Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8548867.5                     271 PI      89          3     1178                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012767120 Xl3.1-IMAGE:8740761.3 - 630 ESTs
                                                                       ......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8740761.3                                                                                       CAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012684967                                                                                             GACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG
                                                      consensus depths                                                                                           50    79   199   221   268   288   323   338   334   341   346   353   349   357   353   359   353   360   360   364   357   366   357   367   362   370   365   375   364   383   368   394   367   401   365   410   363   422   364   431   369   447   375   464   374   469   370   469   366   472   374   479   377   483   386   487   387   488   382   491   378   495   392   500   389   505   393   508   389   510   424   517   427   516   433   520   443   525   437   521   440   528   431   532   484   539   488   546   481   554   482   557   493   558   481   555   481   550   471   544   461   549   463   552   327   551   406   546   349   549   367   552   354   551   332   548   330   546   321   539   312   527   285   514   287   503   283   489   263   477   259   463   255   454   256   441   256   431   256   417   255   402   255   389   251   367   247   355   248   337   249   309   247   294   242   281   239   271   244   268   241   264   235   261   235   261   218   260   220   256   214   255   218   255   206   247   209   246   207   245   201   244   200   242   168   215   113   171    75   154    64   131    61    92    28    53    11    36
                                                                   SNP                                                                                                               -----------T
                                                                   SNP                                                                                                                                                                                                                           ------GT----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                               BLH ATG     111    2135                                                                                       
                                               BLH MIN     111     219                                                                                       
                                               BLH MPR     105     219                                                                                       
                                               BLH OVR     111     109                                                                                       
                                               CDS MIN     111      72                                                                                       
                                               EST CLI      65      72                                                                                       
                                               ORF LNG     111       9                                                                                       
