         CCACGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATAACTTCTTGCGTCAGCTGATAAGAGGAGTTCGCGAAATGCATCCAGATTCCGACACTCGTTGTCTGTCATGG
  5   1   2       bld Ga18      in                      xlk133i11ex.5p                                                         AACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGNCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGNGCGNTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAANCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGANAGGNNAAGATGCNCTTGGNATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGNNTTCAAGAATAAATATGAAGATGAAATTAACAGANGCACAGAGCTAGAGNATGAATTTGTCCTGCTAAAGAAGGATGT
  5   1   2       bld Ga18      in                      xlk129m06ex.5p                                                         AACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGNGGAGGANTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGNGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCGCNNTTGGAGGCCCTGACCGATGAGATT
  5   1   2       bld Ga18      in                      xlk131c09ex.5p                                                         AACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCCGGNNCTTCNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTNTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGNNNTTGGAGGCCCTGNNCGATGAGAT
  5   1   2       bld Ga18      in                       xlk73j17ex.5p                                                         AACTTCTCACGNNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGGNNCTGGNGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGNNGNGGATGAGGCATATATGAACAAAGTACAGCTAGAGNNNNNNTTNNNGGCCCTGACCNATGAGATTAACTTCNT
  5   1   2       bld Ga18      ?                        xlk58g05ex.5p                                                         AACTTCTCACNTNNNTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGNCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGANGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGNGGAGGNCTTCAAGAATAAATATGAAGATGAAATNNACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGNNGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCNTTGGAGGCCCTGACCGATGAGATTAACTTC
  5   1   2       bld Ga18      in                      xlk142o09ex.5p                                                         AACTTCTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGNNNCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGNGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGGNNCGCTTNGAGGCCCTGACCGATGAGATTAACTTCTTGCNNNNNNGTATGAAGAGNAGNTGNNCGAAATGNAATCCNNGANTTCTGANNNTTNCNTT
  5   1   2       bld Emb3 5g                         IMAGE:3398907.5p                                                          CACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGTGACAGGACANGATGCGCTTGGATCTGACTGGGAATATGCAGGCCTGGTGGAGACTTCAAGATAATATGAGATGA
  5   1   2       bld Gas5 5g                         IMAGE:3748242.5p                                                          GGAATTCCCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAAACCTGCGCGGNCAGCTTGACGGGGCTGGGACAAGACCAAAATGCGCTGGGAATCTGAGCTTGGAAATATGCANGGCCCTGGGGGAGACTTCAAGAAATAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGGCCTGCTAAAGAAG
  5   1   2       bld Ga18      in                      xlk158g01ex.5p                                                          CTTCTCACNNNTNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCGGNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCGCGCTTGGAGNNCCTGACCGATGAGATTAACTTCTTGCGNCNNNNTATGAAGAGGAGNTGCNCGAAATGCAATCCCAGATTTCTGANACTTCCNNTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGNCAGAGCTCAGTAT
  5   1   2       bld DMZ  5g3  in                         xl297p15.5p                                                          CACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGG
  5   1   2       bld DMZ  5g                              xl232o20.5p                                                          CACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTG
  5   1   2       bld Te2  5g                         IMAGE:7393196.5p                                                           ACGTAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCCTGACGATGAGATAACTTTCTGCGTCAGCTGTATGAAGAGGAGTGCGCGAAATGCATCCAGATTCTGACACTTCGTGTCTGTCATGGACACACGCACTT
  5   1   2       bld Ga18      in                      xlk158j20ex.5p                                                           CTTCTCACNNNNNTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCNGNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACANGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAANTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTNGAGNNCCTGACCGATGAGATTAACTTCTTGCGNCNNNNNTATGAAGAGGAGTTGCGCGAAANGCAATCCCAGATTTCTGACACTTCCGTTGNNCTGTCTATGGACNACAACCGCAGNCNTGACCTGNACNGCATCANTGCNGAGGTCAGAGCTCAGTATG
  5   1   2       bld Ga18      in                       xlk74i23ex.5p                                                           CTTCTCACGTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGNATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAANTAACAGANNCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGANGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGG
  5   1   2       bld DMZ  5g3  in                         xl282j14.5p                                                            CGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGA
  5   1   2       bld DMZ  5g3  in                         xl282j18.5p                                                            CGTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGAT
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749404.5p                                                             GTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTGCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCGAACCAGAAGACCCACACGCAGC
  5   1   2       bld Tbd3 5g                         IMAGE:3549787.5p                                                             ATTTAACGCGTCTCACTGCCATCACACTCCCCAGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCAGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGC
  5   1   2       bld Emb1 5g                         IMAGE:5157236.5p                                                             GTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTNCAGAATAAATATGAAGATGANATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGGAGGCCCCTGGACCGATGAGAATTAACTTTTCTTGGCGTCAGGCTGGTATTGAAAAAAGGAGTTTGGCGCGGAAAATGCAAATCCCCCAGGATTTTCCGGAACACCTTTCCCGGGTTGGCCCCTGGTCCCAAAG
  5   1   2       bld Emb9 5g                         IMAGE:7976890.5p                                                             GTAGTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCTGACACTTCCGTT
  5   1   2       bld Neu2 5g                         IMAGE:2942469.5p                                                              TAGTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCTTATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAAGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTGGACGGCCTGTGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGATATATGCATGGCCTCGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTACAGACGCACAGAGCTAGAGA
  5   1   2       bld Ga18      in                      xlk138m16ex.5p                                                              CNCACGTNNNTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGANCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGNNATATATGAACAAAGNACAGCTAGAGGNNNNCTTGGAGGCCCTGACCGATGAGATTAACT
  5   1   2       bld Ga18      in                        xlk4b22ex.5p                                                              CTCACGTNNNNCATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNNTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAACCTGCGCCNNCAGCTTGACGNNCTGGGANAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTNTCCTGCTGAAGAAGGATGTGGNTGAGGCATNTNTGAACAAAGTACAGCTAGNGGCNNNCNTTGGAGGCCCTGANCGATGAGATNACTTNNT
  5   1   2       bld Ga18      in                      xlk139m15ex.5p                                                              CTCACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGNATCTGAGCTGGGAAANATGCAGNNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAANTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGNNG
  5   1   2       bld Ga18      in                       xlk55n18ex.5p                                                               TCACNNNNCNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNNCTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGNNGT
  5   1   2       bld Ga18      in                      xlk143a09ex.5p                                                               CACNTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNGNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGANCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNNNNNTTGGAGGCCCTGNNCGATGAGANNAACTTCTTG
  5   1   2       bld Ga14 5g                           Ga14-p18b12.5p                                                                GTCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCANCCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGT
  5   1   2       bld Ga18      in                       xlk69o11ex.5p                                                                CACGTNNNNCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAANCTCCTGCAGAANCAGAAGACCACACGCAGCAACATGGACGGCATGNTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGNCNAGANGCGCTTGGAANCTGAGCTGGGAAANATGCAGGNNCTGGTGGAGGACTTCNAGAATAAATATGAAGATGAAATTNACAGACGCACAGAGCTAGAGNATGAAATTTGNCCTGCTGAAGAANGGATGTGGNTGAGGCATATATGAACNAAG
  5   1   2       bld Ga18      in                       xlk61g19ex.5p                                                                ACGTAGNCGCATCTNNCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNCNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAANNNNNTGGNTGAGNCATATATGAACAAAGTACAGCTAGAGGCGNNNTTGGAGGNCCTGACCGATGAGNNTAACTTNTTG
  5   1   2       bld DMZ  5g3  in                         xl314h13.5p                                                                GTCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTG
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3548531.5p                                                                 TCGCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGNGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGCCC
  5   1   2       bld Emb4 5g                         IMAGE:4959738.5p                                                                 TCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTG
  5   1   2       bld Te2  5g3  in                    IMAGE:7207501.5p                                                                 TCTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCCTGACGATGAGATTACTTTCTGCGTCAGCTGTATGAAGAGGAGTGCGCGAAATGCATCCAATTCTGACACTTTCGTGTCTGTCTATGACACACGCAGCCTGACG
  5   1   2       chi Int2                            IMAGE:8530809.5p                                                                  CTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCATATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACTTGGACGGCATGTTTGAAGCCTAACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGAGGACAGGACAATATGCGCTTGGAATCTGAGCTGGGAATATGCAAGGCCTGGTGGAGGACTTCAGGAATATTTTGAAGATGAATTATCATACGCACATAGCTATATAAAGATTTGTCCTGCTAAAAAGGAGTGGAAGATCTTATATTAATAAGTACTTCTTGATCTCATTGTAAGCCTGAATATATATATTATTATGCTTTACTGATGAAG
  5   1   2       bld DMZ  5g3  in                         xl242e18.5p                                                                  CTCATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld Emb4 5g                         IMAGE:5516076.5p                                                                    CATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGANATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCNTGGAGGCCCTNGACGATGAGATAACTTTCTGCGTCAGCTGTATGAAGAGAAGTGCGCGAAANTGCATCCNAGATTNCTGACAN
  5   1   2       bld Kid  5g                         IMAGE:7011550.5p                                                                    CATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCCTGACGATGAGATAAACTTCTGCGTCAGCG
  5   1   2       bld Emb4 5g                         IMAGE:5571101.5p                                                                     ATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAANGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTAAGAAAAAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGAACATTTCCCGTTGTCCTGTCTATGGGAAACAAACCGCAGCCTTTTGACCTGGACGGCCTTCATTGGCANAAGGTCAAAG
  5   1   2       bld Tbd3 5g                         IMAGE:3548788.5p                                                                      TCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGTACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCGAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAACGTGCGTATCCTGTAGCACCAGATCAAGATGCTGGAAACCAAGCGGAATCTCCTGCATAACCAGAAGACCACACGCAGAAGCATGGACGGCATGTGTGAAGCCTACATCAGCTACCTGCGCCTCCAGCTTGACGGACTGGGACAGGACTAGATGTCGCTTGCATCTGAGCTGGTAAATATCGCTGGCCTGTCGGAC
  5   1   2       bld Emb4 5g                         IMAGE:4679984.5p                                                                        TGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGGCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAAGACTTCAAGAATAAATATGAAGATGAAATT
  5   1   2       bld Ga18      in                      xlk156i02ex.5p                                                                        CATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCGGNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975158.5p                                                                         GCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAATGCAATCCAGATTT
  5   1   2       bld Ga18      in                       xlk79n11ex.5p                                                                         CATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAANTTGTCCTGCTGAAGANNGNNGTGGATGAGNNATATATGAACAANGTACAGCTAGAGGNNNNCTTTGGAGGCCCTGANCGATGAGATNAAC
  5   1   2       bld Ga18      in                      xlk153d23ex.5p                                                                         CATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGNTTGACGGCCTGGGNNAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGNNTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCNNNCNTTGGAGGCCCTGANCGATGAGA
  5   1   2       bld Ga18      in                       xlk60c11ex.5p                                                                         CATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNNCTTNNNNNCTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAANTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCGCNCTTTGGNGGNCCTGACCGATGAGATTA
  5   1   2       bld Ga18      in                        xlk8h21ex.5p                                                                         CATCTNCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGNGCTTNNNNNCTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGNGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGNNGAGGCATATATGAACAAAGNACAGCTAGAGGCG
  5   1   2       bld Ga18      in                      xlk155d20ex.5p                                                                         CATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCNNNNNCCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCGNNCTTGGAGGCCCTGANCGATGAGATTAACTTCTTGCGNCNNNNTATGAAGAGGAGNTGCGCGAAATGNAATCCCAGANTTCTGANACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGNCNNNACCTGGACNNCATCATTNCAGAGNNCAGAGCTCAGNA
  5   1   2       bld Ga18      in                      xlk145a19ex.5p                                                                         CATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGNATCTGAGCTGGGAAANATGCAGGGNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAANNTGTCCTGCTGAAGAAGGATNNGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCG
  5   1   2       bld Ga18      in                        xlk4p21ex.5p                                                                          CATCTGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCNNNNNTTNNCNNCTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCNACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNNNTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGNNATATATGAACAAAGTACAGCTAGAGGCGCNNTTGGAGGCCCTGACCGATGAGATT
  5   1   2       bld Ga14 5g                            Ga14-p10c4.5p                                                                           ANTCACAGCTCCACCTTGTCCGTCAGATCGACCAAAGTCACCTNACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCANGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGA
  5   1   2       bld Ga18      in                      xlk106n05ex.5p                                                                            CNGCCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCCTNNCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCNGNNNNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGNATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGGCGCGCTTNGNGGNCCTGACCGATGAGATTAACTTCTTGCNNNNNTGTATGAAG
  5   1   2       bld Ga18      in                      xlk112m08ex.5p                                                                               CCACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNTNNCCCCGCTCnnnnnnttnnnnnCTTCTCGTACAGCGGNNCNCCATGGCGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGNCNCNGGNNTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACNANNGNCTCCTGGNACCCCTCAACCTGNAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCNNNNTTGACGGCCTGGGACAGNACAAGANG
  5   1   2       bld Ga18      in                      xlk149d18ex.5p                                                                               CACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNCCCCCCGCTCCGGCGCTTNNNNNCTTCTCGTACAGCNNNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGNNGCGCTTGGAGGCCCTGACCGATGAGATTNANTTCTTGCGNCNNNNTATGAAGAGGAGTTGNGCGAAAANGNAATNCCAGANTNNCGACACTTNCGNTGNNCTGTCTATGGACAACAACCNNCAGCCTTGACCTGGNNGGCATCATT
  5   1   2       bld Ga18      in                      xlk145a06ex.5p                                                                               CACTCACAGCTCCACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGNNNNNCCCCCGCTCCGGCNCTTNNNNNCTTCTCGTACAGCGGNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGNGGAGGANTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNGCNNTTGGAGNCCTGNNCGATGAGATTAACTTCTTG
  5   1   2       bld Int2                            IMAGE:8530053.5p                                                                                  GNAGATGCATCAATTGAATTCGTCCACCAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATAACTTCTTGCGTCGCTGTATGAGAAGAGTGCGCGAATGCATCCAGATTCCGACACTTCGTGTCTGTCATGACACACCGCAGCTGACTGACGCTCATGCAAGTCAACTCATAGAGAGTGCACAAGCGTAGATGAACTGTCAGTATACAACGCA
  5   1   2       bld Emb9 5g                         IMAGE:7977278.5p                                                                                       CACCATGTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACACAACCGCAGCCTTGACCTGGACGCATCATGCAGAGTCAGAGCTCAGTATGAGACGTTGCCAACAGAGTCGTTTAGAAAGTGAAAACACTGTTATCG
  5   1   2       bld Emb4                            IMAGE:4202335.5p                                                                                             GTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACACGAGCGGTTTTGGGGGCACAAGTGTGGGAATCAGCGGG
  5   1   2       bld DMZ       in                         xl266a17.5p                                                                                             GTCCGTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAANAG
  5   1   2       bld Emb9      in                    IMAGE:7973836.5p                                                                                                 GTCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGTTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAGGATGTGGATGAGGCATATATGACAAAGTACAGCTAGAGGCGCGCTTGGAGCCCTGACGATGAGATTACTTCTGCGTCAGCTGTAGAAGAGAGTGCGCGAATGCATCCAGATTCGACCTTCGTGTCTGTCATGACACACGCAGCTGACTGACGCTCTTGCGAGTCAACTATTAAACTGCACAGACGTTAATGGAACTTCAGTATCAGATGACACCTGTCTGGAACTAACCATGAATGA
  5   1   2       bld Int2                            IMAGE:8527844.5p                                                                                                  TCAGATCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGNNGCCTGACGATGAGATTACTTTCTGCGTCAGCTGTATGAAGAGAGTGCGCGAATGCATCCCAGATTCTGACACTCGTTGTCTGTCATGACACACCGCAGCTGACTGACGCTCATGCGAGTCGACTCATAGAGAGTCCACAGACGTTAGATGAACTGTCAGTAGTCAGATGGATCC
  5   1   2       bld Tbd3      in                    IMAGE:3549939.5p                                                                                                     CCTCGACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGTTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCACAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCCCCTT
  5   1   2       bld Emb9      in                    IMAGE:7976791.5p                                                                                                          ACCAAAGTCACCTACCGCACCAGCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAAGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTTCGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATT
  5   1   2       chi Emb4                            IMAGE:5569822.5p                                                                                                                   ggacgcgtgggcggacgcgtgggcggacgcgtgggcggacgcgtgggcggacgcgtgggcggcgCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGGGGATGAGGCCTATATGAACCAAAGTACAGCCTAAAGGCGCGGCTTGGAGGCCCTGACCGATGAAATTAACTTCTTGCCGATAGCTGCATTAAGACGGAGTTTCCCTCAAAATGCCATCCCCCAATTTCCGGCCCCTCCCCCATATGACCCGGACTAGCCCACCACCCATCCGCTCCTTGCGACCTGGGCCGCGGCTTCCTTCGCGGGAGGCTCTGAGAACGACGAACTCCGACACCTTGCACAGCACACCACGCCTATTCGTCTCCAGCCCCCCCGATGCACGTCCTTC
  5   1   2       bld Emb4                            IMAGE:4682455.5p                                                                                                                              CAGCAGCGCTGCCCCCCGCTCCGGTGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGNTGTCCTGTCTATGGGACACACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCANTATGAAGACGTTGCCCACAAGAGCCGTTTTAAAAGTGGAAAACATGTATCAAGTTTAAGTACCCAAGAACTGCAGACATCAGCTGGGCT
  5   1   2       bld Emb4                            IMAGE:4930563.5p                                                                                                                                GCAGCGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGAACACTTTCCGTTGGTCCTGTCTATGGGACACAACCGCAGCCTTTGACCTGGACGGATTCCTTTGCAGAGGTCAGAGCTCCANTATGAAGACGTTGCCCACAAAAGCCCGTTTAAAAAGGGGAAAACATGGTATCCAGGGTTAAGTACCCAGGAACTGGCAGAACATTCGCCTGGGCCCCCTTATGGGG
  5   1   2       add Emb3      in                    IMAGE:3399498.5p                                                                                                                                    CGCTGCCCCCCGCTCCGGCGGCTTCAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTCGGATCTGCGGGAATCACATCGGGCAGCGCTAACCCTGAGCATCCTGTAACCCTTGACCGGGGAAGCTATCCTTGCATCCTGCAG
  5   1   2       bld Emb9                            IMAGE:7975559.5p                                                                                                                                                              CAGCAGCTTCTCGTACAGCGGCGCCCCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCTTGTCTATGGACAACACCGCAGCTTGACCTGACGGCATCATGC
  5   1   2       bld Ga18      in                      xlk115n15ex.5p                                                                                                                                                                CNNCTTCTCGTACAGCGNNNCNCCATGGCGAGTAGAGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCNCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGANGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGANCACACGCAGCAACATGGACNGCATGTTTGAAGCCTACATCAGCNACCTGCGCCGCCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGAANCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGNNTTCAAGAATAAATATGAAGATGAAATTAACAGANGCACANNGCTAGAGAATGAATTTGNCNGCT
  5   1   2       bld Ga18      in                      xlk110i16ex.5p                                                                                                                                                                   CTTCTCGTACAGCNNNNCNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGNCNCAGGNGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGANAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAANATGCAGNNNNGGTGGAGGACTTCAAGAATAAATNTGAAGATGAAATTAACAGACGCACAGAGCTAGAGAANGAATTTGTCCTGCTNAGAAGGATGTGGATGAGGCATATATGAACAAAGNACAGCTAGAGCGCGCTTNGAGGNCCTGACCGATGAGATTACTTC
  5   1   2       bld Ga18      in                      xlk128o02ex.5p                                                                                                                                                                   CTTCTCGTACAGCNNNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCNTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGANCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTNGGAATCTGAGCTGGGAAANATGCAGGGCCTGGNGGAGGNNTTCAAGAATAAATATGAAGATGAAANTNACAGAC
  5   1   2       bld Ga18      in                      xlk115d23ex.5p                                                                                                                                                                   CTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGCCAGCTCCNCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAANCTCCTGCAGAACCAGAAGANCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAACCTGCGCCGNCAGNTTGANGGCCTGGGANANNNAAGATGCGCTTGGAANCTGAGCTGGGAAANATGCAGGGNCCTGGTGGAGGNNTTCAAGAANAAATATGAAGATGAAANTAA
  5   1   2       bld Ga18      in                        xlk6m23ex.5p                                                                                                                                                                   CTTCTCGTACAGCNGNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGNCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGANTTCAAGAATAAATATGAAGATGAAANTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGNTGAGNNATATATGAACAAAGTACAGCTAGAGGNGNNCTTNGAGGCCCTGANCNATGAGATNAACTTCTTGCNNNNGNGTNTGAAGAGGNGTTGCNCGAAATNNAATCCCAGA
  5   1   2       bld Ga18      in                       xlk53a18ex.5p                                                                                                                                                                   CTTCTCGTACAGCGGNNNNCCATGGCGAGTAGAGCCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGNTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGANGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGNAGGACTTCAAGAATAAATATGAAGATGAAANTAACAGACGCACAGAGCTAGAGAATGANNTTGTCCTGCTGAAGAAGGATGTGGATGAGNNATATATGAACAAAGTACAGCTAGAGGNNNNCTTNGAGGCCCTGANCGATGAGATTAACTTCTT
  5   1   2       bld Ga18      in                       xlk78p03ex.5p                                                                                                                                                                   CTTCTCGTACAGCGNNNNNCCATGGCGAGTAGAGNCAGCTCCNNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTNGAGGCCCTGACCGATGAGATTAACTTCTTGCGNCNNNGTATGAAGAGG
