Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL506p11ex.5                        391 PI      93         40     2170                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:6938290.5                       4 PI      75        453     1196                hypothetical protein LOC549535 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012767109 Xl3.1-XL519l13ex.3 - 361 ESTs
                                                                       -80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL519l13ex.3                                                                                 CTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685039                                                                                       TACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAAAAAAAAAA
                                                      consensus depths                                                                                     71    82    79    91    94    97    95    98    95   100    96   101    97   102    98   103   100   103   100   103   100   104   101   105   101   105   101   105   101   105   104   106   103   105   104   104   105   105   104   105   104   106   105   106   105   106   107   107   108   109   110   110   111   111   108   112   111   112   113   113   112   114   115   117   115   116   114   116    94   116    94   116    95   116    96   117    98   120    98   120    96   118    94   116    94   116    94   118    95   118    94   116    93   115    92   114    91   115    90   114    89   111    92   113    88   110    87   109    79   106    79   106    64    92    58    87    45    73    34    66    30    64    21    53    24    46    24    44    23    41    21    40    22    37    22    37    19    36    20    36    20    35    23    33    21    30    21    29    22    28    21    27    21    28    20    28    22    27    21    24    22    25    21    26    21    26    20    25    22    27    22    28    23    29    26    32    27    32    27    33    27    32    30    36    28    35    26    35    26    34    26    34    27    34    27    33    26    33    27    33    27    34    28    35    28    35    28    36    29    38    29    40    30    40    30    41    30    43    30    42    33    45    36    53    38    57    39    57    42    60    52    73    58    76    59    78    74    92    71    93    81    98   108   121   109   122   112   124   112   125   110   126   104   127   120   131   121   132   122   132   123   135   145   159   155   172   150   173   154   177   164   179   163   180   167   182   166   182   169   182   175   185   176   187   177   187   176   187   167   188   171   187   176   187   176   185   180   188   181   188   173   185   162   184   178   185   179   185   182   187   180   186   176   185   181   185   180   184   173   183   179   184   182   186   179   183   174   186   180   191   178   191   176   191   159   189   171   188   153   185   145   185    97   148    95   144    87   141    66   124    57    99    34    64    32    58    32    55    25    43     5     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGCACATTACTTCTTTAGACTGGGTAGCCTAACCTTTGTTTTTCAGCCTTGATTCCTCTCCGGAACAACTTTGTCTAACTTGTGGTTTTGGTCTGACGCTTGTGGTGTGCAAAACCTTATTTGCCTCCTCGTTTTGCCACACTGCAACACTTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGGTTAGTAAGTTCAATCTGCTTATCTTGGGTAACTACTCACTAATGGACTACTTTTTTTGTGAAATGTATTTGTTTTTAAAGAAAGTTTATTTGCTTTCTTTAACCTCTGAAATTCTCTTGAGTTTTGTT
                                                                   SNP                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------AA----
                                               BLH ATG      42    1702                                                                                 
                                               BLH MIN      24     397                                                                                 
                                               BLH OVR      42      94                                                                                 
                                               EST CLI      -3      72                                                                                 
                                               ORF LNG      42      17                                                                                 
  3  -1   2       chi Ga11                            IMAGE:3475407.3p GCTGGAGCTAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGNGATTGTCCA
  5   1   2       bld Spl  5g                         IMAGE:8461572.5p                                 AATANNNNCCTGATTACNGNAAGAACATCAATAAAATTCGTCCCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAGGGNACACAGATCCGTGATCTGGAAAGAGGAGTGAAATCTGCAATTGCACACCTNAAGGCTGATAGATTTCCTTGAGCAGGAAGACAATCTGACAGATGCCATATTTGTGCTGATGAACAACAAATGCTGACTGGC
  5   1   2       bld Spl  5g3  in                    IMAGE:8463421.5p                                     GTTTTTACCCAATTAGAAGCTAATTNNNNNNNTNTNNNNTNTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACTTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCCACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCACCTGTTATTATTGCGGGGCCCCAAGGGACCCAGATCCGTGATCTGGAAGGAGGATTGAAATCTGCATTGCACACCTGAAGGTTGAAGATTTCTTGAAC
  5   1   2       bld Spl  5g                         IMAGE:8462374.5p                                                           AAAANNCNCCATTNNGNNNGAGATCCTCGATTGAATTGTCCCGTACGTCCTTTGTCTAGCAACATGCCCGGATTTACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAATCTGCATTGCACACCTGGAAGCTGATAGATTCCTTTGAGCAGAAGACCATCTGACAGATGCACTATTGGTGCTGATGAGCAGACGATGCTGACTGGCTTTAGCTCGATAGAAGATGTAACAGATCACTGACGACACCTG
  5   1   2       bld Ga15 5g3  in                       XL468d13ex.5p                                                                 CCCACGCGATCCGCCCTTCTGTACAGCTGGTCTCGTTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATANATTTCCTTGAAGCAGGAAAGACCA
  5   1   2       bld Oo1  5g                         IMAGE:6641324.5p                                                                      CCGTATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCCACATTATTTGGGTGGGCTTGATGAAGCAGACAGAATGGCTTGACATGGNGCTTTGAGCCCTCAGATAAGGAAAGATTAGTAGACCCAGATTCGACCTGACAGACAAANCCNNCTGGATGGTGGAGTGGCACTTTTGGGCCCTAAAGAAAGTCCGNCCAAACCTTGGCTTGAAGGATTTTTCCTGA
  5   1   2       bld Ga15 5g3  in                       XL404d23ex.5p                                                                       CGTATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCAGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCTGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCCTGGAA
  5   1   2       bld DMZ       in                         xl283a13.5p                                                                         CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTAGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGG
  5   1   2       bld Neu4 5g3  in                    IMAGE:4084488.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCT
  5   1   2       bld Eye1 5g                         IMAGE:6959508.5p                                                                          GTATCCTCCCTTCTGTCAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACGGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCCTGGAAGGCTGATAGATTTCCTTGAAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCCTCGATAAGAAAAGATGGTAGACCCGAATCGACCCGACAGA
  5   1   2       bld Ga15 5g3  in                       XL422m20ex.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCT
  5   1   2       bld Ga15 5g3  in                       XL438l12ex.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATANATTTCCTTGAAGCAGG
  5   1   2       bld Ga15 5g3  in                       XL462i05ex.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAANCANACAGAATGCTTG
  5   1   2       bld Ga15 5g3  in                       XL496f23ex.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGNAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACNGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGNACATCTGGCANATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCANAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAA
  5   1   2       bld Ga18 5g                            xlk67j10ex.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGNGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACNNNCCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGNNNNNGTCGTCTGAGGNCCACCTGTATTTATGGCGNNNNCNCAAAGGNNCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGNAAGNTGATAGATTTCCTTGAAGCAGGNAAAGACCNATCTGAANAGATGCACATATTTGGNNNT
  5   1   2       bld Ga18 5g                           xlk125n12ex.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACNANCCAGGGAATTGGCTCAACAGGNTCAGCAAGTGGCTGCAGAGTATGGCAGNNNTTGTCGTCTGAGGNCCACCT
  5   1   2       bld DMZ  5g3  in                         xl300n24.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGG
  5   1   2       bld DMZ  5g3  in                         xl253c04.5p                                                                          ATCCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTG
  5   1   2       bld DMZ  5g3  in                         xl269f17.5p                                                                           CCTCCCTTCTGTACAGCTGGATCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACTGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAANAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCACGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAANCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAANCGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGG
  5   1   2       bld Ga15 5g3  in                       XL472e18ex.5p                                                                            CCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTT
  5   1   2       bld Thy  5g                         IMAGE:8549523.5p                                                                            CCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACGGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCACACCTGGAAGCTGATAGATTCCTTGAGCANGAAGACCATCTGACAATGCACTATTGTGCTGATGAGCAGACGATGCTGACTGGCTTG
  5   1   2       bld Ga18 5g                            xlk79h16ex.5p                                                                            CCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGANGGTCCAATTCTTTTGGTGCTGGCACNAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGNTGCAGAGTATGGCAGNNNNTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGNCCCCAAANGGNNCACAGATCCGTGATCTGGNAAGAGGAGTTGAAATCTGCATTNNAACACCTNGNAAGNTGATAGATTTCCTTGAAGC
  5   1   2       bld DMZ  5g3  in                         xl261p12.5p                                                                            CCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGG
  5   1   2       bld DMZ  5g3  in                         xl239m11.5p                                                                            CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACNGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGCTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCATGAATGTGATCANTACAGAAGAAGCANAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCANGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCNAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAGCAGGTTCAGCAAGTGGCTGCAG
  5   1   2       bld DMZ  5g3  in                         xl234l16.5p                                                                            CCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCAGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTG
  5   1   2       bld DMZ  5g3  in                         xl226j08.5p                                                                            CCTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGG
  5   1   2       bld DMZ  5g3  in                         xl339m14.5p                                                                            CTCCCTTCTGTACAGCTGGTCTCGGTANCGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACNGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACNTCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCANTACAGAAGAAGCANAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAANCANGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGNCTCTAANTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCANGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACTGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACC
  5   1   2       bld Ooc3 5g                         IMAGE:3472883.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGAAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGNGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACAACC
  5   1   2       bld Ooc3 5g                         IMAGE:3472451.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGTATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGNGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTG
  5   1   2       bld Ga15 5g3  in                       XL418p22ex.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGG
  5   1   2       bld Ga15 5g3  in                       XL427p02ex.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCAGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAAGGCTGATANATTTCCTTGAAGC
  5   1   2       bld Ga15 5g3  in                       XL436j22ex.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATANATTTCCTTGAANCA
  5   1   2       bld Ga15 5g3  in                       XL467m16ex.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATANATTTCCTTGAA
  5   1   2       bld Ga15 5g3  in                       XL517j15ex.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGGTGCTTGATGAAGCAGACAGAATGCTTG
  5   1   2       bld Ga15 5g3  in                       XL518f11ex.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGA
  5   1   2       bld Emb9 5g3  in                    IMAGE:7974064.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCAGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAAGTCCACCTGTATTATGGCGGGCCCCAAAGGGACCACATTCCGTGATCTGGAAAGAGAGTTAAATCTGCATGCACACCTGGGGCTGATAATTTCTTGAGCAGGAAGACAATCGACAGAGCCATTTTGTGCTGAGAGCGACGATGCTGAATGGCTTGACCTAATAGAAATATACCGTCCACTGCAACACCTGTTGAGGCCTGCCAAATCGGATTGCAATTTAAGTG
  5   1   2       bld Emb9 5g                         IMAGE:7974166.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCAGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCCACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCTCCAAGGGACCACAGATCCTTGATCTGGAAAGAGAGTTAAATTCGCTTGCAACACCTGGATGGTGATAATTTCTTGAACATGAAGACCATCTGACGATGCCTTTT
  5   1   2       bld Emb9 5g                         IMAGE:7974389.5p                                                                             CCTCCCTTCTGTACGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCGGAAAGACCATCTGAACAAAGCACATATTGGTG
  5   1   2       bld FaB  5g                         IMAGE:8072462.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACACAGATCCGTGATTTGGAAGAGGAGTTGAATCTGCATTGCAACCCTGGAAGCTGATAATTTCTTGAACAAGACGACCATCTGAA
  5   1   2       bld Ga18 5g                           xlk113h24ex.5p                                                                             CCTCCCTTCTGTACAGCTGGNTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGNCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGNTCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGNNCCAATTCTTTTGGTGCTNGCACNACCCAGGNATTGGCTCAACAGGTTCAGCAAGTGNNTGCAGAGNAT
  5   1   2       bld Ga18      in                      xlk123h18ex.5p                                                                             CNCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCANNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACAACCAGGGAATTGGNTCAACAGGNTNCAGCAAGTGGNTGCAGAGNATGGCAGNNNNGTCGTCTGAGGNCCACCNNTATTTATGGNGGGNCCCCAAAGGNNCNCAGATCCGT
  5   1   2       bld DMZ  5g3  in                         xl332o18.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTG
  5   1   2       bld DMZ  5g3  in                         xl333k20.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAATCTGCATT
  5   1   2       bld DMZ  5g3  in                         xl334k20.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAG
  5   1   2       bld DMZ  5g3  in                         xl228l15.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGANGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGC
  5   1   2       bld DMZ  5g3  in                         xl238d13.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATT
  5   1   2       bld DMZ  5g3  in                         xl252f12.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATT
  5   1   2       bld DMZ  5g3  in                         xl244a16.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAA
  5   1   2       bld DMZ  5g3  in                         xl322b12.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGNCCCCAAAGGGACCACAGATCCGTGATCTGGA
  5   1   2       bld DMZ  5g3  in                         xl304k05.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACNTCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCAT
  5   1   2       bld DMZ  5g3  in                         xl293d02.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATT
  5   1   2       bld DMZ  5g3  in                         xl321k10.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCG
  5   1   2       bld DMZ  5g3  in                         xl315n16.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACA
  5   1   2       bld DMZ  5g3  in                         xl315d13.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCAT
  5   1   2       bld DMZ  5g3  in                         xl284p13.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCC
  5   1   2       bld DMZ  5g3  in                         xl275m11.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAA
  5   1   2       bld DMZ  5g3  in                         xl328a12.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAA
  5   1   2       bld DMZ  5g3  in                         xl341h20.5p                                                                             CTCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATT
  5   1   2       bld Te2N 5g                         IMAGE:7768529.5p                                                                              TCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTTGCACACCTGNAAGGCTGATAGATTTCCTTTTGAGCAGGAAGACCAATCTGAACAGATGCACA
  5   1   2       bld Int2 5g                         IMAGE:8528006.5p                                                                              TCCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACGGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGNAAGAGGAGTTGAATCTGCATTGCACACCTGGAGGCTGATAGATTTCTTGAAAGCAGAAGACCATCT
  5   1   2       bld Tbd7 5g                              XL100d23.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCA
  5   1   2       bld Ga15 5g3  in                       XL499b13ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATANATTTCCTTGAAGCANGA
  5   1   2       bld Ga18 5g                           xlk146m07ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGNACNACCAGGGAATTGGNTCAACAGGTTCAGCAAGTGGNTGCAGAGTATGNNAGANNNGTCGTCTGAGGNCCACCTGTATTTATGGCGGGNCCCCAAANGGNNCACAGATCCGTGATCTGGAANGAGGAGNTNAAATCTGCATTGCAACACCTNGNAGNTGATAGATTTCCTTGAAGNAGGAANNACCNATCTGAACA
  5   1   2       bld Ga18 5g                           xlk115m04ex.5p                                                                               CCCTTCTGTACAGCTGGNCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACNAACCAGGGAATTGGCTCAACAGGTNCAGCAAGTGGCTGCAGAGTATGGCANNNNNNGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGNNCACAGATCCGTGANCTGNAAAGAGGNGTTGAAATCTNCANTGCAACACCTGGAAGNTGATAGATTTCCTTTGAAGCAGNAAAGANNNATCTGANCNG
  5   1   2       bld Ga18 5g                            xlk59i13ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCANNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGNGCTGGCACCAACCAGGGAANTGGCTCAACAGGTNCAGCAAGTGGNTGCAGAGTATGGCANNNNNTGTCGTCTGAGGNCCACCTGTATTNATGGNGGGNCCCCAAAGGNNCACAGATCCGTGANCTGGAAAGAGGNGTNGAAATCTGCANTGCNACACCTGGANGNTGNNAGATTTCCTTGAAGNANG
  5   1   2       bld Ga18 5g                             xlk5i06ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCANNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACNAACCAGGGAATTGGCTCAACAGGNTCAGCAAGTGGCTGCAGAGTATGGCAGNNNTGTCGNCTGAGGNCCACCTGTATTTATGGCGGGGCCCCAAAGGNCCACAGATCCGTGATCTGGAAAGAGGANNTGAAATCTGCATTNNAACACCTGGNAAGNTGATAGATTTNCNTTGAAGCAGGAANGACCNATCTGAACAGANGC
  5   1   2       bld Ga18 5g                           xlk139h19ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGNNACNAACNAGGGAATTGGCTCAACAGGNTCAGCAAGTGGCTGCAGAGTATGGCANNNNNNGTCGTCTGAGGNCCACCTGTATTTATGGCGGGGCCCCAAAGGNNCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTNNAACACCTGGANGCTGATAGATTTCCTTGAAGCAGGAAAGANCNATCTGANCAGNNNCACATATTTGGT
  5   1   2       bld Ga18 5g                           xlk104m13ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGNTCAGCAAGTGGCTGCAGAGTATGGCNGNNNNTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAANGGNCCACAGATCCGTGATCTGGNAAGAGGAGTTGAAATCTGCATTGCNACACCTGGAAGNTGATAGATTTNCTTGAAGCAGGAAAGNNCAATCTGAA
  5   1   2       bld Ga18 5g                           xlk125k17ex.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGANTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGNCCAATTCTTTTGGTGCTGGCACNANCCAGGNAANTGGCTCAACAGGTTCAGCAAGNGGCTGCAGAGNATG
  5   1   2       bld DMZ  5g3  in                         xl230h09.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCCTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAA
  5   1   2       bld DMZ  5g3  in                         xl319m18.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAA
  5   1   2       bld DMZ  5g3  in                         xl315h09.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCANGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCNAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGG
  5   1   2       bld DMZ  5g                              xl263n19.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAANAANCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCNCTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCC
  5   1   2       bld DMZ  5g3  in                         xl279n18.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTG
  5   1   2       bld DMZ  5g3  in                         xl258p06.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGA
  5   1   2       bld DMZ  5g3  in                         xl329n05.5p                                                                               CCCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTG
  5   1   2       bld Ov1  5g                         IMAGE:6316882.5p                                                                                CCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGNGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTTCCTTGAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGGTGCTTGATGAAGCCAGAACAGAATGCTTTGACATTGGGGCTTTTGAGCCCTTCAGATAAGAAAAGATTAGTAGGACCAGGATTCCGAACCTGGACAGGACAT
  5   1   2       bld Ga18 5g                           xlk135d08ex.5p                                                                                CCTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACAACCAGGGAATTGGCTCAACAGGTNCAGCAAGTGGCTGCAGAGTATGNNAGANTNGTCGTCTGAGGNCCACCTGTATTTATGGNGGGNCCCCAAAGGNNCACAGNTCCNNTGATCTGNAANGAGGAGTTGAAATCTGC
  5   1   2       bld DMZ  5g3  in                         xl239a01.5p                                                                                CTTCTGTACAGCTGGTTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAA
  5   1   2       bld Ga18      in                       xlk71l23ex.5p                                                                                 CCTTCTGTACAGCTGNNTCGTAACGNCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGNATCGAGGCCGAGATAGAGGANTTGGAGGNGGNCCTCGATTTGGGGGAAACAGAGGNGGNACATCTGGCAAATATGGAAACCCCGGGGAGCNNCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGANGNNGTGAGACGAACACCGCAAGAATNTGATCAGNACAGAAGAAGCAAAGAGATAACCGTACGAGGGANTAACTGTCCAAAANCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCNATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGNNGGTCCAATTCTNTT
  5   1   2       bld DMZ  5g                              xl250n12.5p                                                                                 CTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAANCANGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCANAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCANGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCNGAGCTTGTCGTCTGA
  5   1   2       bld DMZ  5g3  in                         xl226i13.5p                                                                                 CTTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAG
  5   1   2       bld Ga18      in                      xlk106o23ex.5p                                                                                  TTCTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACNAACCAGGGAATTGGCTCAACAGGNTCAGCAAGTGGCTGCAGAGTATGGCAGNNNNNGTCGTCTGAGGNNCACCTGTATTTATGGCGGGNNCCCAAAGGNNCACAGATCCGTGATCTNNAAAGAGGNGTTGAAATCTGCATTNCAA