  5   1   2       chi Brn1                            IMAGE:6952432.5p AACACGCAGGAACGGACGATGACAAGAAGCGGaaagaaagcgaagagacaagagagacgcagaagcgcgaggaagggaagaagaagCACGCTGGGAACCGGTCCGGAATTCCCGCGGAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCTGGTCAAAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAATTATCCCTGAGCTGAACGGAAAAATAACCGGGAATGGCTTTCCCTTGTCCCCACCCCCAAATGTGTCCCGTCGTGGGATCTTGAACTGCCCGCCTGCAAAAAGCCGGGGCAATTACCAATGAACCTCCAAGGCCGGCCATTTAAGAACCGGCATCAAAAAGGGGCCCCAATGGAAAGGGAAATCCCGGGGGAATACCCCCCCAGGAGACCAGGGTTTGGGTCCTCCCCCCTGGAGACTTT
  5   1   2       bld Tail 5g                         IMAGE:8546210.5p                                                   AAAATTTTACATATCTTNNNNNGGGAGAACCAAATAATATTCGTCCCAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGCAAGCTGTGGAGAGATGGCAGAAGTGCANGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAGTATCCCTGAACTGAACNGAAAATACCNGAAATGCTTTCCGTGTCCCACCCAATGTGTCGTCGTGGACTGACTGCCGCTGCAAAGCCGGCAGTAGATGACTCAGGCC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740443.5p                                                    AACAAAGCTAAATAGAGGATCACATAAGATTCGAATTCGTCCCCACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCCACTGCCACCCAGAAGACTGGTGGATGGCCCATCAAGGAAGTTGTGGAGAAGATGGCAGAAGTGCTGGTCAGAACATTATTCCCGCCTCCACCTGGGTGCAGCAAAGCTTGTCGGAAAAGTTATCCCTGAACCTGAACCGGAAAAATACTGAATGGCTTTCCTGTCCCCCACCCAATGTGTCGTCTGATCTGACCTGCCGCCCTGCAAGCGGCAATACCATGAAACTCAAGCGCATTAGACTGCATCGAAGGCATGAGAATCTGGGATACCAAAACCGGTGTCCCTGGTTCCTAAGGGGAC
  5   1   2       bld Lmb1 5g                         IMAGE:8534686.5p                                                     AATNNNNNCCATGTNCANTGCAGAGTACTCTAAAAAATTCGTCCCAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTTACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAAGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAAAAGACTGTGGATTGCCCATCAGGNAAGCTGTGGAGAGATTGCAAAAGTGCAGGTCAAAACTTATTCCCGCCTCAACTGGTGCACAAAGGGTGTCNGAAAATTATCCTGAACTGAACGAAAATAACCCGAATGCTTTCCGGCCCCACCAAATGTTCCTCTGGATTTAACGCCGCCTGGAAACGGCAAATACAAACTAGGCCCCTAAAACGATCGA
  5   1   2       bld Thy  5g                         IMAGE:8548418.5p                                                     CCTTGCNNNANNAAGaaaactaaaaaaaaTTCGTCCCCAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGTAACCTGTGGAGAGATGGCAGATGTGCAGGTCAAAACATTATTCCCGCTCAACTGGTGCAGCAAAGCTGTCGGATAGTTATCCCTGAGCTGAACGAAAATTACCCGGATGGCTTTCGTGTCCCCACCCAATGTGTCCGCCTGGATTGACCGCACCTGCAAACTCGC
  5   1   2       bld Tail 5g3  in                    IMAGE:8541573.5p                                                         CCTATAGTTCNNNGCGGAGACATAAATCGATTCGTCCCCACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGCGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCNAAGGCTGTCNGAAAAGTTATCCCTGA
  5   1   2       add Tad1 5x                         IMAGE:6940794.5p                                                                CCATTACCGCCGGGGCACTCTGCAACAAGACACAGACTTCAGAGGGATTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACAGATTTGGCCGTATTGGGCGCCATGGTGACCCGCGCTGCCTTTGATAGCAGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAAGGAACCGTTAAGGCTGACAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAAGAGCGTGACCCCTCCAACATTAAGTGAGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACTGAGAAGGCCTCTCTACACGTTGAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCACCCCTCAGCAGATGCCCCCATGTATGTATGTGGCATGAACCATGAAAAATATGATAACTCTCTTAAAGTTGTTAGCAAATGCATCCTGCACTACAAACTGTCTGGGGCTCCTCTCGCAAAGGTCATCAACCGACGACTTTGGGCATTGCTGAGGGACTCATGACAACTGTCCCATGCTTTTCACTGCCCCCCCAGAATACTGTTGGATGGCCCCATCAGGGAAACCTGTGGCAGGAGATGGCACAAGTGCCAGGTCAAGACCTTTATTTCCCCGCCCTCACCTGGTGGCACCAA