  5   1   2       bld Ga18      in                       xlk62o13ex.5p                                                                                                                                                                   CTTCTCGTACAGCGGNNNNCCATGGNGAGTAGAGCCAGCTCCGNTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGNTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGNCTACATCAGCAANCTGCGCCGNCAGCTTGACGGCCTGGGANAGGNCAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGNTGTGGNTGAGGCATATATGAACAAAGTACAGCTAGAGG
  5   1   2       bld DMZ                                  xl260o23.5p                                                                                                                                                                            AGCGNCGCCCCCNTGGCGAGTAGAGNCNGCTCCGCTTCTTTCANCCTGGGGTCCAGCTATGGAGGAGCCTCCTGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGNGGGAATCA
  5   1   2       bld Ga18      in                      xlk126a02ex.5p                                                                                                                                                                                     CNCCATGGCGAGTAGAGCCAGCTCNNTNCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCNNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGNCTGGTGGAGGNNTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGNTGAGGCATATNTGAACAAAGTACAGCTAGA
  5   1   2       bld Emb4                            IMAGE:4203624.5p                                                                                                                                                                                          CACGCGTCCGGCCAGCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAAT
  5   1   2       bld Tbd1                                 AW765284.5p                                                                                                                                                                                                        GCTCCGCTTCTTTCAGCCTGGGGTCCAGCTATGGAGGAGCCTCCAAGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATNTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAAGAG
  5   1   2       bld Emb4                            IMAGE:5571075.5p                                                                                                                                                                                                                                CCAGCTATGGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGGACCTGGACGGCATCCATGGCAGAGGTCAGAGCTTCAGAATGAAGACGTTGCCCACAAGAGCCGGTTAAAAAGTGGGAAAACCATGTATCAAGTTTAAGTACCCAAGAACTGCAGAACATCCGCTGGTCCCCTTTTGGGGAAGGACCTTGAAGAACCCCCAAAACCTGAGAATTAGTGGAACTGGACCCGGTTACCACCCCAAGGGCTGCCAGCCTGGAAATAAAATTGCTCTCCAAAGGCCCAACGGGT
  5   1   2       bld DMZ       in                         xl287d18.5p                                                                                                                                                                                                                                        GGAGGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGANGT
  5   1   2       bld DMZ                                  xl297o05.5p                                                                                                                                                                                                                                           GGAGCCTCCAGGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAG
  5   1   2       bld Int2                            IMAGE:8527595.5p                                                                                                                                                                                                                                            AANGGNNCCCGTGTCNNNGAGATGCATCGATTGAATTCGTCCCCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCAACAAGAGCCGTTTAGAAGTGGAGACATGTATCAAGTTAGTACGAGTACTGCAGACTCAGCTGTCGCTATGGGATGAACTGAGACACAAACTGAATAGTGACTGACCGTCACACAAGTGCGTCGAATAATGCTCTCAGCCACTGCAACTGAGCANTCCTGAGCAGACTGAACTGATGAGATCAGACACTCTACGG
  5   1   2       bld DMZ       in                         xl299d15.5p                                                                                                                                                                                                                                                     GGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAG
  5   1   2       bld DMZ       in                         xl259m18.5p                                                                                                                                                                                                                                                     GGTTCGGGAGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCA
  5   1   2       bld Emb1                            IMAGE:6863039.5p                                                                                                                                                                                                                                                             AGCGGCTACAGGAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGGACCCGTTACACCACAAAGGCTGCAGTCCGGAAATAGATGCTCTCAAAGCACAACGTGGCAAACCTTTGGAGGCACCAGATCGGCTGA
  5   1   2       bld Ga18      in                        xlk2d17ex.5p                                                                                                                                                                                                                                                             AGCGGCTACAGGAGCGGTTTTGGGGNCNNAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGNACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGNGCGCTTGGAGGNCCTGACCGATGAGATTAACTTCTTGCGTNNNNNTATGAAGAGGAGTTGNGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGNCTTGACCTGGNCGGCATCATTGCAGAGGNCAGAGCTCAGTATGAAGACGTTNNNAACAAGAGNNGTTTAGAAGTGGAAAACATGTATCAAGTTAA
  5   1   2       bld Sp1                             IMAGE:5435388.5p                                                                                                                                                                                                                                                                        GAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTACTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAACTGCAATCCAAGATGTCTGACACTTCGATGTCCTGTCTATGACAACAACCGCACCCTGACCTGGACGCATCATGCAAAGGTCCACTCATATGAAACTTGCCAAAAGGCGTTAAAAGGGAAAGTGGTCAGTTATTCCAAATGCGAATACCGGGGCCTGGGAAGCGGAAACCAAGGAAAATGG
  5   1   2       bld Sp1                             IMAGE:5507196.5p                                                                                                                                                                                                                                                                        GAGCGGTTTTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGATGAGAAGGAGCACATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACTCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTTAAAGTGGAAAACATGTATCAAGTTAAGTACCACGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAACTGAGATTAGTGACTGACCC
  5   1   2       bld Ga15      in                       XL406c04ex.5p                                                                                                                                                                                                                                                                                TTGGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGA
  5   1   2       bld DMZ       in                         xl327l14.5p                                                                                                                                                                                                                                                                                  GGGGGCGCAGGTGTGGGATCTGCGGGAATCACATCGGTCAGNGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCANGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCNGAACAAGATGCTGGANACCAAGTGGAATCTNCTGNAG
  5   1   2       bld Ga15      in                       XL506m12ex.5p                                                                                                                                                                                                                                                                                             TGTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCANCAAGTCANGACCGAGGAGAAGGAGCANATCAAGACTCTCAACAACAAGTTCGCCTCTTTNATTGACAAGGTGCGTTTCCTGGANCANNAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCANAAGACCACACNCAGCAACATGGACGGCATGTTTGAAGCCTACATCATCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGC
  5   1   2       bld DMZ       in                         xl221f21.5p                                                                                                                                                                                                                                                                                              GTGGGATCTGCGGGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTANA
  5   1   2       bld DMZ       in                         xl300h23.5p                                                                                                                                                                                                                                                                                              GTGGGATCTGCGGGAATCACATCGGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGAC
  5   1   2       bld Ga18      in                      xlk154f19ex.5p                                                                                                                                                                                                                                                                                                           GGAATCACATCGGTCAGTGTCAACCAGAGCCTCCTNNNCCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGNCNNNNTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAANNGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGNTTAGAAGTGGAAAACATGTATCAAGTTAAGTACNAAGAACTGCAGACATCAGCTGGNCNCTATGGGGNTGA
  5   1   2       bld DMZ       in                         xl267f10.5p                                                                                                                                                                                                                                                                                                                     GGTCAGCGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCNTCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCANGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCATAACCAGAAGACCACACGCAGCAACNTGGACGGCATGTTTGAAGCCTACNTCANCNACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTNGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCANCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCA
  5   1   2       bld Int2                            IMAGE:8824123.5p                                                                                                                                                                                                                                                                                                                         CACAGAGAGGCCACACTAGCAGTCGGATACGAATTCGTCCCCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGCTGCAGTCCGAAATAGATGCTCTCAAAGCACACGTGCAAACCTTGAGCACAGATCGCTGAGCCGAGACGGTGAAAGCTGGCATGAAGATGCCAGACAGCTCGCTGACTGGAGCTGCTCTGCAAAAGGCCAGCAGGAACATGACTCGCCCGC
  5   1   2       bld Ga15      in                       XL442m20ex.5p                                                                                                                                                                                                                                                                                                                           TGTCAACCAGAGCCTCCTGGCACCCCTCAACCTGGAGATCGACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGG
  5   1   2       bld Int2                            IMAGE:8825485.5p                                                                                                                                                                                                                                                                                                                                               TATTTAAGTTTCAATATGAACCTTCCAACTATTTCTTTATTCGTCCCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAAGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGCACAGATCGCTGAGCCGAGGAACGTGGAGAGCTGGCATTGATGATGCCAGGAACAGCTCGCTGAACTGGAGCTGCTCTGCAGAAGCCAGCAGACATGACTCGCCAGCTGCGTGAATACAAGGACTGATGATGTGAACTGTCCTTGAATGGAATCGCAACTACGGAACCTGTCTGAAGGGAG
  5   1   2       bld Ga14                               Ga14-p16g7.5p                                                                                                                                                                                                                                                                                                                                                            GGAGATCGACCTTCCATCCAGCANGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGNGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGNGGACTTCAAGAATAAATATGANGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCA
  5   1   2       chi Ga15                               XL438p03ex.5p                                                                                                                                                                                                                                                                                                                                                                    ACCCTTCCATCCAGCAAGTCAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCANAAGGCCAAGCA
  5   1   2       bld Int2                            IMAGE:8529412.5p                                                                                                                                                                                                                                                                                                                                                                                                            AANNNCTTCCAATGGTCGTTGAGGATCCATCAATACGAATTCGTCCCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACTCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTTGCAATCTTTGAGGCACAAATCGCTGAGGCCGAAGAACGTGGATAGCTGGCATTGAAGATGCCAGGAAAATCTCGCTTAACTGGAGCTGCTCTGCGAAGG
  5   1   2       bld Ga18      in                      xlk162f13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGANCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGNNCTGGNGGAGGANTTCAAGAATAAATATGAAGATGAAANTAACAGANGNNCNGAGNTAGAGAATGAATTTGTCCTGCTGAAGNAGGANGTGGATGAGNCATATATGAACAAAGNACAGCTAGAGGNNNNNTTNGAGGCCNTGACCGATGAGAT
  5   1   2       bld DMZ       in                         xl242i07.5p                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTGGAGCAGCANAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCNNAAGACCACACGCAGCNNCATGGACNGCATGTTTGAAGCCTACATCANCAACCTGCGCCGCCGGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCANGGCCTGGTGGAGGACTTCAAGAATAAATATGAANATGAAATTAACAGACNCACANAGCTAGAGAATGAATTTGTCCTGCTAANGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACNACAACCGCANCCTTGACCTGNACGGCATCATTGC
  5   1   2       bld Ga15      out                      XL438f12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTGACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGA
  5   1   2       bld Emb9      in                    IMAGE:7973861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAAGGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAATAGATGCTCTCAAGCACACGTGCAAACTTGAGGCCAGATCGCTGAGCCGAGGACGTGGAAGCTGCATTGAGGATGCAGACAGCTCCTGACTGAGCTGCTTCGAAGCAACAGACTATCGCACTGCTATCAGATGAGATTAACTGCTTGATGAATCCCTAAGACGTGAGAAAAACAGATCGCTCACAATCACAATTCGTTCTGTCGGG
  5   1   2       bld Ga18      in                      xlk136g03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAAGTGCGTTTCCTGGAGCAGCAGAACAAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGNACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGNNNNNNTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGNTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGANTAGTGAACTGANCCGTTACACCACAAGGCTGCAGTCCGAAATAGATNCTCTCAAAGCACAACGTGNNNACCTTGAGGCACAGATCGCTGANNNCGAGGAACG
  5   1   2       bld Ga18      in                      xlk159c17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGATGCTGGAAACCAAGTGGAATCTCCTGCAGAACCAGAAGACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCNNNNNNNTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAANGTGGAGAGCTGGCATTGAAGGATGCCAGGNACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNNAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATNCCAGGAACTGATGAATGTGAANTGGCCCTTGANATTGAGATCGCCACCTACAGGAAACTGCTGGAANGAGAAGAGAGCAGACTGGAATCAGGNTTTCAGA
  5   1   2       bld Ga15      in                       XL497i03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATCTCCTGCAGAACCAGAAGACCACACGCAACAACATGGACGGCATGTTTGAAGCCTACATCANCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTANAGGCGCGCTTGGAGGCCCTG
  5   1   2       bld Int2                            IMAGE:8824447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGCCCCGGCTACAATAGGACCCCCCAATACAAATTCGTCCCGGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGGTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAAGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAAGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGAACTGATGAATGTGAAACTGGTCCTTGATATTGAGATCGCCACCTACTGAAACTGCTGAAGGAAAGAAGCGACTGATCAGCTTCGAACCTAGTATCAGAACAAGACAGTATCAGGTGCT
  5   1   2       bld Emb9                            IMAGE:7975290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGGGGGAGGAGAGTTTCAGTCCGGATTCCGGGATCTGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTGGTCCTGTCTATGGACAACATCCGCAGCCTTGACCTGTACGGCATCCTTGCAGACGTCATAGTTTCATATGAAGACGTTGCCAACAATAGCTGTTTATAAGTGGAAAACATGTCTCAAGTTAAGTACCCATAACTGCAGACTTTCAGCTGGTCGTTATGGGGATGACCTGAAGAACACTAATACTGTAATTAGTTATCTGGCCGGTTTACCACAGGGCTGTAGTCCAATTAGATCTTCATTAGCAAAGCGTTGCAACTTTGTAGTGTAATTGCTGAGTCGATGAACTTTGAAATTGGCATTGAGGAGCTCAGAATAGTTGCTGTAATTATGTTGTCGCATAATGTCATCAGGCATTTACGCTATTTGTGAATTTGACTATTGATTGGAACTGCCTTTAATGATATCTCC
  5   1   2       bld Emb9                            IMAGE:7977080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAATAGGAAGACGTTGCCAACAAGAGCCGTTTAGA
  5   1   2       bld Ga18      in                      xlk152b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGANCACACGCAGCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGNCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTNNNNNTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGTGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGNNCGAGGAANGTGGAGAGCTGGCATTGAAGGATG
  5   1   2       bld DMZ                                  xl282c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAACATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGANGCATATATGAA
  5   1   2       bld Tad1                            IMAGE:6938745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCATGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTNGAGCACAGATCGCTGAAGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGGACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAAGCCAAGCAGGACATGAACTCGCCAGCTGGCGTTGATACCAGGGAAACTGATGNAATGTTGAAACTGGGCCCCTTTGAGAATTGAGGATCGCCCACCTTAA
  5   1   2       bld Int2                            IMAGE:8530350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACGGCATGTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGA
  5   1   2       bld DMZ       in                         xl333k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGAAGCCTACATCAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAACTGGCCCTT
  5   1   2       bld Tbd2      in                    IMAGE:3200645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGAAGCCTACATCAGCAACCTGCGCTTTTAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCATCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCATTGTCCTGTCTATAGACAACAACCACAGCCTTGACCTGGACGGCATCATTACAGAAGTCA
  5   1   2       bld Ga15                               XL502a21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCAACCTGCGCCGCCAGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGAT
  5   1   2       bld DMZ       in                         xl259d03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAACCTGCGCCGCCCGCTTGACGGCCTGGGACAGGACAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCNGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTANAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAANAACACCAAAACTGANATTANTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGANGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACNAGCTCGCTGAACTGGAGGCTGCTCTGCANA
  5   1   2       chi Emb9                            IMAGE:7974888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCGATAGTTGGGATGTTCCGTCGGAGTACCGGGATGGAGCTGGAAAATGGGCATGGGCTTGCGCGGAAGACTTCAAGAATAGAGATGAGGATGGAAGTAAGTCACTCGGGTAGGGGCAGAATGGCGTGCTCCTGCTGAACAATGATGTGGATGAGGCATATATGAACAAAGTACAGGTAGAGGCGCTCTTGGAGGCCCTGACGGATGAGAGTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAGTGCAATCCCATATTTCTGACACTTCCGGGGTCCTGTCGATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAGGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCCCTACAGGAAACTGCCTGGAAGAAA
  5   1   2       bld Int2                            IMAGE:8825444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAATAttttttttattaaaaattttttttttttATTCGTCCCGGGAAATATGCAGGGCCTGGTGGAGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAAGCCAAGCAGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCTCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAGAGAGCAGACTGGAAATCAGCTTTCAGACCTAAGTTATTCAGACCAGACAGTATCAGGTGTTTCCAGTGATCGTGGTGGCATTTCCAGTGATTCAGTAATGAGTTTCAGTGGATCGGTGGTGGCTACGTGGGTGCTACCGCCGCGGCTACTCTACTCCAGCATTGAGCTCTTACATGAGACTCAGACAGGCAAGCCGTAGCATTTTAATGTCCA
  5   1   2       bld Ga18                              xlk120g19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGNNAGNNAAGATGCGCTTGGAATCTGAGCTGGGAAATATGCAGNNCTGGTGGAGGACTTTAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCNTCNNNNTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGNNGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGNNCGAGGAANGTGGAGAGCTGGCATTGAAGGATGC
  5   1   2       chi Int2      in                    IMAGE:8823877.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAAACCTCGCAAGCGCGGGGGAGGGGCTTCGTATTCGTCCCGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTAAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAGCAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGAATCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAATTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGACGAGAAGAGAGCAGACTGGAATCAGCTTTCAGAACCTAAGTATTCAGACCAGACTGTATCAGTGTTTCCAGTGGATTCGTGGTGGCATTTCCAGTGATCAGTAATGGAGTTCCagtggattcgtggtggctacgtgtgctacgtggtggctacgtggtggctacTCTACTCCAGCATGTGAGCTCTTACATGAGAATCAGACAGCAGCGTAGCATTTATGAGACTTGGAACACAAGATGGGGAGTGTTTCAGTCCTCATGTTCCCAACATGGACCTACTTGCTGCCAGCATGATCGATGCTAGCATCAAAGATTGAAGTCACTCCGTACAGCATGAGACGCTATCCCATTAGATGTAGGTGCTCA
  5   1   2       bld DMZ       in                         xl317m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGA
  5   1   2       bld DMZ       in                         xl317o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGA
  5   1   2       bld DMZ       in                         xl261h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGACTTCAAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAG
  5   1   2       bld Int2                            IMAGE:8527235.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAAANNNNCCTCTGTCCGNNNGAGNTCCATCGATTGAATTCGTCCCTGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTC
  5   1   2       bld Emb4                            IMAGE:4930278.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGGATTCCGTGGGTGCCATTTCCAGTGGGATTCAGTAATGGGAGTTTTCCAGTGGGATTTCCGtggggggctaccggcgggcgggctacggcgggcgggcTTACTCTTTACTCCCAGCAAAGGTGGAGGCTCCCTTTTACCATTTGGGAGA
  5   1   2       bld Ga18      in                       xlk51d20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGC
  5   1   2       bld Ga18      in                      xlk161c09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATAAATATGAAGATGAAATTAACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCNNNNNNNTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGNNCGAGGAANGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNAGGNCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGNCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGNAAT
  5   1   2       bld Lmb1      in                    IMAGE:8533051.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAANNNNNTCTGATTTTTNGGGNAGTACCGATATGAATTCGTCCCGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGTGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGNAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAGTATTCAGACCAGACTGTATCGGTGGTTCAGTGATTCGGGGGTGCATTTCCAGTGATCAGTATGGAGTTCAGTGGATCNGTGTCGCTACGTGTGGCTACGCGCGCTATCTACTCAGCATGGAGCTCTTCATGAAACTCAAACAGCACTACTTTATGAGACTGAACAGAT
  5   1   2       bld Tail      in                    IMAGE:8542630.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTACAGACGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCCAGACAGTATCAGGTGTT
  5   1   2       bld Int2                            IMAGE:8528523.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AANNNCCACATCGCTGNGNNGAGGGCATAAATAAAAATCGTCCGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCTGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCATAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTTCAGGATACTGCTGGAAGGAGAAGAGAGCAGACTGGATTCAGGCTTTCTAAACCTAAGTATTCAGACACAGACGTATCAAGTGTTTCCAGGGGATCTGTGGGGCTTTTCGATAGGAATCGTATCGAATTTCAGTGGATCGTTGTGTTCTGCAGCGCTTGGAGCGCTTATTAATGTATAGAATGTTTATATGAGACTCGTAAATTGCGTGGTTTATTAGTAGGTAATATTGGAATGTTGG
  5   1   2       bld Ga15      in                       XL417n23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCNATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCANAGGTCANAGCTCANTATGAAGACGTTGCCAACAAGAGCCGTTTANAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGTGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACNACGTGCAAACCTTGANGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCANGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGGCCAAGCAAGACNTGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAG
  5   1   2       bld DMZ       in                         xl291m20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCTGCTGAAGAAGGATGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCAGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCNGT
  5   1   2       bld Te2N                            IMAGE:7768342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGGATGAGGCATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGANGCACAGATCGCTGAAGCCGAGA
  5   1   2       bld Emb4                            IMAGE:5571082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATATATGAACAAAGTACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGATTGTGAAACTGGCCCTTGGATATTGAGATCGCCACCTACAGGAAACTGCTGNAAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGACCCTAAGTATTCAGACCAAGACCGGTATCAGGGTGTTTCCAGGGGAATCTCGTGGGTGGGCATTTTCCAGTGGGATTCCGGAATTGGAGTTTTCCAGGGGAATTCGGGGGTGGGCCTCCgggggggggCCATACGGCGGCCGGCTTACTTCTTACTTCCACCAAATGGGGACCTTCTTTTACCCATTGGGAAGACATCCAAGAACCAAGGCAACGGTTAGCCTTTTTTAATGGAAAAAACTGTGGGAAACCCAAGGGAAGGGGAAAAAGGGTTTTGTCCAA
