Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-PBX0005C08.5                         20 END     2           0       10                Hypothetical protein LOC549427 [Xenopus tropicalis]
     2   1.0    0Xl3.1-IMAGE:4055037-IMAGp.5                 5 END     2           0       40                protein inhibitor of activated STAT, 3 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl237l10.3                           91 PI      78        483     1215                (no blast hit)
     4   0.0    0Xl3.1-XL185g04.5                            6 PI      92        482      651                translation initiation factor eIF4A I [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012767102 Xl3.1-xl317l02.3 - 708 ESTs
                                                                       ....-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl317l02.3                                                                                                                                                                                         CTCCGAGGCCTCCCTACCTGCTCAAAGAACGTCCCCTGAGCCCCACTGCGTTAGCCAATCAGTAGCGAATGAGGCGGAGCCAGCAAGAGGCTATATAAGGGACGGTTCACCGGCTGGTTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGACGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATGAACGTGGCAGACCTTATCTAAACCTCCCGCCGGAGGGGCAGAAAAAAATGAAAAAAAAAACAGAAAAAAGCATAAAAAAAATAAAAAAAAATGAGCCCAAGGTTTCTTTGGGGCATCAGCTGAATGGGGGTGTAGAGCATTTACCGCACAGCCCTGTAACGAGTGGGCGTGGCCTCCGCTCCCTGTGACATTAACTGATTCCAATAAATGTTATTTTGAGGTATTGTGGCCGTAATACGCATTCGTGGTTTCTTTCTGAAGTTAACACTAACGGCACTTTTCCCACCAAATCAGTGGACCAAAGTCCCCAGCTCATCCCTTTAAGATCTGGCAGCTCAATGTGGTTTTTTTTTCTTTTTTCTTTTTTTTTACAAAACTCCCCAAAATTTAAACATTTTATTTTGCTTTTTCTGATAGTATTTATTGAATAAAAATTTTTTCAACATAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012684954                                                                                                                                                                                               GGCCTCCCTACCTGCTCAAAGAACGTCCCCTGAGCCCCACTGCGTTAGCCAATCAGTAGCGAATGAGGCGGAGCCAGCAAGAGGCTATATAAGGGACGGTTCACCGGCTGGTTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGACGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATGAACGTGGCAGACCTxATxTAAACCTCCCGCCGGAGGGGCAGAAAAAAATGAAAAAAAAAACAGAAAAAAGCATAAAAxxAAxAxAAAAAAATGAGCCCAAGGTTTCTTTGGGGCATCAGCTGAATGGGGGTGTAGAGCATTTACCGCACAGCCCTGTAACGAGTGGGCGTGGCCTCCGCTCCCTGTGACATTAACTGATTCCAATAAATGTTATTTTGAGGTATTGTGGCCGTAATACGCATTCGTGGTTTCTTTCTGAAGTTAACACTAACGGCACTTTTCCCACCAAATCAGTGGACCAAAGTCCCCAGCTCATCCCTTTAAGATCTGGCAGCTCAATGTGGTTTTTTTTTCTTTTTTCTTTTTTTTTACAAAACTCCCCAAAATTTAAACATTTTATTTxxxTTTTxxxxATAGTATTTATTGAATAAAAATTTTTxxAxxxxAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                              3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     9     4    13     6    21    16    45   203   251   237   296   256   304   266   317   273   320   270   321   274   323   275   326   277   327   269   327   281   329   284   333   284   334   325   334   318   333   326   333   324   334   332   339   319   340   333   343   329   344   276   347   326   348   334   348   335   352   332   354   337   355   338   355   338   355   336   360   337   359   339   361   297   364   342   372   351   375   359   382   358   384   328   390   354   395   382   409   375   416   363   417   362   419   396   429   384   432   317   432   397   441   380   449   402   456   398   455   397   455   378   456   380   460   389   466   377   459   310   435   312   435   301   415   258   384   234   368   221   351   205   337   208   312   201   298   213   300   207   302   201   294   211   292   209   289   204   281   200   278   200   275   199   269   203   267   190   264   201   267   206   261   211   261   213   266   213   267   216   269   219   269   186   272   205   275   196   275   210   274   205   275   206   276   207   277   222   288   216   291   220   292   223   292   219   295   221   295   213   296   221   298   204   300   191   296   176   247   155   216   136   203   116   198   118   181    86   165    50   159    55   155    64   154    64   151    59   151    59   150    59   158    63   158    54   149    56   148    48   137    54   123    48   117    53   112    48    95    46    94    47    93    49    93    49    92    47    93    50    92    47    90    44    89    40    89    31    89    25    88    27    87    19    68    11    50    10    38    10    33     8    26     6     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAAAAATGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTTCCCACCAAATCAGTGGACCAAAGTCCCCAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCTGGCAGCTCAATGTGATTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                     A--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                         ---------TG-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C-----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------GG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A--------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -G-C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G-----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------TT----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             C--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------G--C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A---------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C-----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------GC-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------CG-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G--G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T-A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                               BLH ATG     139    1126                                                                                                                                                                                         
                                               BLH MIN     139     340                                                                                                                                                                                         
                                               BLH OVR     139     129                                                                                                                                                                                         
                                               CDS MIN     139      70                                                                                                                                                                                         
                                               EST CLI     133      70                                                                                                                                                                                         
                                               ORF LNG     139      10                                                                                                                                                                                         
  5   1   2       chi Thy                             IMAGE:8550850.5p GGAAAGCTATTTGAGAGTCATCGCTTCGAATTCGTCCCGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTAAGTACTGACTGTTGCTATGGGACAAAGTTGTAACACTCCTGTTGCTATGGGACAAATTCGTAACACTCGGGAGCATGCTCAGTAGGGGCTCCTGGGAAATGTACCAATTTAGAGAGCCGAATTCATAGCATTTAGTAGGAAGCACTTGGGTGTTAGTTTTGTATTGGACACTAAGTATATGGTTTGTGCCTATCCTTAAATTGCTAGTTCTGAGCCTCATTACCAATCCTTTTTGTGCAATTTGGGGTGAGTGATGTCATACCTGTTGCCCTTGTAGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGCGGTACCTCTCCCCAATACATAAAGATGTTTGTGCTGATGAGCGATGAGATGTGAGTAGAGCTTCAGATCAATCTATGAATATCAGAGCTCAGCAGTATGCCAGTGGTCTGCTCTCAGCCACATGCTGCGACTGCTGGAGGTGACAGAGTCATGCGGACTCGATCTGGTCAAGGAACTGAACTTGAGTAGCGTCATAGTCAGCGAGAGTGACTGACGCCTGTACTCAGAACTGTACTACAGGCGCTATC
  5   1   2       bld DMZ       in                         xl296n07.5p                                         GAGATCTCTGCATGACAAGGGGAGAGCTTGCAGTCGTTGGGGGCTGTCCTTCTCTTCCCCGATCTGCCAATCAGGATCCGAGCCGGTCAGACAGGCCTGTAAGGCCCACCCCGTTATTGCATAGCAGTTGTGGCAGCCAATCGACTCCGAGGCCTCCCTACCTGCTCAAAGAACGTCCCCTGAGCCCCACTGCGTTAGCCAATCAGTAGCGAATGAGGCGGAGCCAGCAAGAGGCTATATAAGGGACGGTTCACCGGCTGGTTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGG
  5   1   2       bld DMZ       in                         xl275f01.5p                                         GAGATCTCTGCATGACAAGGGGAGAGCTTGCAGTCGTTGGGGGCTGTCCTTCTCTTCCCCGATCTGCCAATCAGGATCCGAGCCGGTCAGACAGGCCTGTAAGGCCCACCCCGTTATTGCATAGCAGTTGTGGCAGCCAATCGACTCCGAGGCCTCCCTACCTGCTCAAAGAACGTCCCCTGAGCCCCACTGCGTTAGCCAATCAGTAGCGAATGAGGCGGAGCCAGCAAGAGGCTATATAAGGGACGGTTCACCGGCTGGTTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAA
  5   1   2       bld Te2N 5g                         IMAGE:7767125.5p                                                                                                                                                                                 CCAATCGACTCCGAGGCCTCCCTACCTGCTCAAAGAACGTCCCCTGAGCCCCACTGCGTTAGCCAATCAGTAGCGAATGAGGCGGAGCCAGCAAGAGGCTATATAAGGGACGGTTCACCGGCTGGTTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAAAGGCGCTACCTGTCCCCTNATACATAAGATGTTGTTTTGGATGAGCAGAGAGATGTGAGTAGAGTTTCAGGATCAATCTATGATTATTCAGAGCTCACAGTACGCTCGGTGGTCTGCTT
  5   1   2       bld Ga18      in                      xlk160g19ex.5p                                                                                                                                                                                        CAATCGACTCCGAGGNCTCCCTACCTGCTCAAAGAACGTCCCCTGAGCCCCACTGCNNNNNNNTCAGTAGCGAATGAGNNNNANNCAAGAGGNTATATAAGGGANGGTTCACCGGNTGGNTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAAAGNCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGNGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGTTTGAGAAANCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGNTATGATGTCATTGCTCAGGNTCAGTCTGGAACTGGGAAAACAGCCACGNTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGNGTTGGNCCCAACCCGTGAGCTGGNCCAGNAGATCCAGAAAGNAGNTATGGNCCTGGGAGANTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGNACCAACGTGAGGGCTGAAGNACAGAAGCTGCAGNCGGAGGCTCCCCATATAGNCGTGGGNNCCCCGGGNAGAGNGNTTGANATGTTGAANAGGNGCTACCTGTCCCCTAAATACATAAAGATGNTTGNTTTTNGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGNTCAAATCTNTNATATATTCCAGAAGCTCAG
  5   1   2       chi DMZ  5g3  in                         xl314c12.5p                                                                                                                                                                                                                           CCCAGCCTCCCTTTGCATTAACCAATCAGTAGCGTACGGGGCGGAGCCAGCAAGAGGCTATATAAGGGACGGTCACCGGCTTGTCAGAAGCTTCCGCTGTGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCANATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGT
  5   1   2       bld Int2 5g                         IMAGE:8824480.5p                                                                                                                                                                                                                                                                                   CCCCGACTTGCGTGCCCGTAGGAGCCCCCCGATTCGAATTCGTCCCAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTTGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCATATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGCTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGATGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACATCCCCACAAGGCCGTTTATTCTTTTATTCA
  5   1   2       bld Em10 5g                         IMAGE:8321613.5p                                                                                                                                                                                                                                                                                      AGGAACTATAGAACAAGTTTTCGGTCCGGAATTCCCGGGATGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTTCAAGGATCAAATCTATGATATATTTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACTCATGCCTTGCCGACGTGCTGGGAAG
  5   1   2       chi Int2                            IMAGE:8824250.5p                                                                                                                                                                                                                                                                                       TCTCTGGGACTGATAACTTATTAATTACAAATTCAAATTCGCCCATTAATTCTATATCGCGAGAGCCGACCCATAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCCGGTGGTCCTGCTCTCACCCACCATGCCTGCCGACGTGCTGGAGGTGACCAGAAGTTCTTGCGGGACCCTATCCGAATCCTGGATCAAAAGGAGAACCTGATCCCTGGAGGTATTTAGGCAGTTCTACATATTGTGAGCGAGAGGAGTGAAGCTGGAACCCCCCTGTTGACCTGTTACGAGACCCTGACATCCCACCGGGCCGCTATCCTAT
  5   1   2       bld Int2                            IMAGE:8822679.5p                                                                                                                                                                                                                                                                                             GCCCCCCTTCGTTACCGAACGGAGTTCCACCACTTAAAATTCGTCCCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAGAAGACTGACCCTGGAGGTATTAGCAGTTCTACATTAATGTTGAGCGAGAGGATGAGCTGGACACGGCTCTGTGACCTGTACGGACCCTGACATCAACAGCGTTATCTTTATAACACTCGCCGGAGGGGACTGGCTAACGAGAAGATGCACGCGAGGGAC
  5   1   2       bld Int2 5g                         IMAGE:8821806.5p                                                                                                                                                                                                                                                                                             TTTAAAGATATAAAGGAAGTGACTCCTATAAAGAATTCGTCCCCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGACTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGTGACCAAGAAGTTCATGCGGGACCCTATCCGATCCTGGTCAAAAAGGAGAACTGACCCTGGAGGGTATTAGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACATCACACAGCCGTTATCTTTATAACACTCGCGAGTGAACTGGCTACGGAAAGATGCAGCGAGGACTCCCTGTCTCTGGCTGCCGGCGACTTGGACACAAGGGACCGGGAC
  5   1   2       chi Ga18      in                      xlk124a05ex.5p                                                                                                                                                                                                                                                                                             GANCTGAAGGCATGGAGCCTGATGGTGTCATTGAGGTAATGTATCTAATGTGACTATTTATAGAAATATACTGGTGTGTGTGACTGGGATTAACTCTTCCCTTCTCTCTGCAGNNNNTTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGNTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGNCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGNACCCTATCCGAATCCTGGNGAAAAANGANGAGNTCACCCTGGNGGT
  5   1   2       bld Int2 5g                         IMAGE:8531337.5p                                                                                                                                                                                                                                                                                               AATNGGNNCCTGTGTTANNGAAGATGCTCGATAAAATTCGTCCCCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCCTATCCGAATCTGGTGAAAAGGAAGACTCACCTGGAGGTATANGCAGTCTACATTATGTGACGAGAGAGTGGAGCGGAACCTCTGGACTGTACAGACTGAATCACCAGCGTTACTTACACCTCCCGAAGTGATGCTACGAAA
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db27h08.y1                                                                                                                                                                                                                                                                                                      gggtcgacccacgcgtccgcggacgcgtgggtGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGACTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCCGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTNTGTGCTGGATGAAGCGGATGAGAATGTGAGTAGAGGCTTCAAAGATCAAATCTATGA
  5   1   2       bld Int2                            IMAGE:8528817.5p                                                                                                                                                                                                                                                                                                      AAGNNNNNTCATGATTATTTGAGGTGCTCGATTGAATTCGTCCCCGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCCTATCCGATCCTGGTGAAAAGGAAGAGCTCACCTGNAGGTATANGCAGTCTACATTATGTGAGCGAGAGAGTGAGCTGACACCTCTTGACTGTACAGACTGACATCCACAGCGTATCTTTCACCTCGCGAAGTGATGCTACGA
  5   1   2       bld Te2  5g                         IMAGE:7211510.5p                                                                                                                                                                                                                                                                                                       GTACCCGCGAATTCCCCGAGGATGAAGAATGGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAGAGCTCACCCCTGGAGGTATTAGGCAGTTCTACATTATGTTGAGCGAGAGGAGTGGAGCTGGACACCTCTGTGACTTGTACGAGACCTGACANCACACAGGGCGTTTCTTTTCAAACCTTCCCCCGGAAGGGGACTGGCCTAACGGAAAAAAGCCTGCAAGGGACTCCCTGTCTCTGGCCGGCCGGGAAAACTGAAACAAGGGG
  5   1   2       bld Ga15 5g                            XL481n04ex.5p                                                                                                                                                                                                                                                                                                       CGGCTGGTTAAAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCANACGAGATGTTGAGTANAGGTTTCAAGGATCAAATCTATGATATATTCCANAANCTCANCANTAACGCTCANGTGGTCCTGCTCTCANCCACCATGCCTGCCCGACGTGCTGGAGGTGACCANAAAGTTCATGCGGGACCCTATCCNAATCCTGGNGAAA
  5   1   2       bld Te2  5g                         IMAGE:7211182.5p                                                                                                                                                                                                                                                                                                         TCCCCGGGAATTNNCCCGGGATGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCCTGGAGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAAGAGTGGAAGCTGGACACCTCTGTGACTTGTACGAGACCTGACAACACACAGGCCGTTATCTTTACAACACTCGCCCGGAAGTGGAATGGCCTACCGAAAAAATGCATGCAAGGGGATTTACTGCCTTTGCCCTGGAGGGAACATGGGACCCAAAGAAC
  5   1   2       bld Ga15      in                       XL466d24ex.5p                                                                                                                                                                                                                                                                                                              CGACCCACGCCGCTCCGGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAA
  5   1   2       bld DMZ  5g                              xl251n16.5p                                                                                                                                                                                                                                                                                                                TNNNTTCNNATTCNGCACGAGGGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAA
  5   1   2       bld Brn2 5g                          Brn2-za42b12.5p                                                                                                                                                                                                                                                                                                                 AAAGCTTCCGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGC
  5   1   2       bld Spl  5g3  in                    IMAGE:8464043.5p                                                                                                                                                                                                                                                                                                                  GAGNTCCATCGATAGAATTCGTCCCCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGNACCAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCAC
  5   1   2       bld DMZ       in                         xl298d11.5p                                                                                                                                                                                                                                                                                                                  TCGATTCNAATTCNGCACGAGGCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCG
  5   1   2       bld Tail 5g                         IMAGE:8544720.5p                                                                                                                                                                                                                                                                                                                   GAGAGTCATATAAATATTCGTCCCCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTCATGCGGGACCCTATCCGAATCCTGGTGAAAAGGAAGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073039.5p                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAATCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGTTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGC
  5   1   2       bld Em10 5g                         IMAGE:7979117.5p                                                                                                                                                                                                                                                                                                                    TCGGTAGGGATTCCCGGGATCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCAGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCTATCCAAATCTGGCAAAAAAGAAGACTGACCTGGAGGGTATTAGCGTCTACTTATGTTGACGAAGGATGGAACTGACCCCTCTTGACTGTACAACTGAAACCCCGGCTTACTTAACACCCGGAGTGACGCAACGAAACA
  5   1   2       bld Em10 5g                         IMAGE:7983597.5p                                                                                                                                                                                                                                                                                                                     CCCGGGATCTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGAAGAGCTCACC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174576.5p                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGAGAATGTCTGCGAGCTACGAGAGCCGACCCAAAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGATTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCATAAAGTTATTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGGATTGGGGGCACCAACGTGAGGGGC
  5   1   2       bld Ooc1      in                     Ooc1-db33b04.y1                                                                                                                                                                                                                                                                                                                       GGGTCGACCCACGCGTCCGGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGGACCTCTCCGCCAAATACATAAAGATTTTTG
  5   1   2       bld Emb9 5g                         IMAGE:7974983.5p                                                                                                                                                                                                                                                                                                                        CGGATTCCCGGGATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAACCCACATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCCTATCCGAATCATGGTGAATAAGGATAAGCTCCCCCTGGA
  5   1   2       bld DMZ  5g3  in                         xl241a10.5p                                                                                                                                                                                                                                                                                                                        CCGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGT
  5   1   2       bld Eye1 5g                         IMAGE:7019874.5p                                                                                                                                                                                                                                                                                                                         TTCTGAAGAAGATGTCTGCGAGCTACTTAACTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCTTCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAAGCTGGGACACACTCCTGGTGACTTTGTAACGAGACCCCTGGACAAATCCACACAGGGCCCGTTTATTCCTTTTATTCAAACCACCTTCGCCCCGGGAAAGGGTGTC
  5   1   2       bld Ga15      in                       XL464g04ex.5p                                                                                                                                                                                                                                                                                                                         CGTCCGGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAG
  5   1   2       chi Emb9                            IMAGE:7975151.5p                                                                                                                                                                                                                                                                                                                         CCGGGAGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGGCATGGGGGGCACAAACGTGAGGGCTGAAGTACAAAAGCTGCAGTCGGAGGCTCCCCATATAGTCTTGGGCACCCCGGGCAAAATGTTTGACATGTTTAACAGGCGCTACCTGTCCCCTAAATaaaaaaaattttttttttGAAGAAACAAACCAAATTTTAATTAAAGGTTTCAGGACAAATTCTGAANTATTTCCAAACCCTACCAAAACCCTCAGGGGGTCTGTTTTAAACCATGTCTTGCGAATGGGTGGGGTGACCAAAATTTTGGGGCCCCTT
  5   1   2       bld Emb9 5g                         IMAGE:7977829.5p                                                                                                                                                                                                                                                                                                                         CGCACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATTCCGAAATCCTGGTGAAAAAGGAAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328826.5p                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACC
  5   1   2       bld Eye1                            IMAGE:6959192.5p                                                                                                                                                                                                                                                                                                                          CAAGGATGAATGTCTGGCGAGCTACGATTGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTTGGAGGGTATTTNGGCAGTTCCTACATTAATGTTTGAACCGAGAGGAAGTGGAAACCTGGAACACGCCTCTGGTGAACCTGGTACGAGAACCCTGGAACAATCACCACCAGGGCGGTTTATCCTTTTATAAAA
  5   1   2       bld Ga15      in                       XL492n13ex.5p                                                                                                                                                                                                                                                                                                                           CACTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCT
  5   1   2       bld Em10                            IMAGE:7980746.5p                                                                                                                                                                                                                                                                                                                           GTTTCGGTCCGGAATCCCGGGATCGAAAGTCGACCCAGAGACAATGGACCTGATTGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAACAATAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAGAGCTCCCCTGGAGGTATTAGG
  5   1   2       bld Emb9 5g                         IMAGE:7977227.5p                                                                                                                                                                                                                                                                                                                             CTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTATGTGAGCGAGAGGAGTGGAAGCTGGACACACTTCTGTGACTGTACGAGACCCTGACATTCACACAGCCGGTTATCTTTATCAACACTCGTCAGGATGGTGGAACTTGTGCATAACAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7983045.5p                                                                                                                                                                                                                                                                                                                             GTGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGAACCTAATCGAAA
  5   1   2       bld FaBN 5g                         IMAGE:8076776.5p                                                                                                                                                                                                                                                                                                                             GTGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCAACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTTGGTCAAAAGGAAGAACTGACCTGGAGAGTATAAGCAAGTCTC
  5   1   2       bld Tail 5g                         IMAGE:8541999.5p                                                                                                                                                                                                                                                                                                                             CTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGAAGAGCTCACCTGGAGGGATTANGCAGTTCTCTTTATTGTGACGAAAGGAGTGGAGCTGACCCCTCTTGACTGTAGAGACCTGACATCACAGGCGTATCTATCA
  5   1   2       bld DMZ  5g                              xl286e16.5p                                                                                                                                                                                                                                                                                                                             CTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGT
  5   1   2       bld DMZ  5g                              xl284f16.5p                                                                                                                                                                                                                                                                                                                             CTGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCANACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCANGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGT
  5   1   2       bld Emb1 5g                         IMAGE:6634613.5p                                                                                                                                                                                                                                                                                                                              TGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGGAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGACCGAGAAGAGTGGAAACTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGGCCGTTATCTTTATCAACACTCCCCGGGAAGTGGGACTGGGCTAACGGAAAAAGAAT
  5   1   2       bld Ga15      in                       XL430c22ex.5p                                                                                                                                                                                                                                                                                                                              ANGAATGTCTGCGAGCTACGANAGCCGACCCANAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGANAGCAATTGGAATGAAATTGTGGATAGCTTTTGATGATATGAGTCTATCAGGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGANAAACCCTCTGCCATCCNGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGNTTGCCATCTCCATTCTCCNACAGATAGAGCTGGATATGAAAGCCACNCANGCCCTGGNGTTGGCNCCNACTCGTGAGCTGGCCC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328197.5p                                                                                                                                                                                                                                                                                                                              TGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGA
  5   1   2       bld Em10 5g                         IMAGE:8321711.5p                                                                                                                                                                                                                                                                                                                              TGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAAGTGACCAAAAAGTTCATGCGGGACCCTATCCGAAT
  5   1   2       bld Em10 5g                         IMAGE:8319855.5p                                                                                                                                                                                                                                                                                                                              TGAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCNAGAAGTTCATGCGGGACCCNTATCGAATCNTGNTCAAAAAGGAGACTGACCCTGGAGGGTATAGCAGTCTACATTATGTTGACGAGAGAGTGAAGCTGACACCTCTT
  5   1   2       bld Int2 5g                         IMAGE:8531095.5p                                                                                                                                                                                                                                                                                                                              TGAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTCATGCGGGGGACCTATCGAATCTGGTGAAAANGAGAGCTCACCTGGAGGGTATAGCAGTCTACTTATGTGAGCGAAGATGGAGCTGACCCTCTGTGACTGTACAGACTGACATCCCAGCGTACTTACACCTCGCGAGTGATGCTACA
  5   1   2       bld DMZ       in                         xl291c10.5p                                                                                                                                                                                                                                                                                                                              GAAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCG
  5   1   2       bld Ga15 5g3  in                       XL443n02ex.5p                                                                                                                                                                                                                                                                                                                               TCCGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGA
  5   1   2       bld Ga15      in                       XL493j14ex.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTTCATGC
  5   1   2       bld Emb9 5g                         IMAGE:7976626.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGAAAGACTGACCCT
  5   1   2       bld Emb9 5g                         IMAGE:7974372.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCACCATGCCTGCCGACTTGCTGGAGGTGACTAGAATTTCAGCGGGACCCTTCCGAATCTGGTCAAAAGGAGACTGACCTTGAGGTATAGCAATTCTAATTATGTTATGAGAGATGGAACTGACACCC
  5   1   2       bld Emb9 5g                         IMAGE:7975818.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATANAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAAGTGACCAAAAAGTTCATGGGGGACCCTATCCGAATCCTGTTGA
  5   1   2       bld Em10 5g                         IMAGE:7979657.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCCCATGCCTGCCGACGTGCTGGAGGTGACAAAAAGTCATGCGGGACCCTATCGAATCTGGTGAAAAAGAGAGCTCACCTGAGGTATTAGAGTCTACATATGTGAGCAGAGAGTGAGCTGACCCTCTTACTGTACAACTGAATCCCAGCGTTCTATACCTCCGGAGGATGCTAGAAATCGCAGATCTGCTGCTCG
  5   1   2       bld Emb9 5g                         IMAGE:7977566.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCTCAAATACATAAAGATGTTTGTGCTTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCATAAGCTTCAGCAGTAATGCCCAGGTGGTCCCTGCTCTCAGCCACCATGCCTGCCGACTTGCTAGGAGGTGAC
  5   1   2       bld Emb9 5g                         IMAGE:7978518.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAAT
  5   1   2       bld Ov1  5g3  in                    IMAGE:8329068.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAGGAAGAACTGAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8329167.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTTTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGNACCAGAAGTTCATGCGGGACCCTATCCGAATCCTG
  5   1   2       bld Em10 5g                         IMAGE:8319577.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTCATGCGGGACCCTATCCGAATCCTGGTCAAAAGGA
  5   1   2       bld Spl  5g                         IMAGE:8462499.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCTATCCGATCCTGNTGAAAANGAGAGCTCACCTGNAGGTATANGCAGTCTACATTATGTGAGCGAGAGATGAAGCTGACCCTCTGTGACTGTACAGACCTGACATCCCAGCGTT
  5   1   2       bld Spl  5g                         IMAGE:8461809.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTCATGCGGGACCCTATCCGAATCCTGGTCAAAAGGGAGAACTGACCCCTGAGGTATANGCAGTCTACATTATGTGAGCGAGAGAGTGGAGCTGACCGCTCGTGACG
  5   1   2       bld Spl  5g3  in                    IMAGE:8463900.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGA
  5   1   2       bld DMZ       in                         xl336d09.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAA
  5   1   2       bld DMZ  5g                              xl230d07.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTG
  5   1   2       bld DMZ  5g                              xl222j24.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACANGCGCTACCTGTCCCCTAAATACATAAANATGTTTGTTTTGNATG
  5   1   2       bld DMZ       in                         xl280o23.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAA
  5   1   2       bld DMZ       in                         xl319a19.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGT
  5   1   2       bld DMZ  5x3  out                        xl323f21.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGT
  5   1   2       bld DMZ  5g3  out                        xl281h11.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGNTTTGAGAAACCCTCTGCCATCCNGCANCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCANTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAANCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCA
  5   1   2       bld DMZ       in                         xl283b18.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGA
  5   1   2       bld DMZ  5g                              xl297l13.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATC
  5   1   2       bld DMZ  5g3  in                         xl288j11.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTANAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTAATGCCCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAG
  5   1   2       chi DMZ       in                         xl304h02.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTAAGTGCACCCTATCCCTAAATTCCTCATGGATATTAGATCCTGCTTCTCCAGCCAATAAGACTGTACAACCCTCTTACAA
  5   1   2       bld DMZ       in                         xl312b15.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAA
  5   1   2       bld DMZ       in                         xl299l15.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAA
  5   1   2       bld DMZ  5g                              xl254e03.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAA
  5   1   2       bld DMZ  5g3  in                         xl279i12.5p                                                                                                                                                                                                                                                                                                                               ATCGATTCGCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTG
  5   1   2       bld DMZ  5g3  out                        xl265b21.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTANATAGTTTTGATGATATGAGCCTATCANAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACNAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTANCGCTCANGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAG
  5   1   2       bld DMZ       in                         xl268d17.5p                                                                                                                                                                                                                                                                                                                               GAAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGACCCTATCCNA
  5   1   2       bld Tbd2 5g                         IMAGE:3200050.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCATAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTAATGCCCAGGTGGTCCTGCTCTCAACCACCATGCCTGCCGACGTGCCTGAGGTGACCAAGAAGT
  5   1   2       bld Gas8 5g3  in                    IMAGE:3516793.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCATTGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAACAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGTGGGCACCAACGTGAGGGCTGAAGTACAG
  5   1   2       bld Brn1 5g                         IMAGE:6956696.5p                                                                                                                                                                                                                                                                                                                                TGGATTGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAAGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGGAGTGACCAAAAAAGTCATGCGGGGACCCTATCCGAAATTCCTGGTGAAAAAAGGAAAGAGCTCAACCCTGGAAGGGTATTAGGCCAGGTCTTACTTTAATGTTTAACCCAAAAGGGAATGGAAAACTGGGACACACCTCCGGTGGAATTGGTACGAAAAACCCTGAACAATCCCACCAAGGGCCGGTTATTCTTTTATTCAAACAccccccccccggaaaagggggggaactgggcttaaacgggaaaaaaaaaaTAGCCCTTGGCCCAA
  5   1   2       bld Ga15 5g3  in                       XL428a07ex.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAANAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGANCNANAGGANTGGAANCTGGACACACTCTGTGACTTGTACNANACCCTGACNATCACACANGCCGTTATCTTTATCAA
  5   1   2       bld Ga15 5g                            XL450i16ex.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGA
  5   1   2       bld Ga15      in                       XL452n09ex.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCC
  5   1   2       bld Ga15      in                       XL456i06ex.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTG
  5   1   2       bld Ga15 5g                            XL466h06ex.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGANCGAGAGGAGTGGAANCTGG
  5   1   2       bld Ga15      in                       XL496g15ex.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCANAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGGACCCTATCCGAATCCTGGTGAA
  5   1   2       bld Te2  5g3  in                    IMAGE:7391162.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAGGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACCTGCTGGAGGTGACCAAAAAGTTCTGCCTGAACCTATCCGAATCCCGGTGAAAAAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764483.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACTT
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764506.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGA
  5   1   2       bld Te2N 5g                         IMAGE:7767714.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAA
  5   1   2       bld Em10 5g3  in                    IMAGE:7981550.5p                                                                                                                                                                                                                                                                                                                                GAAGATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCNAGAAGTCATGCGGGACCCTATCCGAATCCCTGTCAAAAGGAAGAACTGACCCTGAGGGTATANGC
  5   1   2       bld Em10 5g                         IMAGE:7979203.5p                                                                                                                                                                                                                                                                                                                                GAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTCATGCGGGACCTATCCGAATCTGGTGAAAAGGAGAGCTCACCTGGAGGGTATAGCAGTCTCATTATGTGAGCGAGAGAGTGAGCTGACCCTCTGTACTGTACAGACTGACATCCCAGCGTATCTACACCTCGCGAGTGATG
  5   1   2       bld FaBN      in                    IMAGE:8076035.5p                                                                                                                                                                                                                                                                                                                                GAAGATGTCTGCGAGCTACGAAAGTCGAAACAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCTATCCGAATCTGGTGAAAAAGAGAGCTCCCCTGGAGGTATTAGCAGTCTACATTATGTGAGCGAGAGAGTGGAGCTGAC
  5   1   2       bld Ga18      in                      xlk107p17ex.5p                                                                                                                                                                                                                                                                                                                                TGAAGAANGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNTNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCNCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTNCCGACGTGCTGGAGGTGACNNAGAAGNTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGA
  5   1   2       bld DMZ       in                         xl318l02.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTANAGGCTTCANGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCNAGGTGGTCCTGCTCTCAGCCACCATGNCTGCCGACGTGCTGGAG
  5   1   2       bld DMZ  5g                              xl313o10.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAA
  5   1   2       bld DMZ       in                         xl317l02.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGA
  5   1   2       bld DMZ       in                         xl275m10.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGANCCTATCCGAATCCTGGTCAAA
  5   1   2      seed DMZ       in                         xl273g17.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAANAACTGACCCTGGAGG
  5   1   2       bld DMZ  5g                              xl276m10.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCANGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAANGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGANGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTG
  5   1   2       bld DMZ  5g                              xl233c17.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCC
  5   1   2       bld DMZ  5g3  in                         xl258g22.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCA
  5   1   2       bld DMZ       in                         xl341n15.5p                                                                                                                                                                                                                                                                                                                                AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAA
  5   1   2       bld Tbd1 5g                              AW764947.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAANCTGCAGTCAGAGGCTCCCCATATAGTCATGGGCACCCCAGGCAGAGTGTTTGACATGTTGAACAAGCGCTACCTGTCCGCTAAATACATAAAGATGTGTGTTGTGGATGAAACAGACGAGATGTTGAGTAGAGTTTCAAGGATCAGATCTATGATATATTGCAGAAGCTCAGCAGTAACAC
  5   1   2       bld Tbd1 5g                              AW765412.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCTGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCTGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCTCCCAAATACATAGAAGATGTTTTGGTGCTGGGATGAAAGACTGAA
  5   1   2       bld Tbd1 5g                              AW871716.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTTCCCCAAATACATTAAGATGTNTGTGCTGGATGAAGCAAATGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048282.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACTGTCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048107.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4958983.5p                                                                                                                                                                                                                                                                                                                                 GACGCGTGGGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCA
  5   1   2       bld Sp1  5g                         IMAGE:5511273.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAANAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAANGAAGAGCTCACCNTGGAGGGTATTAGGCAGTCTACATAAATGTGAGCGAGAGGAGTGGAGCTGGACCACTCTGTGACTGTA
  5   1   2       chi Kid                             IMAGE:7012372.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCATAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAGGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAGTGTATGATGATTTCCAGAAGCTCAGCGATAAGGGCTCAGGTGAGCTTGTGTgtgcaggattggtgcggaggtggaaaaggtagtaggggtggggtggtggagggggatggtgagtggaagggaggaggtaagtagtgggttttggggGGATTT
  5   1   2       bld Kid  5g                         IMAGE:7011148.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCA
  5   1   2       bld Ga15 5g                            XL426c15ex.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAANAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTANT
  5   1   2       bld Ga15 5g3  in                       XL427d10ex.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAAGGAAGAACTGA
  5   1   2       bld Ga15 5g3  in                       XL444n17ex.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGAGCGA
  5   1   2       bld Ga15 5g3  in                       XL512c06ex.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAAC
  5   1   2       bld Ga15      in                       XL516i12ex.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAA
  5   1   2       bld Tail 5g                         IMAGE:8546207.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAAGTGACCAAAAAGTCATGCGGGACCCTATCCGATCCTGGTGAAAAGGAGAGCTCACCTGGAGGTATTAGCAGTCTACATTATGTGACGAGAGATGGAGCTGACCCTCTGTACTGTACAACCTGACATCCCAGCGTATCTACAC
  5   1   2       bld Ga18      in                        xlk2o04ex.5p                                                                                                                                                                                                                                                                                                                                 AAGAATGTCTGCGAGCTACGAAAGNCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACNNTCAGGTGGNCCTGCTCTCAGCCACNATGCCTGCCGACGTGCTGGAGGTGANCAAAAAGTTCATGCGGGANCNTATNCGAATCCTGGTGAAAAAGGAAGAGCTCA
  5   1   2       bld DMZ       in                         xl332a23.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGT
  5   1   2       bld DMZ       in                         xl334d22.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGAACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGANG
  5   1   2       bld DMZ  5g                              xl228g20.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATC
  5   1   2       bld DMZ  5g3  in                         xl305b06.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGG
  5   1   2       bld DMZ       in                         xl286i13.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTG
  5   1   2       bld DMZ       in                         xl308b24.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAANAACTGACCCTGGANG
  5   1   2       bld DMZ       in                         xl314g22.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGG
  5   1   2       bld DMZ       in                         xl276o13.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGG
  5   1   2       bld DMZ       in                         xl289c06.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAA
  5   1   2       bld DMZ       in                         xl264f03.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGA
  5   1   2       bld DMZ       in                         xl264o14.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAA
  5   1   2       bld DMZ  5g3  in                         xl240m18.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTTCATGCGGGACCCTATCCGAA
  5   1   2       bld DMZ       in                         xl235f09.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCNAAAAGGA
  5   1   2       bld DMZ  5g3  in                         xl326l09.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAA
  5   1   2       bld DMZ       in                         xl338o15.5p                                                                                                                                                                                                                                                                                                                                 AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAA
  5   1   2       bld Emb4 5g                         IMAGE:4930632.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCCANGTGGTCCTGCTCTCAGCCACCATGGCCTGCCGACGTGCCTGGAGGTGGACAAGAAAGTTCATGGCGGGACCCCTATCCAAATCCTGGGTCaaaaaaggaaaaaCTGGACCCCTGAAGGGGTATTAGGGCAGTTTCTACCTTAAATGGTTAAACCAAAAAGAAATGGGAAACTTGGGAACCCCCTCTGGTGGAACCTGTTACCAAAAACCCTTGAAAATCCACCCCAGGGGCCCGTTATTCTTTTTTATAAAAACACTTCCCCCCGGAAAAGGGGGGGACCTGGC
  5   1   2       bld Te2  5g                         IMAGE:7392042.5p                                                                                                                                                                                                                                                                                                                                  AGATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAGGGAGAGCTCACCCTGGNAGGGTATAGGCAGNTCTACATTAATGTTGAGCGAGAGGAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975811.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCCNGGATCAAATCTATGAAATATTCCAGAAGCTCAGCCATAATGGCCAGGTGGTCCTGCTTTCAGCCACCATGCCTGCCGAATTGCTGGAGT
  5   1   2       bld Emb9 5g                         IMAGE:7977976.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTC
  5   1   2       bld Emb9 5g                         IMAGE:7977899.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCATAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAAGCAGATGAGATGTTTGAGTAGAGGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTTCTTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGGACCCTATCCGATTCCTGGTCAAAAAGGAGAACTGACTCTGGAGGGTATTAGGCAGTCTTCCATTAATGTTG
  5   1   2       bld Em10 5g3  in                    IMAGE:7983170.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGATGTGCTGGAGGTGACCAAAAATTCATGCGGGACCC
  5   1   2       bld FaBN 5g                         IMAGE:8075848.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACATGCCTGCGACGTGCTGGAGTGACCAGAAGTCATGCNGGACCCTATCGATCTGGTCAAAAGGAGACTGACCNTGAGGTATAGCGTCTACATATGTGACGAGAGATGAGCTGACCCTCGTACTGTCAA
  5   1   2       bld Em10 5g                         IMAGE:8319624.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTG
  5   1   2       bld Em10 5g                         IMAGE:8319101.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATC
  5   1   2       bld Spl  5g                         IMAGE:8461056.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTNCAGGATCNAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGATCCTATCGATCCCTGTGAAAAGGAGAGCTCACCTGNAGGGTATAGCAGTCTACATTATGTGACGAAGAGTGAGCTGACCCTCTGTACTGTACAGACTGACATCCCAGCGTATCT
  5   1   2       bld Ga18      in                      xlk145j06ex.5p                                                                                                                                                                                                                                                                                                                                  AGAATGTCTGCGAGCTACGAAAGNCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGNGGNCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTNCATGCGGGNNCCTATCCGAATCCTGGNGAAAAGGAAGAGNTCACCCTGG
  5   1   2       bld Ga18 5g                            xlk64o24ex.5p                                                                                                                                                                                                                                                                                                                                  AGAATGTCTGCGAGCTACGAAAGNCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCNNGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGNCCTGCTCTCAGCCACCATGCCTGCNGACGTGCTGGAGGTGNNCAAAAAGTTCATNCGGNACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCNTGGAGGGTATTAGGCAGTNCTACATT
  5   1   2       bld Ga18      in                      xlk146e15ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATTGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGNGANCNAGAAGNTCATGCGGNACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGNNAGTTCTACATTAA
  5   1   2       bld Ga18 5g3  in                      xlk132d01ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCNNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTNCTGGATGAAGCAGATGAGANNNTGAGTAGAGGCTTCAAGGNTCAAATCTATGATATATT
  5   1   2       bld Ga18      in                      xlk150l07ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCNNANGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATNNCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGNCAAAAAGGAAGAACTGACCCTGGAGGTNTTAGGCAGTNCTA
  5   1   2       bld Ga18      in                      xlk151h03ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNNNTNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTNCATGCGGGANCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGNGGGTNTTNGGCAGTTCTACATTNAT