  5   1   2       chi Tail                            IMAGE:8541387.5p                                                                  AAAAANCCAACGTTCNNNNGNGAGCCCTACATACAATTCGTCCCGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAAGCTGACAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAGCGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCATGGAAGCTGTGGAGAGATGGCACAGGTGCAGGTCACAACATTATTCCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCTATGCCGCCATTAGGACTGCATCATATGGCCCA
  5   1   2       bld Bone 5g                         IMAGE:8743873.5p                                                                  AAAGAAAGTACATAACAAGATGACATCATATTCGAATTCGTCCCGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAATGTGTCGTCGTGGATCTGACTGCGCTGCAGAAGCCGGCAAGTACGATGACATCAGCGTCATTAGACTGCATCAGAGGGCCCATGAGCATCTGGATACACACAGACCAGGTGTCTCCACTGAACTCCAATGCTGAACAGCTCATCTTCAATCTTTTGA
  5   1   2       bld Brn1 5g                         IMAGE:6952115.5p                                                                    GCTGGTACCGGTCCGGATTCCTGGGATCACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCGTGCCGCCTGCAAAAGCCCGGCCAAGGTACGATGGACATCCAGGGCCGCCCATTTAAGAACTGCATTCAGAGGGGCCCCAAGTGAAGGGAAATCCTGGGGGAATACCACCCAAAGACCCAGGGGTGGTTCTCTCCCCTTGAAACTTTTCAATGGGGGGGAAAAAATTTNAATTCCCCTTCCAAAttttttttGGAAGAACCCCCAAAAGACCC
  5   1   2       add Brn1 5g                         IMAGE:6954232.5p                                                                       CTGGTCCGGTCCGGAATTCTTGGGATCAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAAGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAAAAGACTGTGGATGGCCCATCAGGGAAACTTTGGAAAAGATGGCAAAAGTGCTGGTCAAAACATTATTCCCGGCCTCAACCTGGTGCAACAAAGGCTGTCCGGAAAAATTTATCCCTGAACCTTAACGGaaaaaaaaaCCCGAAAGGGCTTTCCGGGGTTCCCCCACCCCAAAAGGTGTTCCCGTCGCGGGAATCCTGAAACTGGCCACACCTGGAAAAAAACCCGGGGCAAAGGTACAGAAGGAACCTTCAGGGGCCCCCCCATTTAGGAACCTGGCTATCAAAAAGGGGCCCCCAAAGTAAAGGGN
  5   1   2       bld Eye1 5g3  in                    IMAGE:6947798.5p                                                                         GACCGGTCCGGATTCCCGGGATCACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAAAGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGATCTGACCTGCCGCCTGCAGAAAGCCGGGCAAGTACGATGACATCAAGGGCCGCCCATTAGACTGCATCAGAAGGCCCCAATGGAAGGGAATTCCTGGGGAACACCCCCAGAACCGGGTTGTCCTCCACTGGACTTCAATGGGTGGACACTC
  5   1   2       bld Bone 5g                         IMAGE:8743984.5p                                                                         TTCTAGATCGCGAGCGGCAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACTGCGCTGCAGAGCGGCCAGTACGATGACATCAGGCGCATAGACTGCATCGAGGCCATGAGGGATCTGGGATACACCACAGGACCAGGTTGTTCTCTCCCACTGGA
  5   1   2       chi Brn1                            IMAGE:6954379.5p                                                                             CCTAGAGGTTGCGGGATAGCTTACGTAGTGGGAGGAAAAAATTCTCTTTTGTAACAAATTTGGAGAAAGGGAGTATATACGGTATAGCGCCGCAATGGGCGCATGAAGACAAGCGTCTGGAATCAGAGGTACGGAAAATTGGATTAACAGTTCTATTGTATACAGCATGTCACACGGTTTTCTAGGTTAAACATGTTCAAATAATATTTACGCTGGCTATCAGTGTTATAGAATATAATATAGTTATTCCTGATCCCAAGAATGTACTTCCTAGGTATCAAACTGAAATGGGTGATTTGAATGCTGCAACATAACGGGGGGAGGTGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGGAAAGTTATCCCCTGAGCCTGAAACGGAAAAATAACCCGGGAAGGGCTTTTCCCGTGTCCCGCACCCCCAAATGTGTCCCGTCGGTGGATCCGGAACCTGCCGCCCTGCAGAAAGCCGGGCCCAAGGTACCGATGTACAATCAAGGGGCGCGCCCATTTAAAAAAACGGCCACTCCAGAAGGGGGCGCCCACAAGGGATAAAGGGGAAAAACCCCggggggggAATAACAACCCACCN
  5   1   2       bld Tad2 5g                         IMAGE:6935931.5p                                                                             GGGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGTCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTTCACTGCCACCCCGAAAGACTTGTGGATGGGCCCATCAGGGAAAGCTTGTGGGAGAAAATGGCCAAAAAGGTGCCAGGGTCCAAAAACATTTAATTCCCCCGCCCCTTCAACTTGGGGTGGCAGCCT