  5   1   2       bld Emb1 5g                         IMAGE:6862986.5p                                                                                    CTGTACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACGGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTTGGTGCTTGATGAAGCAGACAGAATGCTTGGACATGGGCTTTTGAGCCCTCAAATAAAGAAAGATTAGTAGACCAGGATTTCGACCCTGGACAGACCAAACACCTGAATGTTGGGAGTGCCCCACTC
  5   1   2       bld Ga15 5g3  in                       XL473n15ex.5p                                                                                       TACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAAGGCTGATANATTTCCTTGAAGCAGGNAAAGACCAATCTGAACANATGCACATATTTGGTG
  5   1   2       chi Emb9      in                    IMAGE:7976190.5p                                                                                       TACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAAGGAATTTGGCTCACAGGTTCAGCCAGTGGCTGCAGAGTATGGCAGAACTTGTCCTCTGAGGTCCCCTGTATTTAGGCGGGGCCCCCAGGGACACAAATCCTGATCTGAAAAAGAATGAAACTCCTTGCACCCTGGAAGCTTAAAATTCCTTGGCAGGAAAACATTGAAAATCCCATTTGTGCTGAATACAAAAATCTGCATGCTTAACCCAAAAAAATAGAACAATCCCCACAAACCGTGTGAGCTTGCAAATTCGCTG
  5   1   2       bld Ga18 5g                           xlk132g02ex.5p                                                                                       TACAGCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACNACCCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGACNTNGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGNNNACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTNCAA
  5   1   2       bld Neu7 5g3  in                         XL016p09.5p                                                                                           GCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTC
  5   1   2       bld Tbd7      in                         XL104p23.5p                                                                                           GCTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTG
  5   1   2       bld Ga15 5g3  in                       XL473b13ex.5p                                                                                            CTGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAAGGCTGATAGATTTCCTTGAAGC
  5   1   2       bld DMZ  5g3  in                         xl337p17.5p                                                                                             TGGTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGA
  5   1   2       bld Eye1 5g                         IMAGE:7019531.5p                                                                                               GTCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACGGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGGNAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGAACGAATGCTTTGACATGGGCTTTGAGCCTCCGATTAAGAAGGATAGTTGAACCGGAATTCGACCTGACCGACAAACCCCTGGATGTG
  5   1   2       bld Ga15 5g3  in                       XL423m23ex.5p                                                                                                TCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAAT
  5   1   2       bld Ga18 5g   ?                        xlk75b08ex.5p                                                                                                TCTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGNCACNAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGANNNTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAANGGANCACAGATCCGTGATCTGGAAAGAGGAGNTGAAATCTGCATTNCAACACCTNGNAAGNTGATAGATTTCCTTGAAGCAGGAAAGANCNATCTGAACAGANGCNCATATTTGGTGCTTGANGAAGCAGACAGAA
  5   1   2       bld Ga18 5g                           xlk118a20ex.5p                                                                                                 CTCGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTNNNACNANCCAGGGAATTG
  5   1   2       bld Ga18 5x                           xlk158g06ex.5p                                                                                                   CGTAACGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGNTCAGCAAGTGGCTGCAGAGTATGGCAGNNNNGTCGTCTGAGGNCCACCTGTATTTATGGCGGGGCCCAAAGGNCCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGANCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGANATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGANTCGACCTGACAGACAAACACTGATGTGGAGTNNCACTTGGCCTAAAGAAGNCCGGCAACTTGCTGAAGATTTNTGAGAGANTATGTTCAT
  5   1   2       bld Emb4 5g                         IMAGE:4970840.5p                                                                                                        CGTCCTTTGTCTAGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACGGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGNGAAGAGGAGTTGAAATCTGCATTTGCACACCTGGAAGGCTGATAGATTTCCTTTGAGCANGAAAGACCNATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGATGCTTGACTGGGCTTTGAGCTCAGATAGAANGATATAGACAGATCGACCTGACGACACCTGATG
  5   1   2       bld Tad2 5g                         IMAGE:6934383.5p                                                                                                                    GGCAACATGCCCGGATTTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCGAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAAGTCCACCTGTATTTATGGCGGGGCCCCCAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGCTAGATTTTCCTGGAGCCGGAAAGACCATTCTGAACAGATGGCCATATTTGGGTGCTTTGATGAAGCACAACGGAATGCTT
  5   1   2       add DMZ  5g3  in                         xl278g13.5p                                                                                                                       AACNTGCCCGGATTTAACGACAGGGATCNAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACNGAGGTGGTACATCTGGCANATATGGAAACCCCGGGGAGCGGCTTATGAATNAANAANTGGANCCTGGATGAACTGCCG
  5   1   2       bld DMZ  5g3  in                         xl235d16.5p                                                                                                                         CNTGCCCGGATTTAACGACNGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCANGAACATCCTGATGTTGTGAGACGAACACCGCANGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTTAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACANGTTCAGCAAGTGGCTGC
  5   1   2       bld Tbd5      in                    IMAGE:3579792.5p                                                                                                                                    TTAACGACAGGGATCGAGGCCGAGATAGAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGNGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCANAGGGACCACAGATCCGTGATCTGGAAAGAAGAGTTGAAATCTGCATTGCAGCACCTGGAAAGCTG
  5   1   2       add DMZ       in                         xl250g18.5p                                                                                                                                                ATCGAGGCCGANATANAGGATTTGGAGGTGGTCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAGATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGANAANAATTTCTATC
  5   1   2       bld Ga18                              xlk159d17ex.5p                                                                                                                                                          AGATAGAGGANTTGGAGGNGGNCCTCGTTTTGGGGGAAACAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGANNNGTCGTCTGAGGTCCACCTGTATTTATGGCGNNNNNNAAAGGNNCACAGATCCGTGATCTGGAAAGAGGAGNTGAAATCTGCATTGNAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGANCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGANATGGGCTTTGAGCCTCAGATAAGAAAGANAGTAGANCAGANTCGANCTGACAGANAAACACTGATGTGGAGNGNCACTTGNNNTAAAGAAGNCCGGCAACTTGCTGAAGATTTCTGAGAGANTATGTTCATATTAACATTGGNGCCCTGGNNCTCAGNGCC
  5   1   2       bld Emb9                            IMAGE:7977943.5p                                                                                                                                                                                                 CAGAGGTGGTACATCTGGCAAATATGGAAACCCCGGGGAGCGGCTTATGAAGAAAAAATGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGTAATTCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAAGAAAGACCAATCTGAACAGATGCACATATTTGTGTGCTTGATGAAGCAGACAAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAAGATAGTAGACCAGATTCGACCTGACCGACAACACTGGATGTGGAGTGCCATTT
  5   1   2       bld Spl                             IMAGE:8461859.5p                                                                                                                                                                                                              AAAANCCCATCAATTGGNNGCGGATCCATCGATTCGAATTCGTCCCGGAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGANNAGACCATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGANTAGAAAGATAGTAGACCAGAATCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGNCTAAAGAGTCCGGCACTTGCTGAAGATTTCTGAGAACTATGTCATATTACATTGTGCCTG
  5   1   2       bld Ga15      in                       XL519l13ex.5p                                                                                                                                                                                                                                                             GAACCTGGATGAACTGCCAAAATTTGAGAAGAATTTCTATCAAGAACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTG
  5   1   2       bld Tbd3      in                    IMAGE:3550069.5p                                                                                                                                                                                                                                                                                                         AACATCCTGATGTTGTGAGACGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATA
  5   1   2       bld Ga18                               xlk55p04ex.5p                                                                                                                                                                                                                                                                                                                        TGAGNNGAACACCGCAAGAATGTGATCAGTACAGAAGAAGCAAAGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGNNNNNTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGNANNNNCCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGANNNGTCGTCTGAGGTCCACCTGTATTTATGGCGNGNCNCAAAGNNCCACAGATCCGTGATCTGGAAAGAGGAGNTGAAATCTGCATTGCAACACCTGGAAGNTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGANAGTAGANCAGANTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGNCTAAAGAAGNCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTNANCATTNGNNCCCTGGAACTCAGTGC
  5   1   2       bld DMZ                                  xl291a12.5p                                                                                                                                                                                                                                                                                                                                                                   AGAGATAACCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCANCANATGTCATGGAAGCGATTAANCGGCAGAACTTCNCTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAA
  5   1   2       bld Tbd3      in                    IMAGE:3548340.5p                                                                                                                                                                                                                                                                                                                                                                           CCGTACGAGGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGAAAGGCTGATAGATTTCCTTGAAGCANGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCATATAAGATAGATAGTACACCAGATTTTACCTGACAGACAAACACTGATGTGGAGTAGC
  5   1   2       bld Ov1       in                    IMAGE:5073122.5p                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGCTGTCCAAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGA
  5   1   2       bld Tbd7      in                         XL072i05.5p                                                                                                                                                                                                                                                                                                                                                                                   GGGATTAACTGTCCAAAACCAATTCTGAATTTCAATGAAGCANGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCAT
  5   1   2       bld Thy       in                    IMAGE:8550348.5p                                                                                                                                                                                                                                                                                                                                                                                               TCCAAACCAATTCTGAATTTCAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACATATCCTTCAGATTGTGATGTGTGTACGATGGTGAGAAGATGACAGCTTTGTCGTTGATGAGAATATGATGAAAGAAATAGACATATATTGTGAGACAACACATGTATATGATCCAGTGAGAGGATGTGCTGATGGATCTGGATAACACAGACGACGTCTATGATACTGTACCATCGT
  5   1   2       bld Emb9                            IMAGE:7978256.5p                                                                                                                                                                                                                                                                                                                                                                                                                   CAATGAAGCAAGTTTCCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCCAAGGTTGAAGGAGGGAATG
  5   1   2       bld Ga15      in                       XL512n12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAGCAAATGTCATGGAAGCGATTAAACGGCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACC
  5   1   2       bld Ga15      out                      XL495g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGATTAAACGGCANAACTTCACTGAGCCCACTCCCATCCAAGGACATGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCT
  5   1   2       bld Emb9                            IMAGE:7978016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGAACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGGTGATAAGGAGCCAGCCAGA
  5   1   2       bld Ga15      in                       XL448g05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTTCACTGAGCCCACTCCCATCCAAGGACAGGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAANCANGA
  5   1   2       bld Spl       in                    IMAGE:8463141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTTCACTGAGCCCACTCCCATCCAGGACATGGATGGCCAGTGGCTCTAAGTGGACTGGATATGGTCGGTGTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAAACAATGGTGAGATAGATGACAAGCTTGTCCGTCTGATGGAGGAAATTATGAGTGAAAAAGAAAATAGGACCTAAGTATTTGTTGAGACCG
  5   1   2       bld DMZ       in                         xl314c18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTGCAATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCA
  5   1   2       bld Sp1                             IMAGE:5511528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAATGACTGGATCACGATAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGCGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCACGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGACTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCCTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGACTAACCACACAGAATGCTTGACATGGGCTTTGACCCTCAGATATCAAAGATATTCGACCAGATTCTACCTGATAGACAAACACTGCTGTGGACTGCCCCTTGGCCTACAGAACTCCGGCAACTTGCTGAAGACTTTCTGAGATACTATCTCCATATTAACATTGGTGCCCTGTAACTCTCTGCCAACCACAATATTCTCCTCATTGTTGATCGTTGAAACCATGGCTAGAAGTACCACAATTCTGCCTTTTGATGCCCGTACTCTCGATCGTAAACGTCCTATCACATCCCATCTCTGACACCAACTAGCACTGATTCTCTACCTCGCGCTTGTGGCTAGCTGCCACCTGGTTCTCCTTTCGCCAATTCCCACACCTTCTGCCCTCAACATAAACTTTCACCACTATGTAAC
  5   1   2       bld Oo1                             IMAGE:6638727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGACTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTANAAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTTCCTCAGAGGAATTAT
  5   1   2       bld Ga15      in                       XL449f04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCGCTGGATCAGGAAAAACTCTTTCTTACCTGCTTCCTGGGATTGTCCACATCAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACNATGTGATGATTTGACTCNC
  5   1   2       bld Ga18      ?                       xlk155j02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACCATCAACCATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGTGCTGNNNNNNNCCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGANNNGTCGTCTGAGGTCCACCTGTATTTATGGCGGGNCNCAAAGNNCCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGNANNNTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGNCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGNCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGNCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGNCTAGATGTAGAAGATGTGAAANTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCANNAAAACTGGNACAGCATACACCTTCTNTACCCCAGGAAANATTAAGCAAGTCAATGACCTGANC
  5   1   2       bld Ga15                               XL473d15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTCCTACAGCGGGGAGATGGTCCAATTCTTTTGGNGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACANATCCCGTGATCTGGAA
  5   1   2       bld Ov1                             IMAGE:6316656.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTGGTGCTGGCACCAACCAGGGAATTGGCTCAACAGGTTCAGCAAGTGGCTGCAGAGTATGGCAGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGGTGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGGAGACCAGATTCGACCTGACAGACAAACACTGAGGTGGAGTGGCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAAGATGTAGAAAGATGTGAAAATTTGTCATCAATTATGACTAACCCGAACNTCCTCAGAGGGATTATATTTCACCGAAATCGGGAAAGAAACCGCCCGGCAGCAGCAAAAACTT
  5   1   2       bld Tbd7      in                         XL070b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGGAAGCCTTTTGTTAGACAAATTGGTGAGTACTGGCACATGAATGAGTGTATAGCAAAGGGAGAGGAAGCAGAACTCCGAGCCTTAGGTTTCACGATCCTCCCTCACCTGTATCGTAGTCGTCATGTCGAGACCTGCCAGAGGGGACAAATTCTCAAGTGAATCCTGGTTTCTCGGAAGTGCTTGCCTAGACGAGACACAGCACACAAAAATAACTCTGGCTCCCAAATGCCTTATTGTATTCATGGTGGGGGGTGTTCCCAGGATGTGTGTGCTTGTAGCTGCAGTTGTAAGGTCTTGGCAAGACAAAGCAGTGGGTGGCCAGATTACTGTGCTTCTAATGAATGTGTGAGGTGGACCACTTCCAGTTTCTTGAAGGTCCTCGAACTGAGCACATGAGGAGGTTGGCGTTAGTGGCTGTACTGCTGACCAGCAATCAGAGGTCACTTGACTATTTATAAGGGAGCCTTTGAGCAGTGCAAAAGTACTGGTAAGGCGTGTGGTGGGTGGAGTCGATGGGACAGCACATTACTTCTTTAGACTGGGTAGCCTAACCTTTGTTTTTCAGCCTTGATTCCTCTCCGGAACAACTTTGTCT
  5   1   2       bld DMZ       in                         xl287o04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTC
  5   1   2       bld DMZ       in                         xl244m04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTA
  5   1   2       bld DMZ       in                         xl251a13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGCTTGTCGTCTGAGGTCCACCTGTATTTATGGCGGGGCCCCAAAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGC
  5   1   2       bld Spl                             IMAGE:8462103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGGACCACAGATCCGTGATCTGGAAAGAGGAGTTGAAATCTGCATTGCAACACCTGGAAGGCTGATAGATTTCCTTGAAGCAGGAAAGACCAATCTGAACAGATGCACATATTTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCGCAGCAGCAAACTGGCACAGCATACACTTCTTACCCAGGAACATTAGCAGTCATGACTGATCTCGTCTCCGGAGCAAACAGCTATCACCAGCTATGCACTGTAAGACA
  5   1   2       bld FaBN      in                    IMAGE:8074779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGTGCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGAGCCTCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAAGCAG
  5   1   2       bld Ga18                              xlk123j01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTNCTTGATGAAGCAGACAGAATGCTTGACATGGGCTTTGNNNNCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGNCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGNCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGNACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGNAAACCNAGCTATCAACCCCNNGCTATTNCAGCTGGNA
  5   1   2       bld Ga15      out                      XL406h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGATGANGCAGACNGAATGCTTGACATGGGCTTTGAGCCTCNGATAAGAAAGATAGTAGACCANATTCNACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCANTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGANAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCNNAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCANA
  5   1   2       bld Tail                            IMAGE:8541900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGATAAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAAGCAGAGGAAGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAGCNGGGTGGGTGGGACGGNNAANNTATGACGTGGTTTGGCNGAAAGAAGACTTGGCACAATCCNAAATGCTTNGCACNATCCNAATGCTTNNGGCACAATACATGGAACTTACGCTTGCACAT
  3   1   2       chi Tbd7      in                         XL104p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAAGATAGTAGACCAGATTCGACCTGACAGACAAACACTGATGTGGAGTGCCACTTGGCCTAAAGAAGTCCGGCAACTTGCTGAAGATTTTCTGAGAGACTATGATCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATAGGTTGCCTCTGGTACAAAGATATTGTTTGTTAAGGAAATTTTTAANATTTTTGCAGTAAAGTGTCAAT
  5   1   2       bld Gas8      in                    IMAGE:3517507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTCTGAGAGACTATGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGATGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAG
  5   1   2       bld Tad2                            IMAGE:6934527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTTCATATTAACATTGGTGCCCTGGAACTCAGTGCCAACCACAATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTTTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGAACGGGGAAAAATATGACCGTGGGTTTGGCGGAAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAAACAATCCCCAAAATGGCTTTGGGGGCACAAAATTACAATGGGAAACTTTAACAGCCTATGGCAGC
  5   1   2       chi Emb4                            IMAGE:5571462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGCCCACGCGTCCGAAGAAAATAAGACCATAGTATTTGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGGTTAGTAAGTTCAATCTGCTTATCTTGGGTAACTACTCACTAATGGACTACTTTTTTTGTGAAATGTATTTGTTTTTAAAGAAAGTTTATTTGCTTTCTTTAACCTCTGAAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACAGTCGGAGGACGCAAGGGGATGGAGGACTAGTGGAAATTGGCTGACTGCTTCCAGTTGTGTAGAGGTGGAAAGCCGAGCATCGTGTGCCAGTATCTTCAAAAGGCAGAATTTAACTTGTATCCCCCTCCCACACTACCAAAACTGCAATCCCATAAAGACACCCCACCATCTGTTGCATGCTTATAGCTCTTGATACTTGCAACGTGCTCTGCCTTATACCACAGGGTTGCCGTTGAGGGTTGACTTTGAGACATTTTGGCAGTATTATAATGGGAGAGCAGCTTTTTCTTGGAAGCCTTTTGTTAGACAAATTGGTGAGTACTGGCACATGGAATGAGTGTATAGCAAAGGGGAGAGGGAAGCAGAACTCCCGAGCCTTAGGTTTCACGATCCTCCCTCACCCGGTATCCA
  5   1   2       bld DMZ       in                         xl300c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATATCCTTCAGATTGTTGATGTGTGTAACGATGGTGAGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGGTTAGTAAGTTCAATCTGCTTATCTTGGGTAACTACTCACTAATGGACTActttttttgtgaaatgtatttgtttttaaagaaagtttatttgctttctttAACCTCTGAAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACAGTCGGAGGACGCAAGGGGATGGAGGACTAGTGGAAATTGGCTGACTGCTTCCAGTTGTGTAGAGGTGGAAAGCCGAGCATCGTGTGCCAGTATCTTCAAAAGGCAGAATTTAACTTGTATCCCCCTCCCACACTACCAAAACTGCAATCCCATAAAGACACCCCACCATCTGTTGCATGCTTATAGCTCTTGATACTTGCAACGTGCTCTGCCTTATAC
  5   1   2       bld Ga15      in                       XL458e17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCA
  5   1   2       bld Brn1      in                    IMAGE:4740876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGATGACAAGCTTGTCCGTTTGATGGAGGAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGG
  3   1   2       bld Ga18      in                      xlk106o23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCTNGTCCNNNGATGNNNGNAATNNNGAGTGAAAAAGNAAANNAAGNNCATAGTATTTGTTGAGACCAANCGNCGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGNAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCANCTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACNNNNNAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGNNTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATNNNACAGCACCCAGCAGACTGGCTACAGTGCNCCTCCAATGCAGAATGGAATGACCCAGNAGGCATATACATACCCAA
  5   1   2       bld DMZ                                  xl226b08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTCGTGCCGATTCGGCACGAGGGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACCGCACCCAGCAGACTGGCTACAGT
  5   1   2       bld Ga15      in                       XL414o13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCANAATGGCACATACCANAATGGCTACAGCACCCANCAGACTGGCTACAGTGCAC
  5   1   2       bld Ga18                              xlk106c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAATTATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTNNNNNCAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGNTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGANTGGNTACAGTGCANCTNCNATGCAGAATGGNA
  5   1   2       bld Neu4                            IMAGE:3475512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGAGTGAAAAAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGG
  5   1   2       bld Neu4                            IMAGE:3557275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAAATAAGACCATAGTATTTGTTGAGACCAAACGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCANAATGGCTTTGGCAACAAATCCCANAATGGCTNNTGGGCACAAAATTACAATGGAAACTNTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTTCTATGCAGAATGGAATGACCCAGCAGGCATATACATACTCAACTGCCACTGCTACAGCN