  5   1   2       bld Ga18 5g                           xlk161n19ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTANGAAAGCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGNNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGANCAAAAAGTTCATGCGGNANCCTATCCGAATCCTNGNGAAAAAGGNAAGAGCTCACCCTGGAGGTATTAGGCAGTTCTACATTAATGNTGAGCG
  5   1   2       bld Ga18      in                       xlk52k11ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGNACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTNNCGACGTGCTGGAGGTGACCAAGAAGTNCATGCGGNACCCTATNCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGNAGGGNNTTNGGCAGNNCTACATTNAT
  5   1   2       bld Ga18      in                       xlk52m15ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNANNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGNNCAAAAAGTTCATGCGGGNNCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTNGAGGTNNTNGGCAGTNNTACAT
  5   1   2       bld Ga18      in                      xlk129n03ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGANNCGACCCAGAGACAATGGACCNGAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGANTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGNCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTNNTGGAGGTGACCAAGAAGTNCATGCGGGNCCCTATCCGAATCCTGGNCAAAAAGNAGANTGACCCTGGANGNNTTNGGCAGTCTACATTNNT
  5   1   2       bld Ga18 5g3  in                       xlk54m24ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNNATNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGNNCCTATCCGAATCCTGGTGAAAAAGGAAGAGNTCACCCTGGAGGTNTTAGGCAGNTCTACATTAA
  5   1   2       bld Ga18 5g3  in                      xlk131o16ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGNCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNNNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGNTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGNTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGNACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGNCACCCCGGGCAGAGTGNNCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTNCTGGATGAAGNGGATGAGATGTTGAGTAGAGGCTTCAAGGNNCAAANCT
  5   1   2       bld Ga18 5g3  in                        xlk3o23ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNNNNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGNTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGNCCTGCTCTCAGCCACCATGCCTGNCGACGTGCTGGAGGTGACCAAAAAGNTCATGCGGNACCCTATCCGAATCCTGGTGAAAAAGGAAGAGNTCACCCTGGAGGTNTTAGNNAGTTCTACATTAATNTTGAGCGANANGNGTGGAAGCTGNANNNACTCTGNNA
  5   1   2       bld Ga18 5g3  in                       xlk58n15ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNNNNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGNCCTGCTCTCAGCCACCATGCCTNNCGACGTGNTGGAGGTGACCAAAAAGNTCATGCGGNACCCTATCCGAATCCTGGNGAAAAAGGNAGAGNTCACCCTGGAGGGNATTAGGCAG
  5   1   2       bld Ga18      in                       xlk59i05ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAANNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTNCCGACGTGCTGGAGGNGACCAAAAAGTNCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAGAGCTCACCCTGGAGGTNNTNGGCAGTCTACATTNNTG
  5   1   2       bld Ga18 5g3  in                        xlk8f05ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGANGTTGAGTAGAGNCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTNGAGGGNNTTNGGCAGTTCTACATTNA
  5   1   2       bld Ga18      in                      xlk124n03ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGNCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGNATGAAGCAGATGAGANGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGNCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGNNNG
  5   1   2       bld Ga18 5g3  in                      xlk143l06ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNANNCNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTAACGCTCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGNGGTGACCAAAAAGTTCATGCGGGNNCCTATCCGAATCCTGGTGAAAAAGGAAGA
  5   1   2       bld Ga18 5g3  in                       xlk76k19ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGNNTTCAAGGATCAAATCTATGATATATTCNAGAAGCTCAGCAGTAATGNCCAGGTGGNCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTNNATGCGGGACCNTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCNTGGAGGNNTTAGGCANTNTNCATTAATG
  5   1   2       bld Ga18 5g   ?                       xlk144g23ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGAAAGCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGNANGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGNCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTNCATGCGGGANCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGNGGTATTAGNNAGTNCTACATTNATGTTG
  5   1   2       bld Ga18 5g3  in                      xlk107j21ex.5p                                                                                                                                                                                                                                                                                                                                  AAGAATGTCTGCGAGCTACGNNNNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCNCCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTANATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGNTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGNCGACNNGCTGGNNGTGACCAAAAAGTCAT
  5   1   2       bld DMZ  5g3  in                         xl238g21.5p                                                                                                                                                                                                                                                                                                                                  GAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4203170.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGT
  5   1   2       chi Brn1 5g                         IMAGE:6954276.5p                                                                                                                                                                                                                                                                                                                                   CCGATCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTANATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCCTGGAGGGTATTAAGGCAGTTTCTACCATTAAATGGTTGAGCCGAGAAGGAATTGGGAAAGCTTGGGAAAACACCTCCTGGTGGAACTTTGTTCCGAAGAAACCCCTGGGAACAAATTCCACAACCCGGGGGGCCGCGGTTTAATCCCCTCTTTAAAGCCAAAAACCACCTC
  5   1   2       bld Ga15      in                       XL403c24ex.5p                                                                                                                                                                                                                                                                                                                                   CGCTCCGGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCANAAGCTCANCAGTAATGCCCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGA
  5   1   2       bld Ga15 5g                            XL477b13ex.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAG
  5   1   2       bld Ga18      in                      xlk116g07ex.5p                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGNANNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGNAGGTGANCAAAAAGTTCATGCGGGNNCCTATNCNGAATCCTGNNNAAAANGNAGAGNTCACCCTGGAGGGTATTAGGCAGTTCTACATTNATGTTGAGCGA
  5   1   2       bld Ga18      in                      xlk129f18ex.5p                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGNCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATNNCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGG
  5   1   2       bld Ga18 5g3  in                      xlk136l07ex.5p                                                                                                                                                                                                                                                                                                                                   AGAATGTCTGCGAGCTACGANAGCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGNCACCATGNCTGCCGACGTGNTGGNGGTGACCAAAAANNTCATGCGGGACCCTATCCNNATCCTGGTGAAAAAGGAAGAGCTCACCCTNGNGGNNTTNGGCAGNTCTACATT
  5   1   2       bld Ga18 5g                           xlk156j24ex.5p                                                                                                                                                                                                                                                                                                                                   AGAANGTCTGCGAGCTACGNNNNNNACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGNTCATGCGGGANCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGNTCTACATTAATGTTGAGCGAGANGAGNGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTNACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGNGGNCTGGNTAACGNA
  5   1   2       bld DMZ  5g                              xl326e02.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTTCATGCGGGANCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGANGGTATTA
  5   1   2       bld DMZ  5g                              xl306m07.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGG
  5   1   2       bld DMZ       in                         xl260j17.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTG
  5   1   2       bld DMZ  5g                              xl266l15.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCANGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACTCAGCCCTGGTGT
  5   1   2       bld DMZ  5g3  in                         xl328i05.5p                                                                                                                                                                                                                                                                                                                                   AATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGANCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTG
  5   1   2       bld Ga15 5g                            XL432n03ex.5p                                                                                                                                                                                                                                                                                                                                    ATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGAACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGA
  5   1   2       bld Ga15 5g                            XL456f18ex.5p                                                                                                                                                                                                                                                                                                                                    ATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAA
  5   1   2       bld Em10 5g                         IMAGE:8321498.5p                                                                                                                                                                                                                                                                                                                                    ATTGTCTGCGAGCTACGAGAGCCGATTCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTTATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCAATAATTGTGGGCACCCCGGGCAAATTGTTCGACATGTTAACAGGCGGTACTTCTCCC
  5   1   2       bld DMZ  5x3  out                        xl229f04.5p                                                                                                                                                                                                                                                                                                                                    ATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTANAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTAATGCCCAGGTGGTCCTGCTCTCANC
  5   1   2       bld DMZ       in                         xl296n21.5p                                                                                                                                                                                                                                                                                                                                    ATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCA
  5   1   2       bld DMZ  5g                              xl278p12.5p                                                                                                                                                                                                                                                                                                                                    ATGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGT
  5   1   2       bld FaBN                            IMAGE:8077469.5p                                                                                                                                                                                                                                                                                                                                     TGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGA
  5   1   2       bld Em10                            IMAGE:8321520.5p                                                                                                                                                                                                                                                                                                                                     TGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTC
  5   1   2       bld Em10                            IMAGE:8320376.5p                                                                                                                                                                                                                                                                                                                                     TGTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAATCTATGATATATTCAGAAGCTCAGCAGTAACGCTCAGGTGGTCTGCTCTCAGCACCATGCCTGCGACGTGCTGGAGTGACCAAAGTCATGCNGACCTATCGAATCTGTGAAAAGAGACTACCTGAGGTATAGCAGTCTACTATGTGACGAAGATGAACTGAACCTCGGATGTCAACTGAATCCCGCGTACTACACCTCCGAGGATGCTAGAAACGCAGATCTTC
  5   1   2       bld Em10                            IMAGE:8318499.5p                                                                                                                                                                                                                                                                                                                                     TGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAATCTGGAACTGGGAAGACAGCCTCGTTTGCCATCTCCTTTCTCCAACAGATAAAGCTGGATATGAAAGCCACACAGGCCTTGGTGT
  5   1   2       bld DMZ       out                        xl256i16.5p                                                                                                                                                                                                                                                                                                                                     TGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGCAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGG
  5   1   2       bld Tbd5      out                   IMAGE:3580194.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAACTACAAAAGTCGACCCATAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGACATTGAGAGCAATGGGAATGAAATTGTATATAGTTTTGATGATATGAACCTATCAAAGTCCCTGCTCATGGGTATATATGACCTATGGCCTTTGAGAAACCACTCTGCCATCCAGCAG
  5   1   2       bld Emb4                   IMAGE:4680106-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCT
  5   1   2       bld Em10                            IMAGE:7983617.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGGATCAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCNGGACCCTATCCGAATCCTGGGTCAAAAGGAGAACTGANCCTGNAGGGGTATAGGCGTTCTACATTATGTTGAGCGAGAG
  5   1   2       bld Emb9                            IMAGE:7975926.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCC
  5   1   2       bld Emb9      in                    IMAGE:7975831.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAAT
  5   1   2       bld Em10                            IMAGE:8317609.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCTTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGATGTTCATGCGGGACCCTATCCGAATCCTGG
  5   1   2       bld Ov1       in                    IMAGE:8328605.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGG
  5   1   2       bld Em10                            IMAGE:8319644.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGTTGAAAAAGGAGAGCTCACCCTGGAGGGGTATANGCAAGTCTC
  5   1   2       bld Tail                            IMAGE:8542938.5p                                                                                                                                                                                                                                                                                                                                      GNGGAGTACCTAATATAATCGTCCCCGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGACTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTCATGCGGGACCCTATCCGAATCCTGGTCAAAAGGAAGAACTGACCTGAGGGTATAGCAGTCTACATTATGTTGACGAGAGAGTGAGCTGACACCTCTGTGACTGTACAGACTGACATCCCCAGCGTACTTATAACCTCCGGAAGTGACGCTACGAA
  5   1   2       bld Lmb1                            IMAGE:8534214.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCATATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTNCAAAGGGAGAACTGACCCTGGAGGGTATANGCAGTTCTACATTAATGTGAGCGAGAGAGTGG
  5   1   2       bld DMZ                                  xl334n16.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAAT
  5   1   2       bld DMZ                                  xl335n16.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCNAGCTACNAGAGCCGACCCANAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATNTGAGCCTATCANAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCANCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGNAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAANCCACACANGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCNGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACNTGAGGNCTGAAGTACAGAAGCT
  5   1   2       bld DMZ                                  xl251o23.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGANAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGANAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCANAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAACGNGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTANTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCANATGAGATGTTGAGTANAGGCTTCAAGGATCAAATCTATGATATATTCCAG
  5   1   2       bld DMZ                                  xl223b12.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAA
  5   1   2       bld DMZ                                  xl323k08.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGT
  5   1   2       bld DMZ       in                         xl313k01.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAAAACTGACCCTGGAGGGTAT
  5   1   2       bld DMZ       in                         xl292m17.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACNAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTG
  5   1   2       bld DMZ                                  xl250o23.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCG
  5   1   2       bld DMZ       in                         xl234d14.5p                                                                                                                                                                                                                                                                                                                                      GTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAA
  5   1   2       bld Oo1                             IMAGE:6642381.5p                                                                                                                                                                                                                                                                                                                                       TCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGGAGGGTATTAGGCAGTTCTACATTAATGTTGAACCGAAAGGAATGGAAACTGGACACACTCTGTGNACTTGTACCAGACCCTTGACATCACACAGGGCGGTTATTCTTTAT
  5   1   2       bld Ga15                               XL420a06ex.5p                                                                                                                                                                                                                                                                                                                                       TCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAANAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGANCG
  5   1   2       bld Ga15                               XL421o06ex.5p                                                                                                                                                                                                                                                                                                                                       TCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCANAAGCTCANCAGTAACGCTCANGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCNAATCCTGGTGAAAAAGGAANAGCTCACCCTGGAGGGTATTANGCANTTCTACATTAATG
  5   1   2       bld Ga15      in                       XL463e04ex.5p                                                                                                                                                                                                                                                                                                                                       TCTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAANAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGAGCGA
  5   1   2       bld Ga15      in                       XL500l09ex.5p                                                                                                                                                                                                                                                                                                                                       TCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTT
  5   1   2       bld Spl       in                    IMAGE:8463432.5p                                                                                                                                                                                                                                                                                                                                       TGTCTGCGAGCTCNAAAGTCGACCCCCCTTTATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTCCTTTTAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATTCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTTGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCCTCGCAGTAACGCTCAGGTGGTCCTGCTCTCGCCACCAATGCTGCCAACATTGCTGTAGGTGACTCAAAATTTCATGCGGGACCTATCCAGAATCTG
  5   1   2       bld Emb4      in                    IMAGE:4201799.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTG
  5   1   2       bld Ov1       in                    IMAGE:5047959.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACTAGACCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTG
  5   1   2       bld Emb4                            IMAGE:4930154.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGAACGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGGACATCACACAGGGCCGTTATCTTTATTCACACTCGCCCGGAAAGTGGGA
  5   1   2       bld Emb4                            IMAGE:4930201.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCCTGGTGAAAAAGGAAGAGCTCACCCTGGGAGGNGTATTANGCAGTTCTACATTAATGGTTGANCGAAGAGGAATGGGAAACTGGACACACTCTGGGGACTTTGTACGGAGACCCTGGACAATCACAACAAGGCCGGTTAATCTTTATCCACCCCTCCCCCCGGGAAAGGGGGGAACTGGCCCTAAACN
  5   1   2       bld Ga15      in                       XL411i10ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGNACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTANAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAANAACTGACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGAGCGANA
  5   1   2       bld Ga15      in                       XL429b20ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTANAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTAATGCCCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAANAANTTCATGCGGGACCCTATCCNAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTANGCANTTCTACATTAATGTTNANC
  5   1   2       bld Ga15      in                       XL430j20ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTG
  5   1   2       bld Ga15      in                       XL435i08ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAAGGGTATTANGCAGTTCTACAT
  5   1   2       bld Ga15      in                       XL440j23ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAANAACTGACCCTGGAGGGTATTA
  5   1   2       bld Ga15                               XL441a06ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCACAGTCCCTGCTCAGGGGTATATATGCCTATG
  5   1   2       bld Ga15      in                       XL410b07ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGANAGCCGACCCNGAGACAATGGACCCGAAGGNATGGAGCCTGATGGGATCATTGANAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCATANTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCANCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCNTTGCTCAGGCTCANTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAANAGATAAANCTGGATATGAAANCCACACAGGCCCTGGTGTTGGCACCAACTCNTGAGCTGGCCCANCAGATCCNGAAANTANTTATGGCCCTGGGAGATTATATGGGTGCC
  5   1   2       bld Ga15      out                      XL427h06ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGAGAAGCCGCAGTACAAGAAACAAGGGGGGCGCCGCCTCCAGCTCCGGCAACaaaaagaagaagaagaaaaagaaCCAGCCGGGCCGCTACAGCCAACTCGTAGTGGACACGATCCGCAAACTGGGGGAGAGGAACGGCTCGTCCCTGGCCAAGATCTACAGCGAAGCCAAAGAAAGTGTCCTGGNTCGACCAACAGAACGGCCGCACG
  5   1   2       bld Ga15                               XL493f23ex.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGG
  5   1   2       chi Em10      in                    IMAGE:7981817.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTGTGAGTATCCTGGCAAGATGACTGGAAATGGTTGGAGGTGTGCTGCTACACTTCACTTGGGTGCTGGTACTAGAGGGTAATGGGTGCTTGGCATGAGGCCATGTGTGGTGATACCAATGCAGTTGGACAGAACACTCCCTAAACTAATTGCTGGTGCCACTTTAACTATCCAATTAAGCACTTGGACTCAGCTGTCAATATCCAGATGTCTTTGTGCCTTTAATGGTAAGCTCTATT
  5   1   2       chi Emb9                            IMAGE:7975472.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACATAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCAAATACATAAAGTATGTTTGTGCTGGATGAACAGATGAGATGTTGAGTAGAGGCTTCTAGGTCAAATCTATGATATTTCTATAGCTCTTCATTAATGCCCAGGTGGTCTTGCTCTCACCACATGCCTGTTACTGCTGAGGTGCCAAAATTCTGCTGGACTTATCGATTCTGTCAACCGTAAACTACCTGGAGGTTATGTTTTACTTTTGTTACAGAGATGGACTGGATCT
  5   1   2       bld Emb9                            IMAGE:7975488.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAAATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGTTAACAAGAAGTTATGGCGGAACCTTTCTGAATCCTGGTCAAAAGGAAAACTGACCCTGGAGGTATTAGGCATTCTCTTA
  5   1   2       bld Em10      in                    IMAGE:7980436.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGCGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAAGGAAGAACTGACCCTGGAGGGGTATAAGGCA
  5   1   2       bld FaBN                            IMAGE:8076533.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACAAAGAAGTTCATGCGGGACCCTATCCGGAATCCTGGTCAAAAAGGAAGAACTGACCCCTGGAGGGTATTAGGCAGGTTCTACAAT
  5   1   2       bld FaBN      in                    IMAGE:8075849.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCTGCNGGACCTATCCGATCCTGGTCAAAAGGAGACTGACCTTGAGGGATTAGCATTCTACTAATGTGAGCGAAGAGTGAACTGACCGCTCGGACCGTCAA
  5   1   2       bld Em10                            IMAGE:8318859.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGCGACCAAGAGTTCATGCGGGACCCTATC
  5   1   2       bld Spl                             IMAGE:8460441.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTCATGCGGGACCCTATCCGATCCTGGTCAAAAGGAAGACTGANCCTGAGGTATANGCAGTCTACATATGTGAGCGAAGAGTGAGCTGACACCTCTTACTGTACAACTGCATCCCAGCGTATCTATACCTCNCGAGTGATGCTAGAAATGCCCAGATCTGCCTCTGCG
  5   1   2       bld Spl                             IMAGE:8461143.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAGAAGTCATGCGGGACCTATCCCGAATCTGTCAAAANGAGACTGACCCTGAGGTATANGCAGTCTACTTATGTGAGCAGAGAGTGAGCTGACCCTCTGTACTGTACAACTGAATCACAGCGTACTTATACTCGCGAGTGATGCTAGAAATCGCAGATCTGCTGCTCGCACGCNAGACACCTAAATT
  5   1   2       bld DMZ       in                         xl251l05.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAA
  5   1   2       bld DMZ       in                         xl278c20.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGT
  5   1   2       bld DMZ       in                         xl268b05.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGA
  5   1   2       bld DMZ       in                         xl331e24.5p                                                                                                                                                                                                                                                                                                                                        CTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCNA
  5   1   2       bld Egg1                            IMAGE:3301339.5p                                                                                                                                                                                                                                                                                                                                         GCACGAGGACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGTAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCTTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCGCCTAAATACATAAAGATGTATGTTTTGGATGAAGCANACGACATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCATGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCT
  5   1   2       bld Te2N                            IMAGE:7202004.5p                                                                                                                                                                                                                                                                                                                                         TGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTTACCTGTCGAAAACCTGAACATCCACCCCGGCCGTTTTCTTTTATTAACCCTCCCCCGGAAGGGGGACTGGCCTACGGGAAAAGAACCCCCCCAAGGGGACTTTCACTT
  5   1   2       bld Ga15      in                       XL478m01ex.5p                                                                                                                                                                                                                                                                                                                                         CGAGCTACGTAAAGTCGACCCAGAGACAATGGTACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTANATAGTTTTGATGATATGAGCCTATCATAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGANAAACCCTCTGCCATCCANCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCANGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTANAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCANTAACGCTCANGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCNAATCCTGGTGAAAAAGGAANAGCTCACCCTGGAGGGTATTANGCANNTCTACATTAATGTTNA
  5   1   2       bld Te2N                            IMAGE:7768867.5p                                                                                                                                                                                                                                                                                                                                         TGCGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTNCAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCNAAAGTTCATGCGGGACCTATCCGAATCTGGTGAAAAGGAGAGCTCACCTGNAGGGTATAGCAGTCTACATATGTGACGAGAGATGGAGCTGACCCTCTTGACTGTACAACTGAATCCCAGCGTACTTTCACCTCGCGAGTGATGTACGAAAACTGCAGATCTGCTGCTGCGA
  5   1   2       bld Ga18      in                      xlk117d04ex.5p                                                                                                                                                                                                                                                                                                                                          CNNCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGNATGAAGCGGATGAGATGTTGAGTAGAGNCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGNCCAGGTGGNCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAANNCATGCGGNACCCTATCCGAATCCTGGNCAAAAGGAAGAACTGACCCTGGAGGNATTAGGCANTCTACATTNATGTNAGCGA
  5   1   2       bld Ga18      in                      xlk107e13ex.5p                                                                                                                                                                                                                                                                                                                                          CNNCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGNNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATNNCCAGGTGGNNCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGANCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGNNAAAAAGGAAGAACTGACCCTGGAGGTNTTAGGNAGTCTNCAT
  5   1   2       bld DMZ                                  xl259g10.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGC
  5   1   2       bld DMZ       out                        xl287b06.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGG
  5   1   2       bld DMZ       in                         xl238i13.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGACCCTATCCGA
  5   1   2       bld DMZ       in                         xl279h15.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAAT
  5   1   2       bld DMZ       in                         xl225f23.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGT
  5   1   2       bld DMZ       in                         xl227j15.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGANAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCANAGTCCCTGCTCANGGGTATATATGCCTATGGCTTTGANAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCNTTGCTCANGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCNACANATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCC
  5   1   2       bld DMZ       in                         xl337e13.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGT
  5   1   2       bld DMZ       in                         xl340i17.5p                                                                                                                                                                                                                                                                                                                                          GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCC
  5   1   2       bld Emb4                            IMAGE:5514606.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGTCCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTNAATGTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTG
  5   1   2       bld Ga15                               XL415n13ex.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAANA
  5   1   2       bld Ga15      in                       XL476d13ex.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAAGCTGGACACGCTCTGTGACCT
  5   1   2       bld Ga15                               XL483h15ex.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGANAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGANA
  5   1   2       bld Ga15      in                       XL489n01ex.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTANAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGTGACCAANAANTTCATGCGGG
  5   1   2       bld Emb9      in                    IMAGE:7974007.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCACCATGCCTGCCGACGTGCTGGAGTGACAAAAATTCATGCGGGACCTATCCGATCCTGTGAAAAGGAGAGCCCCCTGGAGGTATAGGCATTCTCTTATGTGAGCAAGGATGAGCGGACCCTTGTGCTGACAGCCTACAACCCAGCGTTTTTTCACCTCCGAGTGATGCACGAAAACTGCAGATCTGTTTCTGCGAATACAGGCAATTTTAATCTTG
  5   1   2       bld Em10                            IMAGE:7978784.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAAGTGGTCCTGCTCTCAGCCACCATGCCTGCCTACGTGCTGTAAGTGACCAAAAAGTTCATGCGGGACCCTATCCAAATCCTGGTGAAAAGGGAGAGCTCACCCTGGAAGGTATTAAGCAGTTCTACAT
  5   1   2       bld FaBN                            IMAGE:8078266.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTCATGCGGGACCCTATCCGAATCTGGTGAAAANGAGAGCTCACCTGGAGGTATANGCAGTCTACATTATGTGAGCGAGAGAGTGGAGCTGACACCTCTGTGACTGTAG
  5   1   2       bld Brn3                            IMAGE:8540925.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCGATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCGGCCACCATGCCTGCCGACGTGCTGGAGGTGACCANNAGTTCATGCGGGATCCTATCCGAATCTGGTGAAAANNGAGAGCTCACTCTGGAGGGTATAGCAGTCTACATTATGTGAGCGAGAGATGGAGCTGACCCTCTGGACTGTACAGACTGACATCCCAGCTGTATCTACACCTC
  5   1   2       bld Int2                            IMAGE:8526505.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGGTTTCAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTCATGCGGGACCTATCCGAATCTGGTGAAAAGGAGAGCTCACCTGNAGGTATAGGCAGTCTACATTATGTGAGCGAGAGATGAAGCTGACCATCTGTACTGTACAGACCTACATCCACAGCGTACTTACACCTCCCGAAGTGACGC
  5   1   2       bld Thy                             IMAGE:8548565.5p                                                                                                                                                                                                                                                                                                                                           CGAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTCATGCGGGACCCTATCCGATCCTGGTGAAAAGGAGAGCTCCCCTGGAGGTATANGCAGTCTACTTATGTGAGCGAAGAGTGAGCTGACCCTCTGTGACTGTACAACCTGACATCCCGGCGTACTTTCACCTCC
  5   1   2       bld Ga15      in                       XL455i21ex.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGC
  5   1   2       bld Emb9                            IMAGE:7977255.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGAGTGAAGCTGGACACACTTCTGTTGACTTTTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCCGGAAGGGTGAACTGGCCTTAAC
  5   1   2       bld Ga18      in                      xlk134a01ex.5p                                                                                                                                                                                                                                                                                                                                            GCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGNCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGNTCAAATCTATGATATATTCCAGAAGCTCAGNAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTNCCGACGTGCTGGNGGTGACC
  5   1   2       bld DMZ       in                         xl232c04.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCC
  5   1   2       bld DMZ       in                         xl298i04.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAG
  5   1   2       bld DMZ       in                         xl252d22.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAG
  5   1   2       bld DMZ       in                         xl266o12.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGA
  5   1   2       bld DMZ       in                         xl279n05.5p                                                                                                                                                                                                                                                                                                                                            GAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAA
  5   1   2       bld Ga15      in                       XL467b17ex.5p                                                                                                                                                                                                                                                                                                                                             AGCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGAG
  5   1   2       bld Ga18      in                      xlk162f09ex.5p                                                                                                                                                                                                                                                                                                                                             GAGCTACGAAAGNCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAATCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGNTCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGNGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAGGAAGANNTCACCCTGG
  5   1   2       bld Ga18      in                      xlk137f10ex.5p                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGANCCGACCCAGAGACAATGGACCNNAAGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTNNCATGCTTGCATCGGGGGCACCAACGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGANGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGNCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGNNGTGACCAAGAAGTTCATGCGGGANCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGNNTTNGGCAGTNCTACATTAATGTTGA
  5   1   2       bld Ga18      in                       xlk77c02ex.5p                                                                                                                                                                                                                                                                                                                                             CGAGCTACGAGANCCGACCCAGAGACAATGGACCNNNNGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTANNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGNTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGANTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGANGTTGAGTAGANGNNTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGNTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGNAGGNNNTAGGCAGNTCTACATTAATGTTGAGCGAGAGGAGNGGAAGCTGGNNACGCTCTNTGACCTGTACGAGANCCT
  5   1   2       bld Emb9                            IMAGE:7974830.5p                                                                                                                                                                                                                                                                                                                                              GCTACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAG
  5   1   2       bld Ga18      in                      xlk160d18ex.5p                                                                                                                                                                                                                                                                                                                                               AGCTACGNNNNNGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGANCCTATCCGAATCCTGNNGAAAAAGGAAGAGCTCACCCTGGAGGTATTAGGCAGNTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGNTATCTTTATCAACACTCGCCGGANNNGGNCTGGCTAACGGNNAAGANNNA
  5   1   2       bld DMZ       in                         xl230k11.5p                                                                                                                                                                                                                                                                                                                                               CTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGT
  5   1   2       bld DMZ       in                         xl232a03.5p                                                                                                                                                                                                                                                                                                                                               CTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTAT
  5   1   2       chi Thy                             IMAGE:8550315.5p                                                                                                                                                                                                                                                                                                                                                TACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGATGTGACCAAGAAGTCATGCGGGACCTATCCGATCCTGGTCAAAAGGAGACTGACCTGGAGGTATAGGAGTTTACTTATGTTAGCGAAGAGTGAGCTGGAAGTCTTGACTGTCAGACCTACATCCAGCGTTCTTTAACTCCCGAGGGACGTAAGAAAACCC
  5   1   2       bld DMZ       in                         xl290a19.5p                                                                                                                                                                                                                                                                                                                                                TACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGANGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAA
  5   1   2       bld DMZ       in                         xl224o04.5p                                                                                                                                                                                                                                                                                                                                                TACGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGG
  5   1   2       bld Emb4                            IMAGE:4683784.5p                                                                                                                                                                                                                                                                                                                                                  CGAAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCCTGGAGGGTATTAGGCCAGTTCTACATTAATGTTTGAGCGAGAAGAGTGGGAAACCTGGGACCCACTCCTGTGAACTTGGGAACGAAAACCCCGTGACAATCCACCCCCAGGGGCGGTTTATCTTTTAATTTAAACACCTCCCCCCCGGGAAAGGGTGGGAACCTGGGGGCTTATCCGGGC
  5   1   2       bld Ov1                             IMAGE:6316487.5p                                                                                                                                                                                                                                                                                                                                                  CGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCCAGCAGTAATGCCCCGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGCCAAAAGGAAGAACTGACCCTGGAGGGGTATTAGGGCAGCCCTACATTAATGTTTAACCGACAGGAGTGGGAACCTGGACACCCCCCTTGGACCCGGTACGAGAACCCTGAACATCCCCCCAGGCCCGTTATCCTTTAtaaaaaactcaccccaaaagggggactggggttaccggaaaaaaatcccccccAAGGGAC
  5   1   2       bld Ga15                               XL472o06ex.5p                                                                                                                                                                                                                                                                                                                                                    AAAGTCNACCCNGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCC
  5   1   2       bld Emb9      in                    IMAGE:7973807.5p                                                                                                                                                                                                                                                                                                                                                    GAAGTCGACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACAAAAAGTTCATGCGGGAACCTATCCGATCCTGGTGAAAAAGAAGAGCTCACCTGGACGGATAGGCATTCTACTTATGTTGACGAGAGAGTGAACTGACCCTTTGTGATTGACAGACTGACATCCCGGCGTTTCTTATACCCCCCGAAGGGATGTATGAGAATCTCAAG
  5   1   2       bld Ga18      ?                        xlk72p13ex.5p                                                                                                                                                                                                                                                                                                                                                    ACGAANNNNNCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTNTNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGANTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGNTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGNTTTGGATGAAGCAGACGAGATGTTGAGTAGAGNNTTCAAGGNTCAAATCTATGATATATTNCCAGAAGCTCANNAGTAACGCTCAGGNGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGNTGGNGGNGACCAAAAAGTTCATGCGNGACCCTATNCGAATCCNNGGNNAAAAA
  5   1   2       bld Egg4      in                    IMAGE:3744726.5p                                                                                                                                                                                                                                                                                                                                                       GCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCC
  5   1   2       bld Emb3      in                    IMAGE:3400415.5p                                                                                                                                                                                                                                                                                                                                                           CCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAACAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTTCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGTCCCACAGATCCAGAAAGTGTTATGGCCTGGGAGAT
  5   1   2       bld Ga18                                xlk5j19ex.5p                                                                                                                                                                                                                                                                                                                                                            ACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGAGGTGANCAAAAAGTTCATGCGGNACCCTATCCGAATCCTGGTGAAAAAGGAAGA
  5   1   2       bld Ga18      in                      xlk144p06ex.5p                                                                                                                                                                                                                                                                                                                                                            ACCCAGAGACAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTNCCGACGTGCTGGAGGNGACCAAAAAGTTCATNNGGNANCCTATCCGAATCCTGGTGAAAAAGGAAGAGNTCACCCTGGNGGTNTTAGGCAGTNTATATTA
  5   1   2       bld Int2                            IMAGE:8531219.5p                                                                                                                                                                                                                                                                                                                                                             CCCAGAGAAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTCATGCGGGACCCTATCCGAATCTGGTGAAAANGAGAGCTCACCTGGAGGTATANGCAGTCTACATTATGTGAGCGAGAGATGGAGCTGACCACTCTTGACTGTACAGACTGACATCACCAGCGTATCTTACACCTCGCGAAGTGACTGCTACGAAATCTGCAGACTCTGTC
  5   1   2       bld DMZ       in                         xl340b21.5p                                                                                                                                                                                                                                                                                                                                                              CAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAAAACTGACCCT
  5   1   2       bld Emb4                            IMAGE:5513805.5p                                                                                                                                                                                                                                                                                                                                                               CAGAGACAATGGACCCGTGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAANAAGGAAGAACTGACCCTGGAGGGTATTANGCAGTTCTACATTAATGTTGAGCGAGAG
  5   1   2       bld Oo1       in                    IMAGE:3404944.5p                                                                                                                                                                                                                                                                                                                                                                 GACAATGGACCTGAAGGCATTGGAGCCTGATGGTGTCATTGAGAAGCATTGGAATGANATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTT
  5   1   2       bld Oo1                             IMAGE:6859231.5p                                                                                                                                                                                                                                                                                                                                                                  AGAAATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCCTGACATCACACAGGCCGTTATCTTTATCAACACTCGCCCGGAAGGTGGGACTGGGCTAACGGAGAAAGATGCATNGCNAGGGAN
  5   1   2       bld Ga12      in                         XL150o23.5p                                                                                                                                                                                                                                                                                                                                                                   AGACATGGACCCGAAGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAG
  5   1   2       bld Ga18      in                      xlk149k01ex.5p                                                                                                                                                                                                                                                                                                                                                                   AGANAATGGACCNNNNGNATGGAGNCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATNNNNTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGNTCATGCGGGANCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGANCCTGACAATCACACAGGCCGNTATCTTTATAAACACTCGCCGGAAGNGGACTGGCTAACGGAGAAGATGCACGCGAGGGANTTCACTGTCTCT
  5   1   2       bld Ga15                               XL454n09ex.5p                                                                                                                                                                                                                                                                                                                                                                    ATGGACCCGCAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGANTCTATCATGAGTCCCTGCTCANGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCANCGAGCTATTATGCCTTGNATCAAGGGTTATGATGTCATTGCTCANGCTCANTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCANCAGATANAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCANCAGTAATGCCCAGGTGGTCCTGCTCTCANCCACCATGCCTGCCGACGTGCTGGAGGT
  5   1   2       bld Egg1                               PBX0132E03.5p                                                                                                                                                                                                                                                                                                                                                                     AATGGACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATG
  5   1   2       bld Ga15      in                       XL475l08ex.5p                                                                                                                                                                                                                                                                                                                                                                      ATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCCTGCCCGACGTGCTGGAG
  5   1   2       bld Oo1                             IMAGE:3404351.5p                                                                                                                                                                                                                                                                                                                                                                       TGGACCCGAAGGCATGGAGCCTGATGGGATCATTGACAGCAATTGGAATGAAATTGCGGATAGTTTTGATGACATGAGCCTATCAGAGTCCCTGCTCATGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCACTCTGGAACTGGGAAGACAGCCACCTTTGCCATCTGCATTCTGCAACAGATAGAGCTGGATGTGAAAGCCACACAGGCGCTGGTGTTGGCACCAACTAGTGAGCTGGCCCAGCATATCCAGAAAGTAGTCATGGCCCTGGGAGATGATATGGGTGCCTCTGGCCATGCTTGCATCATGGGCACCAACGTGAGGGCTGACGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACACCCGGCAGAGTGTTCGACATGTTTGAACAG
  5   1   2       bld DMZ                                  xl241m18.5p                                                                                                                                                                                                                                                                                                                                                                       TGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCANGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAACNAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCANGCTCAATCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCT
  5   1   2       bld Panc                            IMAGE:8737593.5p                                                                                                                                                                                                                                                                                                                                                                          ACCTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATTTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAAGTGGTCTGCTCTCAGCCACCATGCTGCGACGTGCTGGAGGTGACAAAAGTCATGCGGACCCTTATCCGATCCTGTGAAAAAGAAAGCTCCACCTGGAGGTTTAGCAGTTACTTATTGTTGCGAAGGTAGTTTCCTTGGGTGACGTACTCTGGCGTTCAGCTCTGTCGTCATCGGCATATATAAGATTGGCGACCTGTTCTATTGGGAGAACATTG
  5   1   2       bld Tbd3                            IMAGE:3549654.5p                                                                                                                                                                                                                                                                                                                                                                           CCCGAAGCATGGAGCCTGATGGGATCATTGAGAGCAATCTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGAATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGAGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGAGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCAGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGT
  5   1   2       bld FaBN                            IMAGE:8076392.5p                                                                                                                                                                                                                                                                                                                                                                            CTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAAGGAGTGGAAGCTGGGACACACTCTGTGACTTGTACGA
  5   1   2       bld Em10                            IMAGE:8320018.5p                                                                                                                                                                                                                                                                                                                                                                            CTGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAAGTGACCAAAAAGTCATGCGGGACCCTATCCGAATCCTGGTGAAAANGAAGAGCTCACCCTGGAGGGTATANGCAGTCTACATTATGTTGACGAGAGATGGAGCTGACACCTCTGTGACTGTACAGACCTGACATCACCAGCGTATC
  5   1   2       bld Emb4                            IMAGE:4683682.5p                                                                                                                                                                                                                                                                                                                                                                             TGAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGGGCGTTATCTNTTATCACACTCGCCCGGAAGGTGGGACTGGCCTANCGGGAGAAGAATGCATNGCGAGGGGACTTNCACTGGGTCTCTGGCCCT
  5   1   2       bld FaBN                            IMAGE:8076718.5p                                                                                                                                                                                                                                                                                                                                                                              GAAGGCATGGAGCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAGGAAGAGCTCACCTGGAGGGTATAGGCAGTCTACATTAATGTGAGCAAGAGATTGAAGCTGGACACCTCTGTACTT
  5   1   2       bld DMZ       in                         xl302p19.5p                                                                                                                                                                                                                                                                                                                                                                               AAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGT
  5   1   2       bld Egg5      in                    IMAGE:3430264.5p                                                                                                                                                                                                                                                                                                                                                                                         GCCTGATGGTGTCATTGAGAGCAATTGGAATGAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCATGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAATTATGGCCCTGGGAGATAACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCTCTCAATACATAAAGATGTTTGTTGTTGATGAAGCAGACGAGAAGTCGAGTAGAGGTTTCAAGGATCAAAACTATGAAATAGTCCATAAGCTT
  5   1   2       bld Sp1       in                    IMAGE:4963145.5p                                                                                                                                                                                                                                                                                                                                                                                                CAGTGAATGAACAGTCTAAATTGAATCCGATCGATTTGCCTTGAAGAAAACACTTGATTTGCTTTAGTATTTGACAATGTTTGTTGAACTGTCCCTTTAATGCTATTCCCTCATTGACTTGAGTGATGTCATGTCACCCCTTTAGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTA
  3  -1   2       bld Neu4      in                    IMAGE:4084459.3p                                                                                                                                                                                                                                                                                                                                                                                                         TGAGAGCAATTGGAATGAAATTGTGGATAGTTTTTATGCACATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCCGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACCATCCTTTGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAG
  5   1   2       bld Spl                             IMAGE:8463449.5p                                                                                                                                                                                                                                                                                                                                                                                                                AAAATGGNNCCCTCGTGNGNNNNGAGATGCATATAATAAATTCGTCCCCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGGACATCACACAGGCCGTTATCTTTATCAACACT
  5   1   2       bld He1                             IMAGE:4409055.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATTGTAGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTG
  5   1   2       bld DMZ                                  xl246h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATTGTGGATAGTTTTGATGATATGAGTCTATCANAGTCCCTGCTCANGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCATCGAGCTATTATGCCTTGTATCANGGGTTATGATGTCATTGCTCANGCTCANTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCNTGNGCTGGCCCANCAGATCCAGAANGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCNACATGTTGAACAGGCGGTACCTCTCCCCCNNATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGTANCCTATCCGAATCCTGGTCAAAAA
  5   1   2       bld Te2                             IMAGE:7207585.5p                                                                                                                                                                                                                                                                                                                                                                                                                         AAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTTATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACCATCACACAGGCCGTTATCTTTATAACACTCGCCCGGAGGTGGACTGGCTTACGGAAGAAAATGCACCCAAGGGACTTCACGTGTCTTGCCCCGGCACGGCAACTTGGAACCAAA
  5   1   2       bld Ga18      in                       xlk56c22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGANCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGNGGAAGCTGGACACACTCTGTGACTTNTACGAGACCCTGACAATCACACAGGCCNNTATCTTTATCAACACTCGNCNGNANNNGNACTGGCTAACGGAGAAGNNG
  5   1   2       bld Emb4                            IMAGE:5515919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCA
  5   1   2       bld Ga18      in                      xlk157c07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTCCCTGCTCAGGGGTATATATGCCTATGGTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGNNAGTTCTACATTAATGTTGAGCGAGAGGAGNGGAAGCTGGACACACTCTGTGACTTGTACGAGANCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGTGGNCTGGCTAACGGAGAAGATGCATGCGANGGANTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGANGTCATTATGAGAGAGNTCCNATCTGGNTCCAGNCGTGNTCTGATTACCACAGANTTGCTGGCCCGAGNATTNATGTCCANCAGGNCTCACTGG
  5   1   2       bld Bone                            IMAGE:8742806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAGTTCATGCGGGACCCTTATCCGATCCTGGTGAAAAGGAGGAGCTCCACCCTGAGGTATTAGGCAGTTCTACATTATGTTGAGCGAGAAGGGATGGAGCTGACCAACTCTCTGGTGACTTGTCGAGAACTGACAATCACACCAAGCGTTACTTTATTCACACCTCGCCGAGGTGGACTGCTAACGGAAAATGCATGCAAGGACTTCATGTTCTTGCCCTGACGACCTGACTAAGACGACGCTCTATAGAGAGTTCGATCGGATCAGCTGGTCTGATAACAGA
  5   1   2       bld DMZ       in                         xl281i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGC
  5   1   2       bld Emb4                            IMAGE:5514879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTATATANTGCCTACTGGTCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCACACTCGCCGGAAGGTGGACTGGCNNTACGAGAGATGCATGCGAGGGACTCACTGTCTCTGCC
  5   1   2       chi DMZ       in                         xl304l13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCCGAAGGCATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGCCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGCTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGTAAGTGTTCCTGTGGGGGCCAATTCACTCTGGTGG
  5   1   2       chi Ga18      in                      xlk129n13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTCTGCGAGCTACGAGAGCCGACCCAGAGACAATGGACCNNAAGNATGGAGCCTGATGGGATCATTGAGAGCAATTGGAATGAAATTGTGGATAGTTTTGATGATATGAGTCTATCAGAGTCCCTGCTCAGGGGTATATATGCCTATGGTTTGAGAAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGANCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTNCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTNTCTTTATAAACACTCGCCNGANNTGGNCTGGCT
  3   1   2       bld Ga18      in                      xlk145j06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GNATATANNCTATGGCTTTNNNAANCCTNTGCCANCNAGCAGCGAGCTNTNTGCCTNNNNTCAAGGNTNANGATGTCNTNCTNAGGCTCANTCTGNNACTGGGAAAACAGCCANGTTTGCGATCTCCATTCTNCAGCAGATAGANCTGGATATGAAANCCACACAAGCCCTGGTGTTGGNCCANCCCGTGAGCTGNCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATNACATGGGTGCCGGATNNCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGNAGCTGCAGTCGGAGNCTCCCCATATAGTCGTGGNCACCCCGGGCAGAGTGTTTGACATGTTGNACAGGCGCTACCTNTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCNAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATGCCCATGAACG
  3   1   2       bld Ga18      in                      xlk146e15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATGGCTTTGAGAACCCTCTGCCNNCCAGCAGCGAGCTNTNATNCCTNGTATCANNNNNNNTGATGTCNNNCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTNCCNNCTCCATTCTCCAANANATAGAGCTGGATATGAAAGCNACACAGGCCCTGGTGTNNGNACCAACTCGTGAGCTGNNCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTNNCATGCTTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGNACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGNTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNNAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTTGAGGAGATNCCCATGAAC
  5   1   2       bld Ga18      in                       xlk75o19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCCTCTGCCATCCAGCAGCGAGCTATTATGCCTTGTATCAAGGGTTATGATGTCATTGCTCAGGNTCAGTCTGGAACTGGGAAAACAGCCACGTTTGCGATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGNTCATGCGGGANCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGNGGGTATTAGGNAGTTCTACATTAATGTTGAGCGAGANGAGNGGAAGCTGGACANACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGNCGTTNTCTTTNTCAACACTCGC
  5   1   2       bld Ga15                               XL489i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTTGTATCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACG
  3   1   2       bld Ga18      in                      xlk134a01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAGGGTTATGATGTCATTGCTCAGGCTCAGTCTGGNACTGGGAAGANANCCNCGTTTGCCNTCTCCNTTCTCCNACAGATAGAGCTGGATATGANNNCCACACAGGNCCTGGTGTTGGNACCANCTCGTGAGCTNNNCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTNCCTCGTGCCATGCTTGCATCGGGGGCNCCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACANCNCCACAGTTGAGGAGATNCCCATGAAC
  3   1   2       bld Ga18      in                      xlk144p06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CANNGGNNNNNNATGTCATNGCTCANGCTCANNCTGGNACTGGGANNNNANCCACGTTTGCGATCTCCATNCTGCAGCAGATAGAGCTGGATATGAAANCCNNACAAGCCNTGGTGTTGGCCCCNNCCCGTGAGCTGGCCCAGCAGANCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTNCCGGATNCNTGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGNACAGGCGCTACCTGTCCNCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTATATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCNAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGNNAGCCTNATANAA
  5   1   2       bld Ga15                               XL479o18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTATGATGTCATTGCTCAGGCTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGA
  3   1   2       bld Ga18      in                      xlk117d04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATGANNTCNNNCTCANGCTCAGTCTGGAACTGGGAAGANAGCCACNTTTNCCNTCTCCNTTCNCNAACAGATAGAGCNGGATATGAAAGCCACACAGGCCCTGGTGTTGGNNCCAACTCGTGANNTGNNCCAGCAGATCCAGAAANGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTNNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGNTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCNNNNTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTTGAGGAGATNCCCATGAACGTGNNA
  5   1   2       bld Ga18      in                       xlk58c02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATGATGTCATTGCTCAGNNTCAGTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGANCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGANCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGNGGNCTGGCTAACGGAGAAG
  5   1   2       bld DMZ       in                         xl300i06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGCTCAGGCTCAGTTCTGGAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATG
  3   1   2       bld Ga18      in                       xlk75o19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANNCTCANNCTGGANNNGGNAAAANAGCCACGTTNNCGATCNCCNTCTGCAGCAGATAGANCTGGATATGAAANNCNNACAAGCCCTNGTGTTGGCCCCAACCCGTGAGCNGNCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGNNTACATGGGTNCCGGATNCNATGNCTGCATNGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGNCACCCCGGGCAGAGTGTTTGACATGTTGNACAGGCGCTACCTNTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNNAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTCGAGGAGATNCCCATGAAC
  3   1   2       bld Ga18                             rxlk141i06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CANTCTGGAACTGGGAAANANCCACGNTNNNAATCTCCNTNCTGCAGCAGATAGAGCTGGATATGAAANCCNCACAAGNCCTGGTNTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGANTACATGGGTGCCGGGTNNNATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGNCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTNTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATGCCCATGAACGTGNNNGCCTNATATAA
  3   1   2       bld Ga18      in                      xlk116g07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCTGNNNCNGGNAAANANCCACGTTNNCAATCTCCNTNCTGCAGNAGATAGAGCTGGATATGAAAGCNNNNNNAGNCCTGNNNNTNNCCCCAACCCGTGANCTGNCCCAGNAGATCCAGAAAGTAGTTANGNCCTGGNNNNTTACATGGGTNCCGGATNCCATGCCTGCNTTGGGGGNNCCANCGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGNCTCCCCATATAGTCGTGGNCACCCCGGGCAGAGTGTTTGACATGTTGNACAGGCGCTACCTNTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACNNNNNGCCTNATATA
  5   1   2       bld Spl                             IMAGE:8462622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAACTGGGAAGACAGCCACGTTTGCCATCTCCATTCTCCAACAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCNCCGGAANGTGGACTGGCTAACNGAGAAGATGACGCGAGGGACTTCCTGTCTCTGCCTGCCNGCGACATGGACAAAAGACGAGACTCCTATAGAGAGTCCATCTGATCAGTCTGGTTGATACACAAATGTTGCCGAGGATGAGTCACAGCTCCTGTGCTATTTATGCCACACAAAGAA
  3   1   2       bld Ga18      in                       xlk77c02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCNNCGTTTNCCNTCTCNATNCTCNACAGATAGAGCNNGATATGNAANNCACACAGGCCCTGNNNNTGGCACCANCTCGTGAGCTGGCNCAGCAGATCCAGAAAGTAGTNATGNCCCTGGGAGATTATANNGGTGCCTCGTNCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAANCTCCTCACATAATTGTGGNCACCCCGNNCAGAGTGTTCGACATGTTGAACAGGCGGTNCCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGNCCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCNNNCTNCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGNCCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTTGAGGAGATNNCCATGAAC
  3   1   2       bld Ga18      in                       xlk77p16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANNGNNNNCCCNNNNNTCNGCCCACGCNTNCNGNNNCTGGNNNTGAAANNNCACAGGCCCTGNTNTTGGCACCAACTCGTGANCTGGCCCAGCAGATCCAGAAAGTAGNTATGGCCCTGGGAGNTTATATGGGTGCCTCGTNNCATGCTTGCATCGGGGGCACCANNGTGAGGNCTGAAGTACAGAAGCTGCAGTCGGAANCTCCTCACATAATTGTGGNCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTTGAGGAGATNCCCATGAACNNNNNGCCTTNNCTA
  5   1   2       bld Ga18                              xlk137m11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGTTTGCAATCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGNGGAAGCTGGACACACTCTGTGACTTGTACGAGANCCTGACAATCACACAGGCCGNTATCTTTATCAACACTCGCCGGAAGNGGACTGGCTAACGGAGAAGATGCATNNNAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGNCCAGAAGG
  5   1   2       bld Ooc1      in                     Ooc1-db26c08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGTCGACCCACGCGTCCGAGATAGAGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAAGCCGNTATCTTTATAAACACTCGCCCGGAGGTGGACTGGCTAACGGAAAAGATGC
  5   1   2       bld Egg4      in                    IMAGE:3744907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATCTCCATTCTGCAGCAGATAGAGCNNTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAAAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATT
  5   1   2       bld Ga18      in                       xlk77p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGNCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGANCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGNGGACTGGCTAACGGAGAAGATGCACGCGANGGANTTCACTGTCTCTGCCCTGCACGGCGACATGGANCAGAAGGAGCGAGACGTCATTATGAGAGAGTNCCGATCTGGNTCCAGTCGTGTTCTGATTACCACAGANTTNCTGGCCCGAGNATTGANGTCCAGCAGGNCTCACTNG
  5   1   2       bld Ga18      in                      xlk153h02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCNNNNNTGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGANCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGANTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGANGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGANTTGCTGGCCCGAG
  5   1   2       bld Ga15                               XL418c13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGATATGAAAGCCACACAGGCCCTGGTGTTGGCACCAACTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCANCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACANANANAACTACATTCACAGGATTGGCCGAAGGGGGCCGTTTTGGT
  5   1   2       bld Ga18                              xlk104b09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGGTGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGANCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGNGGACTGGCTAACGGAGAAGATGCATGCGANGGANTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGANTTNCTGGCCCGAGNATTGATGTCCAACAGGNCTNACTGGTCATTANTATGACTTG