  5   1   2       bld Tad2 5g                         IMAGE:6936166.5p                                                                             GGGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAAAAGACTTGTGGATGGCCCCATCCAGGGAAAGTTTGTGGAAAAGATGGGCCACAGGTGGCAGGGTCCAAAAACAATTTAATTTCCCCGCCCTTCCAACCTGGGGTGGCAACCCAAAAGGGCCTGGTCCCGGGAAAAAAT
  5   1   2       bld Tad2 5g                         IMAGE:6936138.5p                                                                             GGGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAAGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCCAGAAGACTGTGGGATGGCCCCATCAAGGAAACCTGTGGAAGAAAATTGCACAAGGTGCCAGGGTCAAAAACATTTTATTTCCCGGCCCTCAAACTGGGTGGCAACCCAAAGAGGCTA
  5   1   2       chi Tad1      in                    IMAGE:6878594.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAATGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTTATCTCCGCCCCCTCAACAGATGCCCCCATGTTTGTAGTTGGGCGTGAACCATgaaaaaatatggaaaaactctcttaaaaaTTTGTCTGGGCAATGGCAATCCTGGCGCATACAAAAACTGGTCCTGTGCTCCATCCCCGCGAAAAGGGTCAGTCAAACAGTAAAAACTCTTTGGACCATTCCAATGGAAGGTGACTTCATTGGACTAACATGGTCCCATGTGGCTTTTCACCTGGCACACCACCAAAATAAACTTGTCGTAATTGGGACCAATTTTGGGGAAAATATTCGTTGAGAAAAACACATGGGAAAAAAGTGTTGGCCAGGGTCCCGCAATCAATTTATTTTTACCCTGCCTACTAAACTCTGGGTGGGAANTACAAATTGGGCTGGTTTCAAGTaaaaaaaaTCTTTATTCCCTAGTAGAGATCTATAAAACAAT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6880398.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCANAAGACTGTGGATGGCCCATCAGGGAAAGTTGTGGAGAGATGGCAAAAGTGCAGGTCAGAACATTATTCCCCCCCTCAACTGGGTGCAGCCAAAGGCTTGTCGGAAAAATTTATCCCCTGAGCTGGACCGGAAAAATAAACCGGAAATGGCTTTTTCGTGTC
  5   1   2       bld Tad1 5g3  in                    IMAGE:6881194.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCCATCAAGCAAGCTGTGGAGAGATGGCAAAGGTGCTGGGTCAAAACATTATTCCCGCCCTCAACTGGGTGCAACCAAGGCTGTCGGAAAAAGTTATCCCTTGAAACTGAAACGAAAAAATAAACGGGAA
  5   1   0       chi Te1                             IMAGE:6929838.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAAGAATGGCANAGCTGATCATCAAATGACAAAGTCATCACCCGTCTTTCCAGGGAGCCGTGACCCCCTCCCAACATTTAAGTTGGGGAAGAAATGCTGGGTGCCCGTGGTATGGTGGGTTGGGAAATCCTACCGGGGAAGTCTTTTCCACAAACCCCCCCGAAAAAAAGGGCCCTTCTCTTGGGCCCTTTTGAAAAGGGGAAGGTGGGCCCCAAAggggggggtccctttttattttttcccggcccccccctttttaagaaaaaaaaatgccccccccccccTTGTGTTTTTGTGG
  5   1   2       bld Te1  5g                         IMAGE:6928898.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTTCACTGCCACCCCAGAAGACTGTGGGATGGCCCCATCANGGGAAGCTGTGGGAGAAGATGGGCAGAAAGTGCCAGGGTCANGAAACATTTAATCCCCGGCCCTCCAACTGGGTGGCAGCCCCAAGGGCTTGTTCCGGAAAAAAG
  5   1   2       bld Te1  5g                         IMAGE:6928230.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTTGGCATTGTTGAGGGACTCATGAACACTGTTCATGCTTTCACTGCCACCCAAAAAAATGGTGGATGGGCCCATCAGGGGAAGCTGTTGGAAAAATTGCCAAAAGGTGCAAGGGTCAAAACCATTATTTCCCCGCCTTCCAACTGGGTGGCAACCCAAAGGGCCTGTTCCGGAAAAAATTTATCCCCCTGGAAGCCTTAAAAGCGGAGAAAAAAATAAACCCA
  5   1   2       bld Te1  5g                         IMAGE:6930143.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCCCCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAAANGTGCANGTCAAAACATTATTTCCCGCCTCAACTGGTG
  5   1   2       bld Tad2 5g                         IMAGE:6931088.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGGTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCATTATCTCCNCCCCCTNCTGAGTCCCCGAGGGGTTGTAGTTTGGCTTTCGCCGCGGNcccccccccccccNCN