  5   1   2       bld Tbd3                            IMAGE:3549543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATATGAACAAAGTACATTTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGATCTTTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCNCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGA
  5   1   2       bld Int2                            IMAGE:8822010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAATATAAGATAAAAGAAATAAATTTTTAATAAAATTCGTCCCCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAGACAGCAAGCGTAGCATTTTAGTGAGACTGTGGAGACTACGATGGGAGGAGTGCTGTCAGAGTCTTCAGATGTTTTCTCAAACATGAAGCACTACTCTGCCTGCCACAGCATGATTCTGGAGATGAGCTCGTAAGGCCAGAATCCAGAAAGGGAATTTTGGGGTTAGA
  5   1   2       bld Emb4                            IMAGE:5513917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGCTAGAGGCGCGCTTGGAGGCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTTCAGTGGATTCNGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACNGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGNCATGTGANGCTCTTACCATGGAGACATCCACAGACAGCAGCGTAGCATTTTATG
  5   1   2       bld Emb9      in                    IMAGE:7976613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTGGGATGTAGTCTGGGAGTTTCGGTCCGGAGTTCCGGGATCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGGATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTTCCAGCATGTGAGCTCTTTACCATGGAG
  5   1   2       bld Int2                            IMAGE:8529187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGATCATCGATAANAATCGTCCCCTGACCGATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACNGCGGCGGCTACNGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATGGAGACATCAAGACAGCAAGCGTAGCATTTAGTGAGAC
  5   1   2       chi Emb4                            IMAGE:5542511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGAGATTAACTTCTTGCGTCAGCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCtacggtggtggctacggcggcggctacggcggcggctaCTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCAATTTTAGTGAAGACTGTGGNANACAAGGGGATGGGAAAAGGGCCTGTCAAAATNTCCTCAGATGTTTTTTCTCCAAAACCATGAACCACCTTTAACCTCCTTGGCTGGGCCCCACAGCATG
  5   1   2       bld DMZ       in                         xl267m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCAGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAG
  5   1   2       bld Ga15      in                       XL519n20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTATGAAGAGGAGTTGCGCGAAATGCAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCANAGTCCTCANATGTTTTCTCAAAACCATGAGCAC
  5   1   2       bld Tad1      in                    IMAGE:6878616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGAGTTGCGCGAAATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCCATGTGAGCTCCTTTACCATTGGGAGACATCCCAGAACAGGCAAAGCGTAGCATTTTTAGTGAAGAACTGTTGGAGAACCAAGNGATGGGAAAATTGCCTGTCCAAAAATCCCT
  5   1   2       bld Ga18      in                      xlk121p10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGNGAGTTGCGCGAAATGNAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGNNCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNAGGNCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGNNTTTCAGANNCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGNGGTGGCATTTCCAGTGGATTCAGTAATGGGAGTTTCCAGTGGATTCGGNGGTGGCTAC
  5   1   2       bld Ga18      in                      xlk120h09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATGNAATCCCAGATTTCCGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNAGGNCAAGCAGGACATGACTCGCCAGCTGCGCGNATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGNGGCGNNTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGANTTTAGTGAAGNCTGTGGAGA
  5   1   2       bld Int2                            IMAGE:8527626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCAATCCCAGATTTCTGACACTTCCGTTGTCCTGTCTATGGACAACAACCGCAGCCTTGACCTGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCATGTGAGCTCTTTACATTGGAGNACATCCAGACAGCAGCGTAGCATTTAGTGAGACTGTGAGACCAAGATGGAGAGTGTGTCGAGTCTCGATGTTTCTCAACATGACACTTACTCTGCTGGCACACATGATCTGAGATGACTCTANGGCGATCGAAGATTGGTAAGTCAACATCTCGTAC
  5   1   2       bld Tad1      in                    IMAGE:6878814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGACGGCATCATTGCAGAGGTCAGAGCTCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCCAGTGGATTCGGTGGTGGCATTTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCCGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCCAGCGTAGCATTTAATGAAGACTGTGGAGACCCAAGGAGGGGAAAGTGCTGTCCGAAGTCCTCAAAAGTTTTCCCCAAAACCTGAGCACCTTTACTCTTGCTGGCCCACACCATGGATTTCTGAAGAAGAACCC
  5   1   2       bld Ga18      in                       xlk53p23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGTATGAAGACGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNAGGNCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGNTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNNGGCGGNTACGNNGNNNGNNACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGANATCCAAGACAAGCAAGCGTAGANTTTTAGNNAAGACTGTGGAGACCAAGGATGGGAGAGTNCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACNTNNCTCTNNNTGGCCNACAGCATGNATTCTGAAANATGAGCCTCCTTNAANGCNNNAATCAGAAAGGNNNTTTNGGTNG
  5   1   2       bld Ga18      in                       xlk57g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGNCGTTGCCAACAAGAGCCGTTTAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGTGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGNATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGNTACGNNGGCGNNTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTANNNNTTAGTGAAGACTGTGGAGNNCAANGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCNNCTTAACTCTTNCTGGCCCACAGCATGGATTCTGAAAGATGAGCC
  5   1   2       bld Ga18      in                        xlk4o19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGAAGTGGAAAACATGTATCAAGTTAAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGNGGCGNNTACGGNGGCGNNNACTCTNACTCCAGCNATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTANNNTTTTAGTGAAGACTGTGGAGACCAANGNNGGGAGAGTNCTGTCAGAGNCCTCAGATGTTTTCTCAAAANCATGAGCACCTTAACTCTTNCTGGCCCACAGCATGGNNTCTGAAANAT
  5   1   2       bld Ga18      in                      xlk139c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGTTTAGTACCAAGAACTGCAGACATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNGNAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNNGGCGGNTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCNNNNNNTTTAGTGAAGACTGTGGAGANCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGNTTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGANATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCNNAGCATGCTAT
  5   1   2       bld DMZ       in                         xl310e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGAACTGCAGACATCAGCTGGTCGCTATGGTGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAA
  5   1   2       bld DMZ       in                         xl279m24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGAACTGCAGACATCAGCTGGTCGCTATGGTGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAA
  5   1   2       bld Ga18      in                      xlk112p13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAGNCATCAGCTGGTCGCTATGGGGATGACCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNGNAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGNGGTGGCATTTCCAGTGGATTCAGNNATGGAGTTTCCAGTGGATTCGGTGGNGGCTACGGTGGTGGCTACGGCGGNNNNNCTCTTACTCCAGCAATGTGAGCTCTTTACCATNGGAGACATCCAAGACAAGCAAGCNNNGNNNNNNGNGAAGACTGTGGAGNNNAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTCTCAAAACCATGAGCACCTTAACTCTNCTGGCCCACAGCATGGNTTCTGAAAGANGAGCCTCCTTAAAGGNNGAAA
  3   1   2       bld Ga18      in                       xlk74i23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCANCNNGNNNNNANGGGGATGNCCTNANGNANNNNAANCTNAGNTTANNGNACTGNCCCNTNNNCNNAANNCTGCANNCCNAAATAGANNNTCTCANNNNNACGTGNAANCCTTGAGGNNCAGATNNCTGAGGCCGAGNNACGTGNAGAGCTGGCATTGAAGGATNCCAGGNACAANCTCGCTGAACTGGAGGNNNNCNGCAGAAGNNCAAGCAGGACATGACTCNCCAGCTGNGTGAATNCCAGGANCTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGNCTACGGCGGCGNNTACGNCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCNNNNNAA
  5   1   2       bld Ga18      in                       xlk57i13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTCNNTATGGGGATGNCCTGAAGAACACCAAAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTNNNNAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGNGGCGGNTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGNNTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTNAACTCTTNCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTANCCCAAGCATGCTATATGTGAAGNAAGCTAGCCCTTTTTAATCCCCNNNNGNNTAAANNGA
  3   1   2       bld Ga18      in                      xlk133i11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNNGATTAnnnnACTnnnnGTTACACCAnAnnnnnGCAGTnCGAAATnnnnnGCTCnCAnnnnnnANGTGNAANCNTNNANGCACAGNTCGCTGANGCCGAGGAACGTGGAGANCTTGCATNNAAGGATGCNAGGAANAAGCTNGCTGANCTGGAGNNNNNNTGCAGAAGGCNAAGCAGGNCATGNCTCNCCAGCTGCGTGAANNNCCAGNNACTGATGAATGTGAANCTGNCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGNAGAGAGCAGNCTGGAATCAGGCTTTCAGNACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGnCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNATTNCTCNNNNNAAT
  3   1   2       bld Ga18                              rxlk69g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNAAANTGAGNTNAnnnnnnnnGNCCCNNTNNNCNNNNANNCTGCAGTCCNNNNAGATGCTCTCANNNNCNACGTNNAAANCNTTNAGGCACAGATNNNTGAGNCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGNNNNCNGCAGAAGNCCAAGCAGGACATGACTCGCNNNNGNGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCTNTAAAAT
  5   1   2       bld Ga18      in                       xlk65c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACTGAGATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANNNNNNACCTTGAGGCACAGATCGCTGAGGNCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGNGNAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGNGGCGNNTACGGNGGNNNNNACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCNTAGNNTTTAGTGAAGACTGTGGAGANCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACNATGAGCACCTTAACTCTTGCTGGCCCACAGCATNGANNCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGNAAGCTAGCNNTTTTTNA
  3   1   2       bld Ga18      in                       xlk65c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAANTNAGATTANNGNACTNNCCCGTTNNNCCACNANGCTGCAGNCCGAAATAGATGCTCTNANNNNNACGTNNAANCCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATNCCAGGAACAAGCTCGCTGAACTGGAGNNNCTCTGCAGAAGNNCAAGCAGGACATGACTCGCCAGCTGCGTGAATNCCAGGNACTGATGAATGTGAAACTGNCCCTNGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCNTNNAAAATAA
  3   1   2       bld Ga18      in                      xlk145a19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATTANNGNNTGNCCCGTNCNCCANNNGNTGCAGNCCNNANAGANGNTCTCAAANNNACNNNCAAACCTTGAGGCACAGATNNCTGAGGCCGNGGANGTGNAGAGCTGGCATTGAAGGATGCCAGGAANAAGCTCGCTGNACTGNANNNNNNNGCAGAAGGCCAAGCAGGACATGNCTCGCNANNNNGCGAATNCCAGGAACTGATGNATGTGAANCTGGCCCTTGATATTGAGATCGCCACCTACAGGAANCTGCTGNNAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGNCCTACAACATGTTGNNATTTTTNNNTTNCTNNNNNNAATAAA
  5   1   2       bld DMZ       in                         xl236p24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTcggtggtggctacggtggtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTNGGGTAGATGT
  5   1   2       bld DMZ       in                         xl275i08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTAGTGAACTGACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAACGTGCAAACCTTGAGGCACAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTcggtggtggctacggtggtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAAT
  3   1   2       bld Ga18      in                      xlk156i02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAGnnnnnnnnnCCGTTNCNACNNNNNAGNCTGCANNCNNAAATAGANNNNNNNCAAANCNCACGNNCAANCNTGAGNNNNAGNNNNCTGAGGCCNANGAACNNNGNNNNCTGGCATNNNNNANNCCNNGNACAANCTCGNTGNACNNGNAGNNNNTCTNNAGAANGCCAAGCAGGACATGNCTCGCCACNNNNCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGNNCCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTNNNTNNCTCTTNNAAA
  3   1   2       bld Ga18      in                      xlk130f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANNTAGNGNNCTGNCCCNTTNNNCNNNANNCTGCAGNNNNNNNAGATGCTCTCANNNNNNACGTGNAAACNTTGAGGCANAGATCGCTGAGNCCGAGGAACGTNGAGAGCTGGCATTGAAGGATGCNAGGAACAAGCTCGCTGAACTGGANNNNNNCNGCAGAAGNCNAAGCAGGACATGACTCNCNNNTGCGCGAATACCAGGNACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGANCCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTNTTTNAAAATAAA
  5   1   2       bld Ga18      in                       xlk53m19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCGTTACACCACAAGGCTGCAGTCCGAAATAGATGCTCTCAAAGCACAANGNGNAACCTTGAGGCACAGATCGCTGAGNNCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGNNNAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGNNGGCGNNTACGNNGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCNTNGNNTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGNTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGNNATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGNAAGCTAGCCCTTTTTNNTCCCCNNC
  3   1   2       bld Ga18      in                      xlk136f01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNCTGCAGTCCNNAANNNANNCTCTCAAANNNNNAANNNNNAACCTTGAGGCACAGATNGCTGAGGNCNANGAACNTNGNNGNNNCTGGCATNNNAGGATNCNAGGAACAAGCTCGCTGANCTGGANNNNNNNCTGNAGAAGNCNAAGCAGGACATGNCTCNNNNNNNGCGCGAANNCCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCNCCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGNCTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTACT
  3   1   2       bld Ga18      in                      xlk154f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNTGCAGTCCGAAATAGANGCTCTCANNNNNNACGTGCAAACCTTNAGGNACAGATCGCTGAGNCCGAGGNACGTGGAGNGCTGGCATTGAAGGATNCCAGGNACAAGCTCGCTGAACTGGAGGGNNNNNNGCAGAAGGCCAAGCAGGACATGNCTCNCNANNGNGCGAATNCCAGGNACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGNAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNNATTTTTNNATTNCTC
  3   1   2       bld Ga18      in                      xlk143a09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCANTCCGAAANAGNNGCNCTNNAANCNNACGTNNNNCCTTNAGGCANAGATNNNTGANNNCGAGGNNCGTGNANNGCTGGNNTGAAGGATNCCAGGANCAAGCTCGCTGAACTGNAGNCTGCTCTTCAGAAGNCCAANNAAGACATGACTCGCNNNNGNGCGAATNCCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGANCCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTNTTNNAAAAT
  3   1   2       bld Ga18      in                      xlk159j08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACCNTTGAGGCNNNNNNTNNNTGAGGCCNAGGNNNNNNGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTNNNTGAACTNGANGGNNNNTCTGCAGAAGNCCAAGCAGGACATGACTCNCCAGCTGCGTGAATNNCAGNNNCTGATGNAATGTNNAACTGNCCCTNGATATTGAGATCGCCACCTACAGGAANCTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTC
  3   1   2       bld Ga18      in                      xlk136g03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCNTTGANGNNNNNGATNNNNGANGCCGAGGNACGTGNNNNNCTGGCATTGNAAGGATNCCAGGAANAANCTNGCTGAACTGGAGGGNNNNCTGCAGANGGCCAAGCAGGACATGACTNCGCCNNCTNNGCGAATACCAGGNACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGNNTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCTTTTAAAAT
  3   1   2       bld Ga18      in                       xlk69o11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAAACCNTNAGGCACAGNTCGCTGANGNCGAGGACGTGAGANCTGGCATTGAAGGATGCNNNGNACAAAGCTCGCTGNCTGGAGGNNNNNCTNNAGANGNCAAGCAGGACATGACTCGCNNNNGCGCNNATNCCAGNNACTGATGAATGTGAAACTGNNCCCTTGATATTGAGATCGCCACCTACAGGAANCTGCTGGAAGGAGAAGAGAGCAGNCTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATNTNNCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTNCCATNCTTGCAAATTCTAGCACCGTGCCTTATTGTCCANCCTTTTGTGATGGATTTTGGGAAAGNCCTACAACATGTTGNC
  3   1   2       bld Ga18      in                      xlk139m15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AANCCTTGAGGCACAGATNNCTGANGNCGANGNACGTGNNNAGCTGGCATTGAAGGATNCCAGGAACAAGCTCGCTGANCTGGANGNNNNNCTGCAGAAGGCCAAGCAGGACATGACTCGCCNNNNNGCGANTNCCAGGNNCTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTNNTNNNAAA
  3   1   2       bld Ga18      in                      xlk138m16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANCCTTGAGGCACAGATNNNTGANGCCGAGGAACGNNNNNNNCTGGCATTGAAGNATNCCAGGAACAAGCTCGCTGAACTGGAGGNNNTCTGCAGAAGNCCAANCAGGACATGNCTCGCNANNGNGCGAATNCCAGGAACTGATGNATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCNNNNNNAATNA
  3   1   2       bld Ga18      in                      xlk158j20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACCTTNAGGCANAGATNNCTNNGNCGAGGNACGNNNGAGCTGGCATTGAANGATGCCAGGAACAANCTCGCTGNACTGNNNNNNNTCTGCAGAANNCCAANCAGGACATGACTCGCCNNNNNNNGAATACCAGGNNCTGATGAATGTGNANCTGGCCCTTGATATTGAGATCGCCACCTACAGGAANCTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGANCCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGnCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTACTNNNNNNAATAA
  3   1   2       bld Ga18      in                      xlk159c17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CNTGAGGCACAGATNGCTGANGCCGANGNNCGNNNNNAGCTGGCATTGAANGATNCCAGNACAAGCTCGCTGAACTGNAGGNNNNCNGCAGAAGGCCAAGCAGGACATGACTCGCNAGCTGCGTGAATNCCAGGNNCTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGNAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCNNNNNAAT
  3   1   2       bld Ga18                             rxlk157c23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAANNCTTNNGGCANAGATCGCTGANNCNNNGGNNCGTGGNNAGCTGGCATTGNANGGATNCCAGGNACAAGCTCGCTGNACTGGANGNNNNNTCTNNAGAAGNCCAAGCAGGACATNNCTCGNNANNNNNCGAATACCANGNNCTGATGAATGTGAAACTGNNCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGNTTTCAGANCCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNATTNCTC
  3   1   2       chi Ga18      in                       xlk78p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AANCNTNNANGCANANNTNGCTGANGCNGAGGNACGNNGNNNNNCTGGNANTGANNGNTNCCNANNNACAAGCTNNCTGNNNTGNAGGNNNNNTGNAGANGGCCAAGCAGGACATGNCTCGCNNNNNNNCGANTNCCAGGACTGATGAATGTGAAACTGNCNCTTGATATTGAGATCGCCACCTACAGNAAACTGCTGGAAGNAGAAGAGAGCAGACTGGANNNAGGCTTTCAGANNCTAAGTATTCAGNNCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNAT
  3   1   2       bld Ga18      in                       xlk73j17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACAGATNNNTGANGNCNAGNNNNNNGAGANCTGGCATTNNNGGATGCCAGGNANAAGCTCNCTGANCTGGANNNNNNCTGCAGAAGGCCANNNAGNACATGNCTCGNNACNGCNNNNATNCCAGGNACTGATGAATGTGAAACTGGCCCTNGATANTGAGATCGCCACNTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTNAGNNCCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNATTNCTNNTT
  3   1   2       bld Ga18      ?                       xlk137m23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANCCTTGAGGCACAGATCGNTGANNCNGAGGANCGTGGAGAGCTGGCATTGANGGATGCCAGGAACAAGCTCGCTGAACTGGANGNNNNTCTGCAGAAGGCNAAGCAGGACATGNCTCGCNNNNGNGCGAATNCCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTCNNTAAAA
  3   1   2       bld Ga18 5g3  in                      xlk154m14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANCCTTGANGCACAGATCGCTGANGCCGNGGNACGTGGAGAGCTGGCATTGAAGGATNNCAGGAACAAGCTCGCTGAACTGGNGGNNNNCNGNAGAAGNCCAAGCAGGACATGACTCNCCAGCTGCGTGAATNCCAGNNACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGNAAGGAGAAGAGAGCAGNCTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNNCTACAACATGTTGGCATTTTTNNNTTNCT
  3   1   2       bld Ga18      in                      xlk155f01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANCCTTGAGGCACAGATNNCTGAGGCCGAGGNACGTGGAGNGCTGGCATTGAAGGATNCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGNCCAAGCAAGACATGNCTCNCNACNGNGCGNATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNATTNCT
  3   1   2       bld Ga18      in                      xlk131c09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANCCTTGAGNNACAGATCGCTGNGGCCGAGGAACGTNGNNGAGCTGGCATTGAAGGATNNCNNNANAAGCTNGCTGNNCTGGANNNNNNCNGCAGAAGGNCAAGCAGGACATGACTCGCNNNTGCGCGAATNCCAGGAACTGATGAATGTGAANCTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCNTCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCTTNNAAAA
  5   1   2       bld Ga15      in                       XL416h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAGTTCCAGATCGCTGAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCCAAGCTTCTTCATCTGATTC
  3   1   2       bld Ga18      in                      xlk145a06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACANATCNCTGANGCCGAGGANNGTNGANANCNGCATTGANNNNTNCNNGGNACAAGCTCGCTGNACTGNANGCTGCNCTTCAGAAGNCAAGCNAGACATGNCTNNCNNNNGCGCGANNNCCAGGAACTGATGAATGTGANNTGGNCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGNAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGNCTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGNNGCNACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCCCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNNCTACAACATGTTGNNNTTTTTNNNT
  3   1   2       bld Ga18      in                       xlk72f04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGAGGCCGAGGNNNGTGGAGAGCTGGCATTNNAGGATGCCAGGAANAAGCTCGCTGNNTGGAGGCTGCTCTTCAGNAGNNNAAGCAAGACATGNCTCGCCNACNGCGCGAATACCAGGNACTGATGAATGTGAAACTGNNCCTTGATATTGAGATNNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGNCTGGAATNAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTNCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCTTTT
  5   1   2       bld Lu1                             IMAGE:4633198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGCCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGACGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCA
  5   1   2       bld Tbd1                                 AW764458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGGAACGTGGAGAGCTGGCATTGAGGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACG
  5   1   2       bld Emb4      in                    IMAGE:4203365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGGAACGTGGAGAGCTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTT
  5   1   2       bld Tbd5      in                    IMAGE:3580960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGAGGAACGTGGAAACTGGCATTGAAGGATGCCAGGAACAAGCTCGCTGAACTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGACTCGCCAGCTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCA
  3   1   2       bld Ga18      in                      xlk142o09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGCTGGCATTGAAGGATGCCAGGANNANCTCGCTGAACTGGAGGNNNNCTNNAGNAGNCCAANCAGGANATGNCTNNCCAGCTGCGTGAATNCCAGGANCTGATGAATGTGAAACTGGCNCNNGATATTGAGATNNNNNCCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGNCTGGANTCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGNTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTACTC
  3   1   2       bld Ga18      in                      xlk155d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGCTGGCATTGAAGNATGCCAGGNACANGCTCNCTGNACTGGANNNNNNCTGCAGAAGNCCAAGNAGGACATGNCTCNNNACNNNGCGAATNCCAGGAACTGATGAATGTGAAACTGNCCCTTGATATTGAGATCNCCACCTACAGNNAACTGCTGGNAGGAGNAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGnCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNTTNCTCTTTTAAAATNA
  3   1   2       bld Int2      in                    IMAGE:8823877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGCCTTGCCATTGAATGGATGGCAGGAGCCAGCTGCTGACTGAAGCTGTCTCGCAGAGGCCAGGCAGACATGATTCGCCAGCTGCGCGATACAGGAACTGATGATGTGAAATGCCTGATATGAGATCGCACTACAGAAACTGCTGAAGAGAGAGAGCAGACTGAATCAGGCTTCAGAACTAAGTATTCAGACCAAGACTGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGTGGTGGCTACGGTGGTGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCACCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATCTATTTTGAGTCATGGGTGACCTTTCTGTGTTCATGTCCCAAGCACCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTAAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATAAAAGTTTGCC
  3   1   2       bld Int2 5g3  in                    IMAGE:8820564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTGGTGAGAGGCTGGCATGGAGGATGCCAGACCAGGCTTCGCTGACTGAGCTGCTGCAGAAGGCCAGCAGACATGACTCGCCAGCTGCGTGATACCAGGACTGATGAATGTGAAACTGCCTGATATGAGATCGCCACCTACAGAAACTGCTGAGAGAGAGAGCAGACTGGAATCAGGCTTTCAGAACTAAGTATCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGTGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTAAAATAAAGTTCG
  5   1   2       bld Ga18      in                      xlk124o20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNTNNNGGAACAAGCTCGCTGAACTGGAGGCTGCTCTTCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGNNNNATACCAGGAACTGATGAATGTGAAANTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGNNGGCGNNTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCNNNNNNTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGNCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATNNTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAANNAAGCTAGCCCTTTTTAATCCCCCACAGNTCTAAAACGGACATTTGATGGTGCTTTACA
  3   1   2       bld Te2  5g3  in                    IMAGE:7207862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTTAAAATGGGGGGCTTCTTTTGCAAAAAGCCCAAGCAGAAACTAGATCTCCCCAAGTTGCGGTAATACCCAGAAACTGAAGAATGTAAAACTGCCCTTGAATATTGAGATCGCCACCTACAAGGAAAAATGCTGAAGAGAAGAGAGCAGACTGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGTGTTTCCAGTTGATTTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTATAAATAAAGTTCGGCCCT
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3200731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGAACTGGAGGGTTGCTCTGCAGAAGGCCAAGGCAGGACATGACTCGCCAGGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATATTGAGATCGCCCCCTACAGGTAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTCTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAAAGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCA
  5   1   2       bld Neu4                            IMAGE:4084995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGCTGCTCTTCAGAAGGCCAAGCAAGACATGACTCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACT
  3   1   2       chi Tad1      in                    IMAGE:6878616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGGGGCCCCCCCCTTTTGGGGATTTATTTTTGGAGGGATTTTCCGGCCCCACACCTTTACCCAGGGGAAAAAACTTGGGTTGGGAAAAGGGGAGGAAAGGAGGAAGCCGGACCTTGGAAATTCAGGGGCTTTTTCAGAAACCTTAAGGTATTTCCAGAACCAAGGACAGGTATTCAGGTTGTTTCCCAGTGGATTTCGGGGGGTGGCATTTCCCAGTGGATTCAGTAAGGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTAAGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCACATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGCATAAGCGAAGATGCGTACTACATGTTGGCATTTTTGCATTAGGAAATAAAATAAAGTTNGCGGGGTCCCCCCCCCCCCCCGCCCGGGNNNNCCCCGNGGGNNNNNNNNNNCTCTCCGA
  3   1   2       bld Ga18      in                      xlk156f14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNGCAGAANGCCAANCAGGACATGACTCGCCANNGCGCGAATACCAGGNNCTGATGAATGTGAAACTGGCCCTTGATATTGAGATCNCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNATTNCTCTTNNAAAATAA
  3   1   2       bld DMZ       in                         xl317o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAGAAGGCCAAGCAGGACATGACTCGCCAGNTGCGTGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTT
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976220.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAGGGCACAAGCAGGACATGACTCGCCCAGCTGCGTGATACCAAGAACTGATGAATGTGAAACTGCCTGATATGAGATCGCCACCTACAGGAAACTGCTGGAAGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATAAAGTCCGCCCCTT
  5   1   2       bld Ga18      in                       xlk52h09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTNNNNNNTACCAGGAACTGATGAATGTGAANNTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGNGGCGGNTACGNNGGNNNNTNCTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGNNTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGNAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGNTC
  5   1   2       bld Tbd3                            IMAGE:3548491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGAttcggtggtggctacggtggtggctacggcggcggctacggcggcggctacTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATC
  3   1   2       bld Ga18      in                      xlk158g01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATNNCAGGAACTGATGAATGTGAAACTGNCCCTTGATATTGAGATCNCCACCTACAGGAANCTGCTGGAAGGAGAAGAGAGCAGNCTGGAATCAGGCTTTCAGNNCCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGNCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACANNNTGNC
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGTGTTGTTTTTTGTCGTCACGGANGAGCTTCAAGCACAGCGCTGCGGCGGATCAGACGAGAGGAACGCCTGTTGGATGCACTCAGAATGCTGAGAGAGGGCGACTGATCAGCTTCAGACTAGTATCAGACAGACGTATCGGTGTTCCAGTGATTCGTGGTGCATTCCAGTGATTCAGTATGGAGTTCCAGTGATTCGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTAATAATAATATTTTCTATTTGGCTTATTGTGCATTTCCAATGCCTTTCAAATTAGTGTTGAAAATACTACCATACTTGCAAATTATAGCAACCGTGCATTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTAAAATAAGTCGCTTCAA
  3   1   2       chi Ga18      in                      xlk161c09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNNNNACTGATGAATGNNNNANTGNCCCNTGNNNTGAGATCNNNNCTANNNAAACTGCNGNANGAGAANNGAGCAGACTGGAATCANGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTNTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTT
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTACAGACGCAAGGCGTTTTTTTTTCTTTTTTTAGGGCTTAAGCACAACACGCGGCGAACGATAGATGAATGCCTGTTGATCGCCTCCGAACGCGAGAGAGGGCGACGATCAGCTCGACCTAGTTCAGACAGCTGTTCGGGTTCCAGTGATCGGGGTGCATTCCAGGGATCAGTATGAGTTTCCAGTGATTCGGGGTGGTACGGCGGGGCTACGGCGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAAATTAGTGTAGAAAATACTACCATACTTGAAATTCTAGCAACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTAAAATAAAGTCGCCTC
  3   1   2       bld Emb9      in                    IMAGE:7976791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGCTAGTCAGCACTGTATGAGGTGCAAGCAGCGCTACTGCAGTGTGATCAGATGAGATGAACTGCCTGTATGGATGCACTACAGAACGCTGAGGAGAGGAGCGACTGATCAGCTTCAGACCTAGTATCAGACAGACAGATCAGTGTTCCAGTGATTCGTGTGGCATTCCAGTGATTCAGTATGGAGTTCCAGTGATTCNGGTGGTGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATAACTATTTTCTCTTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATATCAGCAACCGTGCATTATTGTCCATCCTTTTGATGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTGCATTACTCTTTAAATAAGTCGCCTATT
  3   1   2       bld Ga18      in                      xlk139c11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATNCCAGGNACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGNAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGANCCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATNNCTTTCANCTTAGTGTTGAAAATACTACCATNCTTGCAAATTCNAGCNNCGTGNCNTATTGTCCNTCCTTTTGTGATGGNTTTTGNGAANNNNCTACA
  3   1   2       bld Ga18      in                      xlk164c02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGGAACTNNTGAANNGNGAANTGGNCCTTGATATTGAGATNNNNCCTACAGGAANCTGCNGGNANNAGAAGAGAGCAGACNGGAATCAGGCTTTCAGAANCTAAGTATTCAGNCCAAGNCTGTATCGGGTGTTTCNAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTNATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNNATTTTTNNNT
  5   1   2       bld DMZ       in                         xl307l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCANGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTANCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCANATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAANACGGACATTTGATGGNGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAA
  5   1   2       bld DMZ       in                         xl306l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAACTGATGAATGTGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTG
  3   1   2       chi Ga18      in                      xlk129m06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANTNCCAGGNACTGANGAANNNNNACTGNCCCTTGATATNAGATNNNNCTACAGNNACTNCTGNANGNNAGAGAGCAGACTGGAATCANGCTTTCAGNACCTAAGTATTCAGNCCAAGACTGTATCGGGTNTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGANTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGANCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTCTNTAAAA
  3   1   2       bld Emb9      in                    IMAGE:7976613.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTAGCCGACATTTTATGGTTTCAAGCCACACATACGCAGTGGATCCGATGATAATGACTGCCTATATGGAGCCCCCAGGAATGTGAAGAAAAGACAGATTGATCAGCTTTAAACTAGTATCGACCAGACAGTTCAGGTTTCCAGTGATCGGTGGGGCATTCCAGTGAATCAGTATGGAGTTCCAGTGGATCGGTGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACACGTGCACTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTAAAATAAAGTCGCCT
  3   1   2       bld DMZ       in                         xl317m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACTGATGAATGTGAAACTGGCCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCT
  3   1   2       chi Ga18      in                      xlk112p13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAACNGNNNGANNNNAAACTGNCNTTGANNTTGAGNNNNNNCCTNNAGNAACTGCTGNANNNGAAGAGAGNAGNCTGGNATCAGGCTTTCAGANCCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCNAGTGNATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTANGGTGGTGGCTACGNCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTNNNAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTT
  3   1   2       bld Ga18      in                        xlk2d17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGATNAATGTGAANNTNGCCCTNGATATTGAGATCNCCNCCTACAGGAANCTGCTGGAAGGAGAAGAGAGCAGNCTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNCNTTNCTC
  3   1   2       chi Ga18      in                      xlk115n15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GANCTGATGANTGTGAAACTGNCCCNTGATNNTGAGATNNNNCCTACAGGNAANTGCNGNNGNNAGAGAGCAGNCTGGAATCAGGCTTTCAGNACCTAAGTANTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTCNNNNNAATAA
  3   1   2       bld Ga18      in                      xlk162f01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGNACTGATGANTNNGAANCTGCCCTNGATATNAGNTNNNCACNACAGNAACTGCTGNAAGGAGAGAGAGNAGNCTGGAATCAGGCTTTCAGAANCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTCNNNTAAA
  3   1   2       chi Ga18      in                      xlk128o02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNNCTGATGAATNNNANCTGNCCTTGNNNTGAGATCNNCNNCTACAGGAANCTGCTGNANGNNAGAGAGCAGNCTGGAATCAGGCTTTCANNANCTAAGTANTCAGACCAAGACAGTATCAGGTNNTTNCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGNCTACGNNGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGANCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTNNNNNAAATA
  3   1   2       bld Ga18      in                      xlk152b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGANNANNNNNNAAANNNNCCNTGATNNTGAGNTNNNNCTACAGGAANCTGCTGNANGAGAAGAGAGCAGNCTGGAATCANGCTTTCAGAACCNAAGTANTCAGACCAAGACTNTATCGGGTNTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTT
  3   1   2       chi Tad1      in                    IMAGE:6878814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGGGGGAATTTAATTGGCGGGGGGGGGGGGGGAAAAATAAAGGGGGGGGGGGGGGGATTTTTAGGGGGGGGGGGGGGGGGTTTTTTTTTTTTTTTTTTTCCCCCCCCGCCACAAAGTGGGGGGGGGTTTTTTTTTTTTCCCCCCTGGGGGGGGGGGAGCTTCTCCCCCCAAGACCCAAACCCCCCAAAAGGGGGGGCGCCCTTTTTTTGGGAGAAAGACATTTGTGTGGGGGCCCCCCCCAAGGTTTTGGGGAAAAAATTTCCTTTTTTCAAAAAGTCCCCCCCCAGAGGGTTTTTTTTTCCAAAAAACCCCTGGGGCCCCCCCTTTAAACTTTTTGGGGGGGGCCCCCCCCGCCCTTGGGTTTTTTGAAAAAGAGTGGAGCCCTCCCTTAAAGGGCCCAGAAATTCGGAAAAGGGATATTTGGGGTAGGATTTCCCTACACCCCATTTTCCACCGTTACCCCCCAAGGCATGTTATATGTGAAAGCAAGGCTAGCCCTTTTTTATCCCCCCACAGTTCTAAAACGGACCATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATA
  3   1   2       bld Emb9      in                    IMAGE:7973836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATGATTGACCACCTACAGGGAAACTGCTGGAAGGAGAAGAGAGGCAGAACTGGAATCCAGGCTTTCAGAAACTAAGTATTCAGAACCAAGACTGTATCGGGTGTTTTCCAGTGGATCGGTAGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGTACGGCGGCGGCTACTCTTACTCCAGCAAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAAGCAAGCGTAGCATTTTAGTGAAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAAATAAAGTCGGCCTTC
  3   1   2       bld Ga15                               XL507m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AANTGGCCCTTGATATTGAGATCGCCNCNTACAGGAAACTGCTGGGAAGGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGANGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTNTGAGTCATGGGTGGCCATTCTCTTTAAANGACCTTTCTGTGTTCATGTCCCAAGNTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTNTAATANTATTTTCTCTNNGGCTTCTNGNGCAATTTCCATGCCTTTCAACTTAGNGNTGAAAATATCTACCATAGCTTGCAAATTCTAGCAACCGTGCCTTATNGTCCATCCTTTNGNGATGGATTTTGGGAAAGTGCCTACAATCATGNTGGCATTTT
  3   1   2       bld Ga18      in                      xlk145a18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAACTGGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGNCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNCATTNCTNNTNNAAAAT
  3   1   2       bld DMZ       in                         xl317g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCT
  5   1   2       bld Ga18      in                      xlk145a18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNANNTNGCCCTTGATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGNGGNNNNNCTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCNNNGNNTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGNCATTCTCTTTAAATGACCTTTCTGTGNNCATGTCCCAAGCTTCTTCATCTGATTCCCTCCNAGAAGGCTCAACTTAAGGCGAGNNCAGCTAATTGTGGGNAAAGTNCTTCTAATACTATTTTCTCTTTGGCTTCTTNNNNAATTTCCATGCCTTTCAACTTAGNNNTNAAANNACTANCATACTTNC
  3   1   2       bld Ga18      in                      xlk121p10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANCTNGCCCTTGANATGAGNTNNCCACCTACNNGAAACTGCTGNAAGGNNAGAGAGCAGNCTGGNATCAGGCTTCAGAACCTAAGTANTCAGNCCAAGACAGTATCNGGTNTTTCNAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTANTGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNNGGNGNCTACTCTTACTCCAGCANTGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCNNNTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCT
  3   1   2       bld Ga18      in                      xlk121n17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TNAGATCNNNCCTACAGGAANCTGCTGGAAGNANANNNGANNAGNCTGNANTCAGGCTTTCAGNACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGNGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGNGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNNATTTTT
  3   1   2       chi Ga18      in                      xlk112m08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGATNNNNNGATNGCCNCCTACANGAANCTNNTGGANGAGAAGAGNGCAGACTGGAATCANNNTTCNNNACNTANNNNTNCAGACCANNNNNNNTATCGGGTGTTTCCAGTGAATCGGGGGTGGCATTNCCAGTGGATTCAGTAANGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGNCGGCGNCNACTCTTACTCCAGCAATGTGANCTCTTTACCANNGGAGACATNCAAGACAAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTC
  3   1   2       bld Ga15 5g3  in                       XL418i04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATATTGAGATCGCCACCTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATTCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTT
  3   1   2       bld Ga18      in                       xlk53m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTGANNNTGAGATNNNCNCCTACAGNAAACTGCNGANGNNANNGAGNAGNCTGNATCAGGCTTTCAGNNCCTAAGTNNTCAGNCCAAGACAGTATCAGGTGTTTCNAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGNGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTANTCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTT
  3   1   2       bld Ga18      in                      xlk115d23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCNNCCTACAGNAANCTGCTGGAAGNNNNANNGAGCAGACTGGAATCANGCTTTCAGNACCTAAGTATTCAGNCCAAGACAGTATCAGGTNTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGANCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNNCTACAACATGTTGNCATTTTTNCNTTNCTCTTT
  3   1   2       bld Ga18      in                      xlk120h09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GANATNAGATNNNNNCTACAGGAAACTGCTGGAAGNANAGAGAGCAGNCTGGAATCAGGCTTTCAGNACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNCNTTNCTNNTTTAAAANAA
  3   1   2       bld Ga18      in                      xlk151o10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCTACAGGNAACTGCTGGAANNAGAAGAGAGCAGNCTGNANTCAGCTTTCAGAACCTAANTNNTCAGNCNAAGACAGTATCAGGTNTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGNCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATNGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNNATTT
  3   1   2       bld Ga18      in                      xlk106n05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANATNAGATNNNNCCTACAGGAAACTGCTNNNNGAGAAGAGAGCAGACTGGAATCAGGCTTTNAGAANCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNNATTTTTNNNTTNCTC
  3   1   2       bld Ga15 5g3  in                       XL498i03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCT
  3   1   2       bld Ga18      in                        xlk8h21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNGAGATCGCNNCCTACANNAAACTGCNNNNGNNAGAGAGCAGACNGNAATCAGGCTTTCAGNNCCTAAGTANTCAGNNNNGACAGTATNNGGTNTTTNCAGTGGATTCGGTGGTGGCATTTCCAGTGGATNNAGTAANGGAGTTTCNAGTGGATTCNGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGNAANNGTAGCATNNTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGNCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCT
  3   1   2       bld Ga15 5g3  in                       XL512k22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTACAGGGAAACTGCTGGAAGGAGAAGAGAGCCAGACTGGAATCAGGCTTTCAGAACCCTAAGTATTCAGACCAAGACAGTATNCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTT
  3   1   2       bld Ga18      in                       xlk52h09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNANCTGNTGGAAGGNNAGAGAGNAGNCTGNANTCANGCTTTCAGAACCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNCGGNGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGNNCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTANTCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNNNNTC
  3   1   2       bld Ga15 5g3  in                       XL482m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTT
  3   1   2       bld Ga18      in                        xlk7l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACCTACAGNAANCTGCNNNANNGAGNAGAGAGNAGACNGGAATCAGGCTTTCAGANCCTAAGTATTCAGNCCAAGACAGTATCAGGTNTTNCNAGTGGATTCGGTGGTGGCATTTCNAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGNNGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTT
  3   1   2       bld Ga15                               XL437f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAGGAAAACTGCTGGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAAACNTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCNAGCAANGTGA
  3   1   2       bld Ga18      in                      xlk124o20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNCCTACAGNNAACTGCTGGNANGAGANGAGAGCAGACTGGAATCAGGCTTTCAGNACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGANTTCGGGGGTGNCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGNCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNNATTTTTNCNTTNNTCTTTAAAA
  3   1   2       bld Ga18      in                       xlk57i13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNCTACAGNAANCTGCTGGAAGGANANGAGAGCAGACTGGANNCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTNGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNNNNNNTCTTNTAAANT
  3   1   2       bld Ga15                               XL491m22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCANGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTT
  3   1   2       bld Ga15      in                       XL497i03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGGAAGGAGAAGAGAGCAGACTGGAATCAGGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGNGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTNGCANTACTCTNTAAAA
  3   1   2       bld Emb9      in                    IMAGE:7973861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTACAGGAAACTGCTGAAGGAGAAGAGAGCAGACTGAATTCAGGTTTCAGAACTTAAGTATTCAGAACAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATAAAGTTCGCCCTT
  3   1   2       bld Ga18      in                       xlk51d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CNNNAGGNAACTGCNNANGNNANGAGANNAGNCTGGANTCAGNCTTTCAGANCTNAGTATTCAGNCCNANGACAGTATCAGNTGTTTCCAGTGGATTCGGTGGNGGCATTNCNAGTGGATTCAGTAATGGANTTTCCAGTGGNTTCGGTGGTGGCTACGGTNGTGGCTACGGCGGCGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTnnnnnCnnnnnnAAA
  3   1   2       bld Ga18      in                       xlk79n11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACTANAGGAAACTGCNNNGNNAGAGAGNAGNCTGNATCAGGCTTTNANANCTAAGTANTCAGACCAAGACAGTATCAGGTNTTTCCAGTNGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCNAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATNGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGANCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTANTCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTCT
  3   1   2       bld Ga18      in                      xlk109j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGNAACTGCNGGAAGNAGNAGAGANNAGNCTGGAATCAGGCTTTCAGAACCTAAGTATTCAGNCNAAGACTGTATCGGGTNTTTNCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGNCTACGGNGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNCNTTNNTCNTTNA
  3   1   2       bld Ga15                               XL408m21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGGAACCTAAGTATTTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTAAA
  3   1   2       bld Ga15      in                       XL506m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAACTGCTGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCT
  3   1   2       chi Ga18      in                      xlk149d18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ANANGNANCTGCTNNAGNGANGAGANNANNCTGGAATCANNNNTTCNNAACCNNAGTATTCANNCNANNCAGTNTCAGGTNTTTCCAGTGGATTCGGTGGTGNNATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCNAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTT
  3   1   2       bld Ga18      in                      xlk149k24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGNAACTGCTGNANGNNNANNNGAGCAGNCTGGAATCAGGCTTTCANNCCTAAGTNNTCAGNCCAAGACAGTATCAGNTNTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGnnTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGANCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTNTNNNTTNNTCNT
  3   1   2       bld Ga15      in                       XL406c04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGGAAGGAGAAGGAGAGCAGACTGGGAATCAGGCTTTCAGGAACCTAAGTATTCAGACCAAGACAGTATCAGGNGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACCATGTTGGCATTTT
  3   1   2       bld Ga18      in                      xlk110i16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANCTGCTGNAAGNAGAAGAGAGCAGACTGGAATCAGGCTTTNAGANCTAAGTATTCAGNCCAAGACAGTATCAGGTGTTTCCAGTGGNTTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTNTNNNTTNCTNNTT
  3   1   2       bld DMZ  5g3  in                         xl334b05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGCNGNAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATTCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATACT
  3   1   2       bld DMZ  5g3  in                         xl260b16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGCNGAAGGAGNAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATACTCTT
  3   1   2       bld Ga18      in                       xlk57g01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTGNAAGNNNAGAGANNNGNCTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCNAAGNCTNTATCGGNNNNTTCCANNTGAATTCGGGGGTGGCNTTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANCGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTT
  3   1   2       bld DMZ  5g3  in                         xl229b13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATACTCT
  3   1   2       chi Ga18      in                       xlk60c11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTGCNGNNGNGAAGAGANNNNNCNGNATCAGNTTTCNNNNCTAAGTNNTCAGNCNANGNNNGTATCAGNTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGNCTACGNNGNNGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATNCAAGACAAGCAANCGTAGCATTTTAGTGAAGNCTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCNCCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTNCATNACTNNNNNNAATA
  3   1   2       bld Ga18      in                      xlk162f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCTGNANGANAGAGAGCAGACNNGAATCAGNCTTTCAGNNCCTAAGTATNNAGACNAAGACANTATCAGNTGTTNNCAGTGGATTCGGTGNTGNNATTTCCAGTGGATTCAGTANTGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNCGNNGNNTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATNCAAGACAANCNNNNNAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANNCATGAGCACCTTAACTCTTGCTGNCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTNCCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCNTTTNAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCCTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTNCANNATGTTGNCATTTTT
  5   1   2       chi Te2N                            IMAGE:7765900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGTGGGCATTCTCTTAAATGACCTTCTGTGGNATGTCCAAGGCTTCTCACTGATCCCTCCCGAAGGTCAACTAAGCGAGTCAGCTATTGGGGCAAGTCTCCATAACATTTCCCTTGGCTCTTGGCATTTCTTGCTTTACCTAGGGTGAAAACACATACTGACATTAGCCCCGCTTATGTCACCTTGTGAGGTTGGGAAGCTAC
  3   1   2       bld Ga15 5g3  in                       XL472g13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTT
  5   1   2       bld DMZ       in                         xl253d05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATT
  3   1   2       bld Ga15      in                       XL519n20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGAGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTT
  3   1   2       bld DMZ       in                         xl287d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAGGAGAAGAGAGCAGACTGGAATCAGGCTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTT
  3   1   2       bld Lmb1      in                    IMAGE:8533051.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAGAGAGCAGACTGGAATCAGGCTTTCAGAACTAAGTATTCAGACCAAGACTGTATCGGGTGTTTCCAGTGAATCGGGGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTCGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATACTCTTTAAAATAAAGTCCCCC
  3   1   2       chi Ga18                             rxlk126f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANGAAAAAGCTACATTGAAGTANNNCTTGNNATTCATTTTTCTTAGGTGTTTNNAGTGNNTTCGGTGGTGGCATTTCCAGTGGATTCAGTNATGGAGTTTNNAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNCGGCGGCTACGGCGGCGNCTACTCTTACTCCAGCAAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCNCCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTNTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNNTNCT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGAGGAGAGAGAGCAGCTGAATCAGCTTCAGACTAGTATTCAGACCAGACAGTTCAGGTGTTCCAGTGATTTCGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTAAAATAAGTCGCCTCTT
  3   1   2       bld Te2                             IMAGE:7206923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCAGACTGGAATCAGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTCTTTTAAAATAAAGTTCCGCCC
  5   1   2       chi Te2N      in                    IMAGE:7765078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGCTTTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTcggtggtggctacggtggtggctacggcggcggctacggcggcggcTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAATGACCTTTCTGTGTTCATGTCCCAGCTTCTCATCTGATTCCTCCCAGAANGCTCACTTAAGCGAGTCAGCTATTGTGGGCAGGTCTTCTATATATTTCTCTTGGGCTCTGGCATTNCATGCCTTCAACTATGTCTANGAATACTACATACTGCATCAGACGTGCTATGTCTCCTTGTGTGATTTGGATGCACA
  3   1   2       bld Ga18                             rxlk150a20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGNAGNCNGATCAGNTTTCANANCNANTNNTCAGACCAAGACAGTNTCAGNTNNTTNCAGNGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGANCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCT
  3   1   2       chi Tail      in                    IMAGE:8542630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATTCCCACTCACGGAATCCTGAGTAGAGCGATGGATCGGCTTCGAACTAGTCGACAAGACAGTACCAGGTTTCAGGAATCGGGGGGCAATTCAGGGATCAGTAATGAGTTCAGTGGAATCGGTGGGGGCTACGTGGTGGCTACGGCGGCGGCTACTCTACTCAGCCATGTGAGCTCTTTACCATGGAGACATCAAGACAAGCAAGCGTAGCATTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTCTCAAAACCATGAGCACTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATTACTTTTTAAATTAAAAGTTCCGCCCTTG
  3   1   2       bld Ga18                               rxlk6l21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGNATTNANGNTTTCANACCTAANNNNTCAGNNCAAGNNAGTATCAGNTGTTNCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAANGGANTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGNGGCTACTCTTACTCCAGCAATGTGAGCTCTTTNCCATTGGAGACATCCNAGACAAGCAANCGTAGCATTTTAGTGAAGNCTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGNNCCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTANTCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGGCATTTTTnnnnnCnnnnnnAAATA
  3   1   2       bld Ga18      in                      xlk126a02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCNGNTTCAGNNCCTAAGTATTCAGNNNANACAGTNTCAGGTGTTTCCAGTGGATTNGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGNNGGNGGCTACGGNGGNGNCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCNAGACAAGCAANNGTAGCATTTTAGTGAAGACTGTGGAGNCCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGANCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTANCCCTTTTTANTCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAGGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTTCTAAGGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTTTNNNTTNCTCNTNNAAA
  3   1   2       bld Emb9 5g3  in                    IMAGE:7975881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAGCTTCAGACNTAGTATCAGACAGACTGTATCGGTGTTCCAGTGATCGGTGTGGCATTCCAGTGATTCAGTAAGGAGTTCCAGTGGATCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTGGGAAAGTGCCTACAACATGTGGCATTTTGCATACTCTTAAAATAAGTCGCCGCCCCC
  3   1   2       bld Ga18      in                        xlk6m23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNTTTCNNNNCNNNGNATTCnnnnnnnnnCAGTNTNAGNNNNTTNCNGTGGATTCGGTNGTGGCATTTCNAGTGGNTTCAGTANNGNAGTTNCNAGTGGATTCGGTGGNGGCTACGGNGGCNGNNTACGGNGGCGGCTACTCTTNCTCCAGCANNGTGAGCTCTTTACCATTGGAGACATNCAAGACAAGCAANCGTAGCATTTTAGTGAAGNCTGTGGAGNCNNNGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAANCCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTANTCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTNCCTACAACATGTTGNCATTTNTNNNNNNTCNTTNA
  3   1   2       bld DMZ       in                         xl253d05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGTGGTGGCTACGGCGGCGGCTACTCTTACTCCAGCAATGTGAGCTCTTTACCATTGGAGACATCCAAGACAAGCAAGCGTAGCATTTTAGTGAAGACTGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAGTCCTCAGATGTTTTCTCAAAACCATGAGCACCTTAACTCTTGCTGGCCCACAGCATGGATTCTGAAAGATGAGCCTCCTTAAAGGCAGAAATCAGAAAGGATATTTGGGTAGATGTCCTACACCCATTCTCACTGTTTACCCCAAGCATGCTATATGTGAAGCAAGCTAGCCCTTTTTAATCCCCCACAGTTCTAAAACGGACATTTGATGGTGCTTTACATAAAAATTTATTTTGAGTCATGGGTGGCCATTCTCTTTAAATGACCTTTCTGTGTTCATGTCCCAAGCTTCTTCATCTGATTCCCTCCCAGAAGGCTCAACTTAAGGCGAGTTCAGCTAATTGTGGGCAAAGTTCTTCTAATACTATTTTCTCTTTGGCTTCTTGTGCAATTTCCATGCCTTTCAACTTAGTGTTGAAAATACTACCATACTTGCAAATTCTAGCACCGTGCCTTATTGTCCATCCTTTTGTGATGGATTTTGGGAAAGTGCCTACAACATGTTGGCATTTTTGCATACTCT
  3   1   2       bld Ga15      in                       XL416h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAACCTAAGTATTCAGACCAAGACAGTATCAGGTGTTTCCAGTGGATTCGGTGGTGGCATTTCCAGGTGGATTCAGTAATGGAGTTTCCAGTGGATTCGGTGGTGGCTACGGCGGCGGCTACGGCGGCGGCTACTCTTACTCCAGCA