  3   1   2       chi Ga18      in                        xlk2o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAANCnnnnnnAAGCCCTGnnnnnnnCCCCNNNCNNGANCTNNCCCAGNANNNNNNANNAAGTAGTNATNNNCCTNNNAGNNTNCANGGGTNNNGGANNCCATGCCTGCATNGGGGGCNCCNACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGANNCTCCCCATATAGTCGTGGNNACCCCGGGCAGAGTGTTTGACATGTTGNACAGGCGCTACCTNNCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACANNNCCACAGTCGAGGAGATNCCCATGAACGTGNCAG
  5   1   2       bld Emb4                   IMAGE:5543528-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGT
  5   1   2       chi Emb4                            IMAGE:5543528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGCCCTGGTGTTGGCCCCAACCCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCCGAGGCATTGATGTCCAACAGGTCTCACTGGGTCATTAACTATGACTTGCCGGACCAACAGAGAAGAACTACTTTCACAGGAATTGGCCCAAGGGGGCCCGGTTTCGGTTAAGGAAAGGGAACCCCCATTAACAGTGGTGGCCCGAAAAATGACCAcccccccccccTGCAAGAACACTAAAGACTTTTCCTACAACACCCCCCGTTCCAAAGGAAATGCCCCATTGCAACTTGGC
  5  -1   2       chi Emb1                            IMAGE:6633946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      gggggggccaccaaaagggggagggggCTGGAAGGGTACCAAAGAACGCTTCCCCTTTCGGGAAGGCCTCCCCCCCATTATAAGTTGGTGGGGCCAACCCCCCGGGGCCAAAATGTTTTTTGGCCAATTTTTGAAAACAAGGCGGTTTACCCTGGTCGCCCTTAAATGTCACTTAAAGGAAttttttgtttttGGGATGAAAGGCAGGACGGAGGATGTGTGAGTTAAGAGGTTTTCCAAAGGATTCCAAATTCTAATGATATATTTCCCAGAAAGCTTCAAGCAAGTAAACGGTTCAGGGTGGGTTCGTGGTTTTTTCAGCCCACCCATGCCCTGGCCGACGTTGCTGGAGGGTGACCAAAAAAGTTCATGCGGGACCCCTATCCGAAATCCCTGGGAAAAAAGGGAAGAGCTCCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGCTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCAGACCTCATATAAACCTCCCGCCGGAGGGGGCGGaaaaaatggaaaaaaacaaaaaaa
  3   1   2       bld DMZ       in                         xl317l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTGTTGGCACCAANTTCGTGAGCTGGCCCAGCAGATCCAGAAAGTAGTTATGGCCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCCACAGTTGAGGAGATGCCCA
  3   1   2       chi Ga18      in                      xlk151h03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGNGAGCTGGCCCAGNNGNNCNAGAAAGTAGTNATNNCNTNGNAGATTNCANGGTGCNNGGTNCNATGCCTGCATNGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTNGNAGNCTCCCCANATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTNNCCCCTAAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGNTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATNCCCATGAAC
  3   1   2       chi Ga18      in                      xlk160g19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNNGCCNANNAGANCCAGNAAAGTAGTTATGGCCNNNGNNNNNTACANNNNTNNNGGATNCNATGCCTGCNNNGGGGCNCCAACGTGANGGCTGAAGTACANAAGCTGCAGTCGNANNCNNCCANATAGTCGNGGNNACCCCGGNCAGAGTGTTTGACATGTNGNACAGGCGCTACCTNTNCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGNCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATNCCCATGAAC
  3   1   2       bld Ga18      in                      xlk157c07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCAGNAGnnnnnAAAGTnnnnnnnCCTGGnnnnnnnnATGGNTGCNGGATNCNATGCCTGCATNGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGNANNCTCCCCANATAGTCGNGGCNCCCNGGGCAGAGTGTTTGACATGTTGNACAGGNGCTACCTNTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGNCGAGATGTTGAGTAGAGGTTTCAAGGATCAANTCTATGATATNTTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGNGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCAGACCTCATATAAACCTCCGCCGGAGGGGGCGGAAAAAATGGAAAAAAACAGAAAAAAGCATAAAATGAAAATAAAAAAAGTGAGCCCCGGGTTTCTTTGGGGCGTCGGCTGAATGGGGTTGTACAGCATTTACCGTAAAGCCCTGTAACGATTNNNNTNNCNCCNCTCCCTNNGNCTCNCT
  5   1   2       bld Ga15                               XL449f22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAAGTAGTTATGGCCCTGGGAGATTACATGGGTGCCGGATGCCATGCCCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTC
  3   1   2       bld Ga18      in                      xlk160d18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANNAAGTAGTTANGNCCCTGGNNNATTACATGGNNNNNGGATNNCATGCCTGCATNGGGGGNANCNACGTGANGGCTGAAGTACAGAAGCNGCAGTCGNNNNCTCCCCANATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTNNACAGGCGCTACCTNTNCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATGCCCATGAACNNNNNNCCTNNNNNAA
  3   1   2       chi Ga18                              rxlk78l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGNAGTTATGGNNCNNGGAGNTNATATGNGTNCCNNGTNCCATNCCTGCNTCGGGGGNNCCANCGTNANNGCTGAAGTACAGAAGCTGNAGTNGGAGGCTNCNTCACATAATTGTGGGCACCCNGGGNAGAGTGTTCGANATGTNGNACAGNCGNTACCTNNCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAAGGATCAAATCTATGATATATTCCNNGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTNAGNCNCCATGCCTGNCGNNGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAANAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGNNGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGNCCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCNCGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNNAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGNGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTTGAGGAGNNNNCNATGNNCGTGNNA
  3   1   2       bld Ga18      in                      xlk107p17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANNAAGTAGTNATGNCCCTGGNNNTTNTATNGGTNCNNCGTNCCATGCTTGCATCGGGGGCNCCNACGTGANGGCTGAAGTACAGAAGCTGNAGTNGGNANCTCCTCACATANTNNTGGNNACCCCGGGCAGAGTNTTCGACATGTTGNNCAGGCGNTNNCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAANTCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTNNNNNTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTTGAGGAGATNNCCATGAAC
  3   1   2       bld Ga18      in                      xlk129n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAANTAGTTATGNCCCTGGNNNNNNATANNGNNNCCTCGNNNNATNCTTGCATNGGGGGCACCANCGTGAGGGCTGAAGTACAGAAGCTGCAGTNGNAANCTCCTCACATAATTGTGGGNACCCCGGGCAGAGTNTTCGACATGTTGNACAGGCGGTNNCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGNCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNNCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTTGAGGAGANNCCCATGANCGTGNNA
  5   1   2       bld DMZ                                  xl293m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTGGGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCANA
  3   1   2       bld Ga18      in                      xlk150l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CNTGGNAGNNNTANNGNTNCCNCGNNCATGCNTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAANCTCCTCACATAATTGTGGGNACCCCGGGCAGAGTGTTCGACATGTNGAACAGGCGNNNNCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCNNNCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTTGAGGAGANNCCCATGAAC
  5   1   2       bld Ga15      in                       XL451n11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGATTATATGGGTGCCTCGTGCCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGANTTGCCATCAACATGGTTACAGAA
  3   1   2       chi Te2       in                    IMAGE:7391250.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGATCAGTTAATCCCTACGATGCGAGGTCGGAGTATACAGCTGTGGACTCATCGCGGAGCATCAGTGTTACTCATGAGCACGGACGATCAGCTCCGATTAGCTAGCGCGGACGATACATTCACACAGAACAGTATGACATAGCCTATTAGTGACATATAGACAGTTTCGTCCGNAATTCCCGGGTAGACGAGATGTGAGTAGAGTTTCAAGGATCAAATCTATGATATATCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCAGACCTCATATAAACCTCCCGCCGGAGGGGGCGGAAAAAATGAAAAACGANATGCTAAACT
  3   1   2       bld Ga18      in                      xlk107e13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANGGNTGCCTCGNNNNANNCTTGNNTCGGGGGCNCCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCNTCNCATAATTGTGGNCACCCCGGGCAGAGTNTTCGACATGTTGAACAGGNGNTNCCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATNCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATGAACNNNNNNCCNNNNCTA
  3   1   2       chi Ga18      in                      xlk124a05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATNNCNNNNTCAGGCTCAGTCTGGNACTGGGAAAACANCCACGTTTGCGANCTCCATTCTGCAGCAGATAGAGCTGGATATGAAAGCCACACAAGCCCTGGTGTTGGCCCCAACCCGTGANCTGNNCCAGCAGCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTCGAGGAGATNNCCATGAAC
  3   1   2       bld Ga18      in                      xlk129n13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNGNTGCCTCGTNCCATNCTTGCATCGGGGGNNCCNACGTGNGGGCTGAAGTACAGAAGCTGCAGTCGGAANCTCNTCACATAATTGTGGNNACCCCGGGCAGAGTGTTCGACATGTTGNACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNNCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACANCNCCACAGTTGAGGAGATNNCCATGAAC
  3   1   2       bld Ga18      in                      xlk149k01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCNCGTNCCANGCTTNCATNGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAANCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTNGAACAGNNGNTACCTNTNCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGNGGATGAGATGTNGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCNNNCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTTGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTTGAGGAGATNNCCATGAAC
  3   1   2       bld Ga18      in                       xlk59i05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNATGCNANNCTGCANNGGGGGNNNCNACNNNAGGGCTGANGTANANANCTGCANTCGNAGNCTCCCCNNATAGTCGTGGGCNCCCGGGCAGAGTGTTTGACATGTTGAACAGNNGCTACCTNNCCCCNAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAANTCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGNCCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCNAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATNCCCATGAACGTGNNAGCCTCAT
  3   1   2       bld Ga18      in                       xlk71i17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATGCTTGCATCGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAANCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGNCTTTCTACAACNCCACAGTTGAGGAGATNCCCATGAACNNNNNGNNNNNCTA
  3   1   2       bld DMZ       in                         xl278c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGCTTGCATCNGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCA
  5   1   2       bld Ga18      in                       xlk71i17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATNNTTNCATCGGGGGNNCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGNNNNNTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGANCAACAGAGAGAACTACATTCACAGGANTNGGCCGAGGGGNNCGTTTCGGTAGGAAAGGAGTTNCCATCAACATGGNTACNGAAGATGACAAGNGCACACTGAAAGNNATAGAGANTTT
  5   1   2       bld Ga15                               XL406k01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGCATTGGGGGCACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGGATTGGCCGA
  3   1   2       bld Ga18      in                       xlk52k11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNTGCATCGGGGGCNCCANCGTGAGGNCTGANGTACAGAAGCTGCAGTCGNAAGCNCCTCACATAATTNTGGGNNCCCCGGGCAGAGTNNTCGACATGTTGAACAGGCGNTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGNCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATNCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATGAACGTGNNAGCCNNNNCTNA
  3   1   2       bld Ga18 5g3  in                      xlk107j21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTGCATNNGGGGCNCNANCGTGANGGCTGANGTANAGAAGCTGNAGTCGNANNCTCCCCANATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTNGNACAGGNNCTACCTNNCCCCNAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAANTCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNNNAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGNNAGCCTCATATAANNNNCNCNG
  3   1   2       bld Ga18                             rxlk164d10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCATNGGGGGCACNANNTGANGGCTGAAGTACAGNAGCNGCAGTCGNAANCNCCTCACATAATTGTGGNNACCCCGGGCAGAGTGTTCGACATGTNNNACAGGCNNTNCNNCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGNCCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGNNCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTTGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATGAACGTGNCAGNCCTTATCTAAACNCCGCGGAGGGNNAGAAAAAAA
  3   1   2       bld Ga18 5g3  in                       xlk58n15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ANNNGGGNNNNNCGTGAGGNNTGAAGTACAGNANCTGCAGTNGNAGGCNNCCCANATAGTCGTGGGCNCCCNGGGCAGAGTGTTTGANATGTTGAACAGGNGCTACCTGTCCCCNNATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATNTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTANCGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGNCAGCCTCATATA
  3   1   2       bld Ga18      in                      xlk124n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCACCNACGTGANGGNNGAAGTACANNAGCTGCAGTNGGAANCNCCTCACANNNNNGTGGGCACCCGGGNNGAGTGTTCGACATGTNGNACAGNCGNNNNNTCTNCCCCAAATACATAAAGATGTNTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAANGATCAAATCTATGATATATTCCAGNNNNTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCNNCATNNCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGANAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTNNCCTNNACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTNCCCGAGGCATTGATGTCCANCAGGTCTCNCTGGTCATTAACTATGACTTGCCGNCCAACAGAGAGAACTANATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTNCCATCAACATGGTTACAGAAGATGACAAGCGCACNCTGAAAGACATAGAGCTTTCTACANCNCCACAGTNGNGGAGNNNCCATGAAC
  3   1   2       bld DMZ       in                         xl283b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACCAGTTGAGGAGATGCCCATGAANCGTGGCAGACCTA
  3   1   2       bld DMZ       in                         xl279h15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCAACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCA
  3   1   2       bld DMZ       in                         xl225f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGTGAGGGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGNCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATAACGTG
  3   1   2       bld DMZ       in                         xl264f03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGAAGTACAGAAAGCTGCAGTCGGAAGCTCNTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACNTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCA
  3   1   2       bld DMZ       in                         xl281i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACCAGTTGAGGAGATGCCCA
  3   1   2       bld DMZ       in                         xl298d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGNCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACCAGTTGAGGAGATGCCC
  5   1   2       bld Ga15                               XL422j11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTANGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATANAGACTTTCTACAACACCACAGTTGAGGAG
  5   1   2       bld Thy                             IMAGE:8549781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGCTCCCCAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCATCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGATAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACTTTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGTACTATCACACATGCCGTTATCTTTATCAACACTCGCCTGAAGGTGGACTGGCTAATGGATAAGATGCTTGCGAGGGACTTCACTGTCTCTTCTCTGCATGGAGACATGGACCAGAATGAGCGTGACGTCTTTATGAGAAGAGTTCCGATCTGGATTCCGTCGTGTTCCGATTACCTCAGATTTGCTTGCCCTAGGCATTGTATTCCTACTGTCTCAGTGGTCTTTCTATGACTTGCCTACATCTGTGATACTACTTTCCTGGATTGGCGTTGGGCCTCTCTGTTGAAAGTTTCTCTTATATTGTTACGATATTACGGTCCCACTTTATATTGTACTTTTTATATCCTATTTTAGAATTTCTGAAGTGATATTTTTTAATCCTTTCGTGTGGGGTAAATTTATTCTCATTG
  3   1   2       bld DMZ       in                         xl289c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAAGTACAGAAGCTGCAGTCGGAGGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCA
  3   1   2       bld DMZ       in                         xl340i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCA
  3   1   2       bld Ga15      in                       XL492n13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTACAGAAGCTGCAGTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGGCAGAGTGTTTGACATGTTGAANCAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAAACGTGGCAGACCTCA
  3   1   2       bld DMZ  5g3  out                        xl316c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGTACAGAAGCTGCAGTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTNTGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTG
  3   1   2       bld Ga15 5g3  in                       XL428a07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAGTCGGAGGCTCCCCCATATAGTCGTGGGCANCCCCGGGCAGAGGTGTTTTGACATGTTGAACAGGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGGCAGACCTCATA
  5   1   2       bld Ga15      in                       XL496g06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AANCTGCANTCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCANACGAGATGTTGAGTANAGGTTTCAAGGATCAAATCTATGATATATTCCANAAGCTCANCAGTAACGCTCANGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAA
  3   1   2       bld Ga18      in                       xlk52m15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANCTGCANTNGNAGGNNNCCCANATAGTCGTGGGCNCCCNGGGCAGANTNTTTGNCATGTTGAACAGGCNCTACCTNTCCCCTAAATACNNAAAGATGTTTGTTTNGGATGAAGCAGACGAGATGTTGAGTAGAGNTTTCAAGGATCAANTCTATGATATNTNCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCANNCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCNNNNCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACNCCACAGTCGAGGAGATGCCCATGAAC
  3   1   2       bld DMZ       in                         xl308b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCGGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCA
  3   1   2       bld DMZ       in                         xl334d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGAAGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTTGCCATCAACATGGTTACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTTGAGGAGATGCCCATGAACGTGGCAGACCT
  5   1   2       bld DMZ       out                        xl247l06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGAGGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACNAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCANAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGA
  3   1   2       bld Ga18                             rxlk131f20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGNGGACGCGTGGGCGGACGCGTGGGCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTNTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTNCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTNNNNNAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCATGAACGTGNNAGNNCTCATATAANNNNCGCGG
  5   1   2       bld Brn3                            IMAGE:8536491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACACAGTCGAGGAGAGCCCATGACGTGGCAGACTCATATAACCTCCGCCGANGGGGCGAAAATGNANNAAACGAAAAGCTAAATGAAA
  3   1   2       bld DMZ       in                         xl286i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTCCCCATATAGTCGTGGGCACCCCGGGCAGAGTGTTTGACATGTTGAACAGGCGCTACCTGTCCCCTAAATACATAAAGATGTTTGTTTTGGATGAAGCAGACGAGATGTTGAGTAGAGGTTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAACGCTCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAAAAGTTCATGCGGGACCCTATCCGAATCCTGGTGAAAAAGGAAGAGCTCACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACACTCTGTGACTTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATCAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCATGCGAGGGACTTCACTGTCTCTGCCCTGCACGGAGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAACAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCCGTTTCGGTAGGAAAGGAGTCGCCATTAACATGGTGACAGAAGATGACAAGCGCACACTGAAAGACATAGAGACTTTCTACAACACCACAGTCGAGGAGATGCCCA
  3   1   2       bld DMZ       in                         xl336d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTCCTCACATAATTGTGGGCACCCCGGGCAGAGTGTTCGACATGTTGAACAGGCGGTACCTCTCCCCCAAATACATAAAGATGTTTGTGCTGGATGAAGCAGATGAGATGTTGAGTAGAGGCTTCAAGGATCAAATCTATGATATATTCCAGAAGCTCAGCAGTAATGCCCAGGTGGTCCTGCTCTCAGCCACCATGCCTGCCGACGTGCTGGAGGTGACCAAGAAGTTCATGCGGGACCCTATCCGAATCCTGGTCAAAAAGGAAGAACTGACCCTGGAGGGTATTAGGCAGTTCTACATTAATGTTGAGCGAGAGGAGTGGAAGCTGGACACGCTCTGTGACCTGTACGAGACCCTGACAATCACACAGGCCGTTATCTTTATAAACACTCGCCGGAAGGTGGACTGGCTAACGGAGAAGATGCACGCGAGGGACTTCACTGTCTCTGCCCTGCACGGCGACATGGACCAGAAGGAGCGAGACGTCATTATGAGAGAGTTCCGATCTGGATCCAGTCGTGTTCTGATTACCACAGATTTGCTGGCCCGAGGCATTGATGTCCAGCAGGTCTCACTGGTCATTAACTATGACTTGCCGACCAACAGAGAGAACTACATTCACAGGATTGGCCGAGGGGGCC