  5   1   2       bld DMZ       in                         xl329b05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAAGGCGTGTGGTGGGTGGAGTCGATGGGACAGCACATTACTTCTTTAGACTGGGTAGCCTAACCTTTGTTTTTCAGCCTTGATTCCTCTCCGGAACAACTTTGTCTAACTTGTGGTTTTGGTCTGACGCTTGTGGTGTGCAAAACCTTATTTGCCTCCTCGTTTTGCCACACTGCAACACTTTACAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCC
  5   1   2       bld Brn1      in                    IMAGE:6950943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGACAGCACATTACTTCTTTAGACTGGGTAGCCTAACCTTTGTTTTTCAGCCTTGATTCCTCTCCGGAACAACTTTGTCTAACTTGTGGTTTTGGTCTGACGCTTGTGGTGTGCAAAACCTTATTTGCCTCCTCGTTTTGCCACACTGCAACACTTTACAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTTAACCCAGTTTGTCCCGTTTTTAATTTTCGGTACTTGGCTCTTTGGAATTGTTTTCCAGGCAAAATAGTTAATTTAAATC
  5   1   2       bld DMZ       in                         xl301d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCC
  5   1   2       bld DMZ       in                         xl306o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGACGATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCC
  5   1   2       bld Ga18                               xlk63e24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGTGATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGNCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGNGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTNCCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCANCCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGANCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGANTTTGGCAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGNNAGCAATGTTCAGAGTGGGTTCCGGGCAGGTNNTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCNATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCNACGGCTACAGCACCNGCTGTCATAGG
  5   1   2       bld Ga15      in                       XL516c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATGATTTGACTCGCAGGTTGAGGAGGGATGGGTGGCCTGCAATGGGAATTCATGGTGATAAGAGCCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCANAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCT
  5   1   2       bld Ga15      in                       XL435f19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCTTGATTCCTCTCCGGAACAACTTTGTCTAACTTGTGGTTTTGGTCTGACGCTTGTGGTGTGCAAAACCTTATTTGCCTCCTCGTTTTGCCACACTGCAACACTTTACAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCANTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTA
  5   1   2       bld Ga15      in                       XL498e14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCAGGAGCGTGACTGGGTCTTAAATGAGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCANAGGTCTAGATGTANAAGATGTGAAATTTGTCATCNATTATGACTACCCCAACTCCTCAGAGGATTATATTCNCCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCNAACCANGCTATCAACCCCNAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCNGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGNGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCANAATGGCTTTGGCAACAAATCCCANAATGGCTTTGGGGCACAANATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCANAGTGGGTTCCGGGCNGGTGCTCAGAATGGCACATACCANAATGGCTACNGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCANCTGTCATAGGTTATCCAATGCCAANCATCCTACCCCCAAATAAGCTGTTAA
  5   1   2       bld DMZ       in                         xl316f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGACGCTTGTGGTGTGCAAAACCTTATTTGCCTCCTCGTTTTGCCACACTGCAACACTTTACAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCNATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACNGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCAT
  5   1   2       bld Ga18      in                       xlk71f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTTAAACATGGTAAATCACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGANCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGNAGCAATGTTCAGAGTGGGNTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGNCATAGGNTNATCCAATGCCANCATCCTACCCC
  5   1   1       add DMZ       in                         xl308g03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTATTCTGATTGCTACAGATGTTGCTTCCAGAGGTCTAGGTTAGTAAGTTCAATCTGCTTATCTTGGGTAACTACTCACTAATGGACTACTTTTTTTGTGAAATGTATTTGTTTTTAAAGAAAGTTTATTTGCTTTCTTTAACCTCTGAAATTCTCTTGAGTTTTGTTTTTCACAAAGGTGCGGTCTTTGTGGCAAGGCCTAGGCATGACAGTCGGAGGACGCAAGGGGATGGAGGACTAGTGGAAATTGGCTGACTGCTTCCAGTTGTGTAGAGGTGGAAAGCCGAGCATCGTGTGCCAGTATCTTCAAAAGGCAGAATTTAACTTGTATCCCCCTCCCACACTACCAAAACTGCAATCCCATAAAGACACCCCACCATCTGTTGCATGCTTATAGCTCTTGATACTTGCAACGTGCTCTGCCTTATACCACAGGGTTGCGTTGAGGGTTGACTTTGAGACATTTTGGCAGTATTATAATGGGAGAGCAGCTTTTTCTTGGAAGCCTTTTGTTAGACAAATTGGTGAGTACTGGCACATGAATGAGTGTATAGCAAAGGGAGAGGAAGCAGAACTCCGAGCCTTAGGTTTCACGATCCTCCCTCACCTGTATCGTAGTCGTCATGTCGAGACCTGCCAGAGGGGACAAATTCTCAAGTGAATCCTGGTTTCTCGGAAGTGCTTGCCTAGACG
  5   1   2       bld DMZ       in                         xl304o03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTGCTTCCAGAGGTCTAGATGTAGAAGATGTGAAATTTGTCATCAATTATGACTACCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAA
  3   1   2       chi Emb9      in                    IMAGE:7976190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTAGAAGTATAGATTTAGAAAGATGTGAGATTTGTTCATCCAGTTATGCTACCCCAACTCCTCATACGGATATTTTCACGGAGATCGGATGAACCGCCTCAGCAGCAAAACTGCACAGCATACACCTTCTTTACCCCAAGGAACTTTACGCCAGTCAATGACATGATTTCCGTCTTCCGGGTAGCAAACCAAGCTATCAACCCCAAAGCTATGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGAACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTAGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTTTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTCTACGTGATTTGGAGTACTCAGCCCCCGCAGCACTACTCCAAATCACGTAAACTCTGAAACAACATGCCTTA
  3   1   2       bld Brn1      in                    IMAGE:6950943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGATGTTGAAAGATGTGAAATTTGTCATCAATTATGACTACCCCCAATTCTTCAGAGGATTATATTCCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACTTTCTTTACCNCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCTCNCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGAACCGCAGAAACTCTGGAAACACTGGCTTGTTCA
  3   1   2       bld Thy       in                    IMAGE:8550348.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGCCAGATAGTAGCCGACGAGTTAGGTACTGATCCTTTGTGTCGAGTGTCGAGTTGAGGAGATGATGTCTCATAGCTCCCATCTCGAGATTATCCGATCGAGACGCCGCGAGCAAATGCCAGCTACCTTCTTACCCAGAACATAGCAAGTCAAGACTGATTCCGTCTCCGGAAGCAACCAAGCTTCACCCCAAGCTATGCAGCTGGAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTCCTAATAGAACAAAGCCCAGTGTTTCCCCAGTCTCCGCCCCCAGAGCAGACTCCAAATCACGTAACTCTGAACACGCGTCTTTTTTT
  5   1   2       bld Ga18                               xlk58j12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATGTGNNATTTGTCATCAATTATGACTNCCCCAACTCCTCAGAGGATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGNACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGAC
  3   1   2       bld Emb9 5g3  in                    IMAGE:7974064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGTAGTGACTACCCCAAACTCTCAGAGGATTATTATTCACTGATCGGAAGACGCCCGCAGCAGCAAAACTGCACAGCATACACTCTTTACCCAGGAAACATAAGCAAGTCAATGACTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCATGAACAAAGCCAGTGTTTCCGGCCATGCGCTGCACCCCGATGACAGTACTCCAAATCACGTAAACTCTGAAACACTGTCGTA
  3   1   2       chi Spl                             IMAGE:8464533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTGTTGTGAGGACTTTCTTGTCCCAGACTTAAGGGAGATAATTGAATAAATCCCACTTAGGATATTCCAATGGAAACCCGAGCGAAAATGCCGCAACCTTTTTACCAGGAACATAGCAATAATGCGGGATCGTTCTCCGGAGCAACCAACTTCACCCCAGGTATGCAGCTGTAGAGGCAGAGGCGCTCAGAGCAGAGAGGAAGAACGACAGACGTGACCGTTTTCTTCAGGCATGCGGGGGGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTGGGCAACAAATCCCAAAATGGTTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGTTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTCGAAGATAGAACAATACTCCAGTGTTTCCCAAGCGCACGCCCCATGACAGTACTCCAAATCACGTAACTCTGAACACTGCTGT
  3   1   2       bld Spl  5g3  in                    IMAGE:8463421.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTAGATCCCCACTCTCCGAGATTTATCACGAATCGAGACCGCCCGCAGCAGNAAATTGCACAGCATACATTTCTTACCCAGGAAACATTAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGCACAAGAAACAAAGACTCAGTATTTACACAGCCATGCGCTGCCCCCATTACAGTACTCCAAATCACGTAACTCTGAACACGCTTATGC
  5   1   2       bld Ga18                               xlk60b16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTATATTCACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGNAACTGCAGNGGTGACTGTAGNGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttntttttttttGTA
  3   1   2       bld Spl       in                    IMAGE:8463141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACCCATCCTCAGAGATATTTCACGATCGAGAACCGCCGCACAGCAAATGGCACAGCTACACTTCTTTACCCAGAAACATAGCAAGTCAATGACCGATCTCCGTCCTCCGGGAAGCAAACAAGCTATCACCCCAAGCTATGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTATAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATNTTAGTTGTTTTTTTTGTTTTTTTTAGCACAAGAAACAAAACTCAGTATTTACACAGCCATTGCGCTGCCCCCATTACAGTACTCCAAATCACGTAACTCTGAACACTGCTATGGTTTT
  5   1   2       bld Ga15      in                       XL467j22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCGAATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAA
  5   1   2       bld Ga18                               xlk68h05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCGGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGNCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAAttttagttgttttttttgtttttttttNTAATAGAACAAAGCCAGNNTTTNCAGAGTTNCGTGATTT
  3   1   2       bld Ga15 5g3  in                       XL438l12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGAANCCGCCCGCAGCAGCAAAACTGGCACAGCATNCACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGG
  3   1   2       bld Ga15 5g3  in                       XL404d23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATG
  5   1   2       bld Ga15      in                       XL444d03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCANAGTTTACGTGATTTGG
  3   1   2      seed Ga15      in                       XL519l13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAACCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCG
  3   1   2       bld Ga15 5g3  in                       XL422m20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGCAGCAGCAAAAACTGGCACAGGCATACACCTTCTTTTACCCCCAGGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGNTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATG
  3   1   2       bld Ga15      in                       XL512n12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGCCCGCAGCAGCAAAACTGGCACAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAA
  3   1   2       bld Ga18      in                       xlk71f23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCNCCGCAGCAGNAAAACTNNCACAGCATANACNTTCTTTNCCNAGGAAACATTANGCAAGTCAATGNCCTGATCTCCGNNNCCGGGAAGCNANNCNAAGCTNTCANCCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGNGCTTCAGAGGCAGAGGAGGAATGANCGACAGNCGTGACCNTTTCTCTTNAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGNCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAANNNNNCGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTNCTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACNGCAGTGGTGACTGTAGTGCACTTTCNCNATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTTTTTTTTTTGTAANAGAANAAANNCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGG
  3   1   2       bld Ga15 5g3  in                       XL518f11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCAGCAGCAAAANTGGCACAGCATACACCTTNTTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGG
  3   1   2       bld DMZ  5g3  in                         xl334k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGCAGCAGCAAAACTGGCCCAGCATACACCTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld Ga15      in                       XL435f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGCAGCAAAACTGGCACAGCATACACCTTNTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTAC
  3   1   2       bld Ga15                               XL516o07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCAAAACTGGCACAGNATNCCCCTTNTTTNCCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCNCCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCNCCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAA
  5  -1   2       chi Bla2                            IMAGE:7298615.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTATTTGATGTGGGTAAAGTCCGGAGCTATCATCTTTAGAAAGAGGTNNGGTTAGGCATAAGGGTCTTGGGAGAATTGGGTTAGTTTATTGTTAGAATATAGACTTACCATGAGCGAGAGACGTATTCCTCTCAAGAGATTTGAAGTGAGTGAAGGCTAAAAAGTAAGAAGACTATCTTCTGACGAATTAATTCCCAAGCATTCAAAGGAGGAAATACGGGGTAAAGATAGAAGGAGTGGTCGTGTCTTTGAATAATCCTAGGTGGTTGGATCGTCAATGTCGGTAGGTAATGATTACAACCGTGTAAGGGAGTATTAATTTTTGATCGTAGGTTTGGCATGAAAATACGGCGATCGGCAGATTCCCTTTGGGTCAATTGGTCCGAATTGGTACTGCCCTTAGCGATCCTTGATACAACGCGCGTTCGACGTTGAATGGTATGACCCAGCATCCATAATCATAAGCGAGTGCCACGGGTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGNTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGT
  5   1   2       bld Brn3                            IMAGE:8538250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAATNNNNCCATCTGTTCNNGAAGAGCATCAATAAAATTCGTCCCCCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCCGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttgttttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGA
  5   1   2       bld Ga18                              xlk148p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATACACCTTCTTTACCCCAGGAAACATTAAGCAAGNCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGNTTGGCGGAAAGAGAGACTTTGGNAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAA
  5   1   2       bld Ga15      in                       XL417o15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCAGANTTTACGTGATTTGG
  3   1   2       bld Ga15 5g3  in                       XL462i05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTACCCCAGGAAACATTAAGCAAGGTCAATGACCNGATCTCCGTCCTCCNGGGAAGCAAACCAAGGNTATCAACCCCAAGCTATTGGCAGNTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCTAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATG
  3   1   2       bld DMZ  5g3  in                         xl315d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTTTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld Ga15      in                       XL498e14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTACCCCAGGAAACATTAAGCAAGTCAATGACCTGATNTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTA
  3   1   2       bld Ga15 5g3  in                       XL517j15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCAGGNAAACAGTAAGCAAGTCAATGACCTGATNTCCNGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGNCCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTACCTGTAATGGGGGCA
  3   1   2       chi Ga18      in                      xlk123h18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTACCCAGGAAACNNTAAGCAAGTNAANGNCCNGATCTCCNNNNCCGGNNAGCAACCNAAGCTNNNNNCCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGANCGACAGNCGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGNCCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGNCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAANNNNNCGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGG
  3   1   2       bld DMZ       in                         xl316f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTGTTTCCAGAGTTGAGCGTGATT
  3   1   2       bld Ga15      in                       XL516c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGG
  3   1   2       bld DMZ       in                         xl329b05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl252f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CNGGNAACNTTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAAGTAGAAACAAA
  5   1   2       bld Egg5                            IMAGE:3430463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTCAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGGCACCAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTG
  3   1   2       bld DMZ       in                         xl306o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTGTTTCCAGAGT
  3   1   2       bld Ga15      in                       XL414o13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGG
  3   1   2       bld DMZ  5g3  in                         xl315h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNAACATTAAGCAAGTCAATGACCTGATGTCCGTCCTCCGGGAAGCAAACCAAGCTATCANCCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGNCCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGNTTTGGCAACAAATCCCAAAATGGCTTTGGGGCNCAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAANGGTTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGNATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl332o18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACATTAAGCAAGTCAATGACCTGATNTCCGTNCTTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATNTTAGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl261p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTAC
  3   1   2       bld DMZ  5g3  in                         xl228l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACANTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCNCCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTT
  3   1   2       bld DMZ       in                         xl223i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CNTTNAGCAAGTCAATGACCTGATNTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCCAGAGTTTACGTGAT
  3   1   2       chi FaBN      in                    IMAGE:8074779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATGGTAGTTGTTTTTTTTGTTTTTTTTGGGAAAAGCACAGAGACCAGAGCTTCCAGAGTGTCCATGCTCTGCCCTACTTACATGAGCTCCGCATCACGCAACTCTGAGTCTCGCTGTGTTTCTT
  3   1   2       bld DMZ  5g3  in                         xl226i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAAGCAAGTCAATGACCTGATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  5  -1   2       bld Em10                            IMAGE:7983666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGACTGGATCTCCTCTTCCCGGAAGCAAACCAGGCTATCACCCCCAAGTTATTGCAGCTGGTAGAGGACAGAGGGCGCCTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGCTGTTTTCTCTGttttttttCGCAATAGAACACAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACCGTAATGGGGGCAGCGCATGGCCTTCCATAAAGATCCTTTAACCTGGCT
  5   1   2       bld DMZ       in                         xl223i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACCTGATCTCCGTCCTCCGGGAAGCAAACCANGCTATCAACCCCAAGCTATTGCAGCTGGTNGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTT
  3   1   2       bld Ga15      in                       XL467j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCTCCGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGNGACTGTAGNGCACTTTCACTATTTAAGTNGACNGTATCTACATTCCNGAGGCAATTTTAGTNGTTTTTTTnGTTTTTTTTNGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTACTGTAATGGGGGCA
  3   1   2       bld Ga15      in                       XL417o15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCGTCCNTCCGGGAAGCAAACCAAGNTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGNCCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTnGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTACCTGTAATGGGG
  3   1   2       bld Ga15 5g3  in                       XL418p22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCA
  3   1   2       bld DMZ  5g3  in                         xl253c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTCCTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld Ga15      in                       XL458e17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCGGGAAGCAAACCAAGGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTTGGAGTA
  3   1   2       bld Ga18      in                       xlk71l23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNCCGGGAAGCAANCCNAGCTNTCANNNNCAAGCTATTGCAGCTGGTAGANNACAGANGGCGCTTCANAGGCAGANGANGAATGANCGACAGACGTGNCCNTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGANAGAGAGNCTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGNNTACAGCNCCCAGCAGNCTGGCTACAGTGCNCCTCCAATGCAGAATGGAATGACCCAGCAGGNATATACAT
  3   1   2       bld DMZ  5g3  in                         xl293d02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTNGTAATAGAACAAAGCCAGTGTTTCCAG
  3   1   2       bld Ga15      in                       XL444d03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGGGAAGCAAACCAAGCTATCAACCCCAAGNTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGNCAGACGTGACCGTTTNTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGG
  3   1   2       bld DMZ  5g3  in                         xl284p13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTGTAGCGTGATTG
  3   1   2       bld DMZ       in                         xl300c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGGGAAGCAAACCAAGCTATCAACCCCAAGNTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTTAGTTnTTTTTTTTnTTTTTTT
  3   1   2       bld DMZ       in                         xl301d04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATT
  3   1   2       bld Ga15      in                       XL449f04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGAAGCAAACCNAGNTTNTCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGNGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGNCCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACCTGTAATGGGGGC
  3   1   2       bld DMZ       in                         xl251a13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTAGNAATAGAACAAAGCCAGTGTTTCCAGAGTNAAGCGTG
  3   1   2       bld DMZ  5g3  in                         xl319m18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGAAGCAAACCAAGCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl278g13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAAGCAAACCAAGNTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTNGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGNCCCAGCAGGCATATACATANCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACNTTCCTGAGGCAATTTTAGTTGTTNNTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAACGTGATTTGGAGTAGCTGTAATGGGGGCAGCG
  3   1   2       bld Ga15      in                       XL403g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGGTATCAACCCCAAGNTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCACCCAGCAGACTGGNTACAGTGCNCCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAG
  3   1   2       bld Ga15 5g3  in                       XL427p02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCAACCCCAAGGCTATTGCAGNTGGTAGAGGACAGAGGGCGCTTCAGAGGGCAGAGGAGGAATGAACGACAGNCGTGACCGTTTCTCNTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTT
  3   1   2       bld Ga15 5g3  in                       XL473n15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCAACCCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGGCGCTTCAGAGGCAGAGGAGGAATGAANGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGC
  5   1   2       bld Ga18                              xlk127l21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGNAGCAATGTTCAGAGTGGGTTCCGGGCAGGTNCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGNCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttttgttttttttttGTAATAGAACAAAGCCAGTNTTTCCAGAGTTTACGTGATTTGGNGNACTGTAATGGGGGCAG
  3   1   2       bld DMZ  5g3  in                         xl239a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld Ga15 5g3  in                       XL496f23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAACCCCAAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCNGAGGAGGAATGAACGNCAGACGTGACCGTTTNTTTTCAGGCAAGNGGGGTGGGTGGGACCGGGAAAATTATGACCGNGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCNCAAAATTNCAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCNCCCAGCAGACTGGNTACAGTGCNCCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCNCGGCTACAGCNCCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCNCAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCNCTTTCNCTATTTAAGTTGNCTGTATTTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGnTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGG
  3   1   2       bld Ga15                               XL499e14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCCAAGNTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGNGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGG
  3   1   2       bld DMZ  5g3  in                         xl328a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTCG
  3   1   2       bld DMZ  5g3  in                         xl315n16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTNG
  3   1   2       bld DMZ  5g3  in                         xl230h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGNAAAGAACA
  3   1   2       bld DMZ       in                         xl283a13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTT
  3   1   2       bld DMZ  5g3  in                         xl234l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTG
  3   1   2       bld DMZ  5g3  in                         xl238d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTNGTAATNGAACAAAGCCAGTGTTTCCAGAGTTTACCGTGATT
  3   1   2       bld DMZ  5g3  in                         xl300n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAA
  3   1   2       bld DMZ  5g3  in                         xl244a16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTANGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ       in                         xl304o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTGTTTCCAGAGT
  3   1   2       bld DMZ  5g3  in                         xl329n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTCG
  3   1   2       bld DMZ  5g3  in                         xl226j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTT
  3   1   2       bld DMZ  5g3  in                         xl279n18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATT
  3   1   2       bld DMZ  5g3  in                         xl341h20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTC
  3   1   2       bld DMZ  5g3  in                         xl333k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTTAGTTNTTTTTTTTnTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl304k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATNNTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ                                 rxl289a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl339m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGNCAGACGTGACCGTTTCTGTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTTCAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGNCCCAGCAGGCATATACATNCCCAANTGCCANGGNTNCAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTNCCCCCAATAAGCTGTTAAACCAGTTNGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCNCAGGTTTTTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATNTTAGTTGTTTTTTTTGTTTTTTTTAG
  3   1   2       bld DMZ  5g3  in                         xl321k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl337p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ       in                         xl314c18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGCAGNTGGTAGAGGACAGANGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGNCGTGACCGTTTTTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCACCCAGCAGACTGGGTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGGTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCNCAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATNTTAGNTGNTTTTTTTTGTTTTTTTTCA
  3   1   2       bld DMZ       in                         xl308g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTACGTTGTTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ  5g3  in                         xl322b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTC
  3   1   2       bld DMZ       in                         xl287o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGCAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTNTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTNAAGCGTG
  3   1   2       bld DMZ  5g3  in                         xl235d16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTNGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATT
  3   1   2       bld DMZ  5g3  in                         xl258p06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTNTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGNGGAAAGAGNGACTTTGGCAACAAATNCCAAAATGGNTTTGGCAACAAATNCCAAAATGGNTTTGGGGCNCAAAATTNCAATGGNAACTTTAACAGNTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCNGGTGCTCAGAATGGCNCATACCNGAATGGNTNCAGCNCCCAGCNGNCTGGGTNCAGTGCNCCTNCAATGCAGAATGGAATGNCCCNGCNGGCATATACATNCCCAACTGCCNCGGNTACAGCNCCAGCTGTCATAGGTTNTCCAATGCCAACATCCTNCCCCCAATAAGCTGTTAAACCNGTTTGTCCGTTTTTATTTTCTGTACNTGCTNTTTGTATTGNTTCCNTGCAAAATAGTTATTTAAATNCCNCNGGTTTNTCAGAGGTAACTGCNGTGGNGNCTGTAGNGCNCTTTCNCTATTTAAGTTGACTGNATNTACNTTCCTGAGGCAATTTTAGNTGTTTTTTTTTTGTTTTTTTTA
  3   1   2       bld DMZ       in                         xl244m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTAGAGGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTTTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTAGAAATAGANTCAAAGCCAGTGTNTCCAGAG
  3   1   2       bld DMZ  5g3  in                         xl275m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACAGAGGGCGCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACCGTGATTTGGAGTAC
  3   1   2       bld Ga15 5g3  in                       XL423m23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCTTCAGAGGCAGAGGAGGGAATGAACGACAGACGTGACCGTTTCTTTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGNCTTTGGCAACAAATCCCAAAANGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGNTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTNCAGAGTTTACGTGATTTGGAGTACTGT
  3   1   2       bld DMZ                                 rxl243a19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTCAGAGGCAGANGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGNCCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTNTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTNAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTCT
  3   1   2       bld DMZ  5g3  in                         xl269f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTCAGAGGCAGAGGAGGAATGAACGACAGACGTGACCGTTTCTCTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATNTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTA
  3   1   2       bld Ga15 5g3  in                       XL468d13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANAGGCAGNGGAGGAATNNACGACAGANGTGACCGTTTCTCTTNAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGNCCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTNTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTANCTGTAATGGGGGCAGC
  3   1   2       bld Ga15 5g3  in                       XL473b13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAACGACAGACGTGACCGTTTCTNTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTNGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGNGACTGTAGNGCACTTTCACTATTTAAGTNGACTGTATCTACATTCCTGAGGCAATTTTAGTNGTTTTTTTnGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTACT
  3   1   2       bld Ga15 5g3  in                       XL436j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGTTTCTCTTCAGGCAAGCGGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATNGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGNGCACTTTCACTATTTAAGTNGACTGTATCTACATTCCNGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTAC
  3   1   2       bld Ga15                               XL480h21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTNTTCAGGCAAGNGGGGNGGGTGGGACCGGGAAAATTATGGCCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGNTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGTCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTACNTAATGGGGGC
  3   1   2       bld Ga15                               XL442j10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCAAGCGGGGGTGGGGNGGGACCGGGAAAATTATGACCGNGGGGTTTGGNGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAGTGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACNGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTAC
  3   1   2       bld Ga15 5g3  in                       XL472e18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCNTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTNCAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCGAGTGTTTCCG
  3   1   2       bld Tbd7      in                         XL070b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTT
  3   1   2       bld Neu4 5g3  in                    IMAGE:4084488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCAAGCGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGTTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTTTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATTTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTATCTCAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL493i21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTATCTCaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL494i21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGGTGGGTGGGACCGGGAAAATTATGACCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTT
  3   1   2       bld DMZ                                 rxl338k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGGTGGGTGGGACCGGGAAAATTATGNCCGTGGGTTGGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTNGGCAACAAATCCCAAAATGNNTTTGGGGCACAAANTTNCAATGGAAACTTTNACAGNTNTGGCAGCAATGTTCAGAGTGGGTTCCGGGCNGGNGNTCAGAATGGCACATNCCAGAATGNNTACAGCACCCAGCAGACNGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGGTACAGCNCCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCNGNTTGTCCGTTTTTNTTTTCTGTACTTGNTCTTNGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACGTGTATCTACATTCCTGNGGCAATTTTAGTTGTTNTTTTTGTTTTTTTT
  5   1   2       bld Ov1                    IMAGE:6316195-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTATCTCaaaaaaaaaaaaaaa
  5   1   2       bld Ov1                             IMAGE:6316195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTACCTGCCttttttggttttttttGTAATAGAACCAAGCCCAGTGTTTCCCAAAAGTTTACCGCGATTTGGGAGAACTGCTAATGGGGGGCAGCCCCATGGGCCCTTCAAATAAAAAATGCCCTTTAAACTTTGGGTTTATCCTCCaaaaaaaaaaaacaaaaaaaaagggcccgggcccgccttccaaaaacgtaattccccctcccaaaagggggcccccaaagagtttttaccccgtttaaccccccGGCCTTTTCCTTGGGTAACAAAAGAGGGGGGTCCCCCCTACAAACTAGAAAATCCTATAACTTAAAACAAGCTTCAAGGCCACCTGGGCCCCCGTCACCCTATTTATACAAAACCCCTCCATCGACCTGGGGGAAAAAAACCTTGGCCTCAACCTTTGGGGGCAATCTCTTTCGGGGAACAGGGAAACCCCCTAACCCTCTCTGGCGGGCGGCGATCACACTTAAATTTTGGGCAACGACACTCACACCTGACACCGAGAATATTTTACACGCTCCCCCCGGGGCACAATAATTACAAGACTCTTTTAAAAGGCAGCTACAACACGGGCGGGCAACAACCCACACCG
  5   1   2       bld Ga12      in                         XL156g06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL156g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGAC
  3   1   2       bld Ga15      in                       XL489a12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAANGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAA
  3   1   2       bld Ov1       in                    IMAGE:5073122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTCCAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGAAAAAAAAAAAAAAAG
  5   1   2       bld Ga12      in                         XL215l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Tbd3      in                    IMAGE:3548340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTTTGAAGAACAGAGAGACATATGTCAGCAAATCACAGAATGGCTTAGGCAACAATCACCAATATGGCTTTGAGGCACAAAATTACAATGGCAACTTTAACAGATATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGTTACAGCACCCAGCAGACTGGATACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCTCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAAAA
  3   1   2       bld Ga15 5g3  in                       XL499b13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTTTGGNGGAAAGAGAGGACTTTGGCAACAAATCCCNAAANGGNTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGNAACTTTAACAGNTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGNTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTG
  5   1   2       bld Ga18                              xlk101l06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGNNACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTNCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGNNNNGNNCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL215l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCG
  5   1   2       bld Ga15      in                       XL467i22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCGGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl234o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTGTTTCCAGAGTT
  5   1   2       bld DMZ       in                         xl308j23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl339f04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTA
  5   1   2       bld DMZ       in                         xl234o02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld DMZ                                 rxl293a09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGNNTTGGCAACAAATCCCAAAATGGCTTNGGGGNACAAAATTNCAANGGAAACTTTANCAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGTTNCAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCNGAATGGAANGACCCAGCAGGCATATNCATACCCAACTGCCACGGGTACAGCNCCAGCTGTCATAGGTTNTCCAATGCCAACATCCTNCCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTNGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCNCAGGTTTCTCAGAGGTAACNGCAGTGGTGACNGTAGTGCACTTNCNCTATNTAAGTNGACTGTATCTACNTTCCTGAGGCAATCATTANGCATGTTTTTTTTNGT
  5   1   2       bld DMZ       in                         xl225m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl225m21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTAGTAATAGAACAAAGCCAGTGTTTCCAGAGT
  5   1   2       bld DMZ       in                         xl339f04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl308j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTNGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTNGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTNCAATGGAAACTTTANCAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACNGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCNGCAGGCATATACATAC
  3   1   2       bld Ga15      in                       XL494i21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGCGGAAAGAGNGACTTTGGCAACAAATCCCAAAATGGCTTTGGNAACAAATCCCAAAATGGCTTTGGGGCACAAAATTNCAANGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGNGGGTTCCGGGCAGNTGCTCAGAATGGCACATACCAGAATGGCTACAGCNCCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGGTACAGCNCCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTNGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACCTGTAT
  5   1   2       bld Ga18                              xlk101f24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGGCGGAAAGAGAGANTTTGGCAACAAATCCCAAAATGGCTTNNNNNCAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGNNAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGNCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACANTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACANANCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGNNNNGNNCTTCAATAAAGATCCTTTAACTTGGNTaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL476n20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL467i22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTnGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGATTTGGAGTACT
  3   1   2       bld Ga12      in                         XL151m08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAAGTGGTGACTGTAGTGCNCTTTCACTATTTAAGTTGACTGTATTCTACATTCCTGAG
  5   1   2       bld Ga15      in                       XL442h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAANGCCANTGTTTCCAGAGTTTACGTGATTTGGAGTACTGCAATGGNGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL442h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACNGTATCTACATTCCTGAGGCAATTTTAGTNGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATG
  5   1   2       bld DMZ                                  xl250f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAAGAGAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCNATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACGGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCANAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAG
  5   1   2       bld Ga18                              xlk159a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGAGAGANTTTGGCAACAAATCCCAAAATGGCTTNNNNNCAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCNGNNNNGNNCTTCAATAAAGATCCTTTAACTTGGNTaaaaaaaaaa
  3   1   2       bld Egg6                            IMAGE:4432879.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAGAGACCTTGGCAACAAATCCCAAAATGGCTTTGGCCACCAATTCCCCAAATGGCTTGGGGCACAAAATTACAATGGAAACTTTACCAGCTAGGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTNTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGC
  5   1   2       bld Ga18                              xlk110a19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAGAGAGNNTTTGGCAACAAATCCCAAAATGGCTTTGGNACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGNAGCAATGTTCAGAGTGGGTTCCGGGCAGTNCTCAGAATGGCACATACCAGANNNNTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGNTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTG
  5   1   2       bld Ga18                              xlk122j14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAGAGNNTTTGGNAACAAATCCCAAAATGGCTTTGGNACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTNCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAAttttagttgttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGNNNNNGNCNTCAATAAAGATCCTTTAACTTGG
  5   1   2       bld Ga18                               xlk57e04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAGAGANTTTGGCAACAAATCCCAAAATGGCTTTGNNNCAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAAttttagttgttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGNNNNGNNCTTCAATAAAGATCCTTTAACTTGGNTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl239j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTT
  5   1   2       bld DMZ       in                         xl239j08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  5   1   2       bld Gas5                            IMAGE:3747658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGT
  5   1   2       bld Ga12                                 XL143i21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  5   1   2       bld Ga18                              xlk159o08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGACTTTGGCAACAAATCCCAAAATGGCTTNNNNACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCNGNNNNGNNCTTCAATAAAGATCCTTTAACTTGGTNNNA
  5   1   2       bld Ga12      in                         XL151m08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL467m16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNTTGGCAACAAATCCCAAAANGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGGCACAAAATTNCAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGGTACAGCACCCAGCAGACTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATNGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTNGACNGTATCTACATTCCNGAGGCAATTTTAGTTGTTTTTTTnGTTTTTTTTNGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTAGCGTGA
  3   1   2       bld Neu7 5g3  in                         XL016p09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGGCAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCNCTATTTAAGTTGACTGTATCTACATTCCTGAGGC
  3   1   2       bld Neu7      in                         XL036e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACAAATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTNAGTTGAC
  3   1   2       bld Tbd3      in                    IMAGE:3550069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAAA
  5   1   2       bld Neu7      in                         XL036e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAAT
  3   1   2       bld Egg6                            IMAGE:4435467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGGCACCAAATCCCAAATTGGCTTTGGGGCACAAATTATCAATGGAAATTTTAACAGCTATGGCAGCAATTTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGTTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATAATAAACCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAG
  5   1   2       bld Tbd1                                 AW765217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCCCAAAATGGCTTTGGCAACAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTA
  5   1   2       bld Ga15      in                       XL478b12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCGCAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCANGCGCCTTCAATAAAGATCCTTTAACTTGGTaaaaaaaaa
  3   1   2       bld Ga15      in                       XL478b12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTnGTTTTTTTTTGTAATAGAACAAAGCCAGGTGTTTCCAGAGTTTACGTGATTTGGAGTAC
  5   1   2       bld Neu4                            IMAGE:4085339.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATCCCAAAATGGCTTTGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTA
  3   1   2       bld Tbd7      in                         XL072i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCANAATGGCTTTGGGGCACANAATTNCAATGGAANCTTTAACANCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTNCTCANAATGGCACATACCAGAATGGCTACAGCACCCAGCAGNCTGGNTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATNCATACCCAACTGCCNCGGNTNCAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGNACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCNCAGGTTTCTCANAGGTANCTGCAGTGGTGACTGTAGTGCACTTTCNCTATTTAAGTTGNCTGTATNNACATTCC
  3   1   2       bld Ga15      in                       XL493i21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNGGGGCACAAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGNCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGAGCTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAAGCAAATGACCAGTGTTTTCCANGAGTTTACCGTGAT
  3   1   2       bld Tbd1                                 AW764815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAATGGCTTTGGGGCACAAAATTACAATGAAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAA
  5   1   2       bld Brn2                             Brn2-za41f03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATTACAATGGAAACTTTAACAGCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAA
  3   1   2       bld Tbd5      in                    IMAGE:3579792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTACAATGGAAACTTTCACACCTATGGCAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGTAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAATTGCCACGGCTACAGCACCAGTTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTCTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAAAAAA
  5   1   2       bld Ga15      in                       XL430e22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL430e22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAATGTTCAGAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGG
  5   1   2       bld Ga15      in                       XL489a12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATGTTCANAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATANGCTGNTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL403g18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTTCNCAGTGGGTTCCGGGCAGGTGCTCAGAATGGCACATACCACAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTANTTGtttttttttgtttttttttGTAATANAACAAAGCCAGTGTTTCCAAAGTTTACNTGATTTGGANTACTGTAATGGGGGCACGCATGGCCTTCAATAA
  5   1   2       bld Ga15      in                       XL512c17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL512c17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCGGGCAGGTGCTCAGAATGGCACATACCAGAATGGCTACAGCACCCAGCAGACTGGCTACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGG
  3   1   2       bld Ga15      in                       XL476n20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTACAGCACCCAGCAGACTGGNTACAGTGCNCCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTNGACNGTATCTACATTCCNGAGGCAATTTTAGTNGNTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTNTTTCCAGAGTTTAC
  3   1   2       bld Egg5      out                   IMAGE:3430495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGATACAGTGCACCTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCAAAAAAAAAAAAATAAAAAAAGATTAAA
  5   1   2       add Tbd7                                 XL078o14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGGCAATTCGGCACGAGGGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ov1                             IMAGE:5074354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCAATGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGGTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTTTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATTTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTAAAAAAAAAAAAAAAGGGCGGCCGCCCTTTTTTTTTCCCCTCATGCTGTTCTTAATAAACCATTCTGAAAATATGAAAAAAAAAAAAAAAG
  5   1   2       add Tbd7      in                         XL095h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGNAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       add Tbd7      in                         XL095h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCAGGCCTTCAATAAAGATCC
  5   1   2       bld Ga15      in                       XL435l24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGttttttttgtttttttttGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL435l24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAATGGAATGACCCAGCAGGCATATACATACCCAACTGCCACGGCTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACNGTATCTACATTCCNGAGGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTANCGTGATTTGGAGTACTGTAATGGGGGCA
  3   1   2       bld Ga15      in                       XL448g05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTNTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTNNNNGTTTTTTTNTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTATCGTGATT
  3   1   2       bld DMZ       in                         xl250g18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNTACAGCACCAGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCNGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTNAAGTTGNCTGTATNTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTNNNGTAATAGAACAAANCCAGTGTTTCCAGAG
  3   1   2       bld DMZ  5g3  in                         xl239m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACAGCNCCAGCTGTCATNGGTTATNCAATGCCAACATCCTACCCCCNATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTNGTATTGTTTCCNTGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGNAAACTGCAGNGGTGACTGTAGTGCACNTTCCCTATNTAAGNCGACTGTATNTACATTCCTGAGGCAATNTTNGNTGNTTTTCTTTTGTTTTTTTT
  3   1   2       bld Gas8      in                    IMAGE:3517507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTGTCATAGGTTATCCAATGCCAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGTTTTTTTTGTTTTTTTTTGTAATAGAACAAAGCCAGTGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL460e22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACATCCTACCCCCAATAAGCTGTTAAACCAGTTTGTCCGTTTTTATTTTCTGTACTTGCTCTTTGTATTGTTTCCATGCAAAATAGTTATTTAAATCCCACAGGTTTCTCAGAGGTAACTGCAGTGGTGACTGTAGTGCACTTTCACTATTTAAGTTGACTGTATCTACATTCCTGAGGCAATTTTAGTTGtttttttttgtttttttttGTAATAGAACAAAGCCAGNGTTTCCAGAGTTTACGTGATTTGGAGTACTGTAATGGGGGCAGCGCATGGCCTTCAATAAAGATCCTTTAACTTGGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL460e22ex.3p