  5   1   2       bld Tad2 5g                         IMAGE:6931512.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGATGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAAAAGTTGCAGGTTCAGAAACATTATTTCCCGGCCTCACACTGGGTTGCAGCCAAAGGCTTGGTCCGGAAAAAGTTTATCCCCCTGAAGCCTGAAACGGGAA
  5   1   2       bld Tad2 5g                         IMAGE:6935683.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCCGGAAAAGTTATCCCCTGAGCTGAAACGAAAAATAACCGGAATGG
  5   1   2       bld Tad2 5g                         IMAGE:6935677.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGGACCCATGACAACTGTCCATGCTTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAAGAGATGGCAGAAGTGCAGGTCCAAAACTTTATTCCCCCCCTCAACTGGTGCAACAAAAGGCTGTCGAAAAATTTATTCCCCGAACTGAACGGGAAAAATAACCGGGAATGGGCTTTCC
  5   1   2       bld Tad2 5g                         IMAGE:6935191.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGNTGGAGAGATGGCAGAAGGTGCAGGTCAGAACATTATTCCCCGCCTCAACTGGGTTGCAGCAAAAGCTGNTCCGGAAAAAGTTA
  5   1   2       add Tad2 5g                         IMAGE:6935405.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAAATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACCTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAAACGACCAACTTGGGCCTTGGTGGAGGGGACTCATTGACAACCTGGTCCATGGCTTTTTACCTGGCCACCCCAAAAAGAACTGTGGGAATGGGCCCATTCACGGAAAGTTTGTGGTACAAAATGGCCAAAGAGTCCAAGGGTCAAAAACAAATATATTCCCGGACCTCAAACggggggggCAACCAAAAAGGTCTGGTCCCGGAAATAAGTTTATCCCCCGTAAGCCTGTAAACGGCaaaaaaaaaacccgggaaatgggccttttcccttgggttccccccaccccccACAAAGGTGGGCCCCGTCCCGCGGGATACTTGAACACTTGCCGCCCCTGCTCCAAAAAACCCGGGGTCCACAGAAAC
  5   1   2       bld Tad2 5g                         IMAGE:6934875.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCCTCACTGGTGCAACAAAGGCTGTCCGAAAAGT
  5   1   2       bld Tad2 5g                         IMAGE:6931020.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAAGACCGTGGATGGCCCCATCACGGAAAACCTGTGGAAAAGATGGGCAAAGGTGCCCGGTCCAAAACAATTTATTTCCCGGCCTCCAAACTGGGGGGGCAACCAAAAGGGCTGCTCCGCGAACAATAAGTTATTCCCCCGGGAGGCTCTGATAATGGCGaaaaaaaaTTAACACCGCC
  5   1   2       bld Tad2 5g                         IMAGE:6932431.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAAGAGATGGCAGAGGTGCAAGTCAAAACATTTATTCCCGCCCTCAACTGGGTGCAGACAAAGGCCTGTTCGGGAAAAGGTTATTCCCCTGGAACCTGAAACCGGAAAAC
  5   1   2       bld Tad2 5g                         IMAGE:6931820.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAAGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGGTGCAGCAAAAGCTGTCGGGAAAAGTTATCCCCTGAAGCTG
  5   1   2       bld Tad1 5g                         IMAGE:6937653.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGCAAGCTGTGGAGAGATGGCAAAGGTGCTGGTCAGAACATTATTCCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGGAAAAGTATCCCCTGAGCTGAAACGGAAAAATAACCCGGAAATGGGCTTTTCCGTGGTCCCCACCCCCAAATGGTGTTCCGGTCCCGTGGAAATCTGAACCCTGCGCCGA
  5   1   2       bld Tad1 5g                         IMAGE:6937012.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCCTTAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCCACGACAACTTTGGCATTGTTGAGGGACTCATGAACACTGTCCATGCTTTCACTGCCACCCAGAAAAACTGGGGAATGGCCCATCAGGCAAGCTGTGGAAAGAATGGCAAAAGGTGCTGGTCAGAACATTATTCCCCGCCTCCACTGGTTGCACCAAAAGGCTGTCCGGAAAAAATTATCCCCTGGACCT
  5   1   2       bld Tad1 5g                         IMAGE:6938540.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAATTGTGGTAGAGATGGCAGAGGTGCAAGTCAGAACATTTATTCCCCGCCGTCAACTGGGTGCAGCAAAAGGCTGGTCCGGAATAAGTTATCCCCTGGAA
  5   1   2       bld Tad1 5g                         IMAGE:6937800.5p                                                                              GGGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCCTGAGAAATATGAAAAACTCTCTTAAAGTTGTTAGCCATGCATCCTGCACCTACAACATGTCTGGGTTCCCCTCGCAAAGGTCATTCACGACCATCTTTTGCCCTTTCTTGGAGGGACCTCATAACAACTGGCCCATGGCGCTACACGGGGCCCCCCCAGAAATAACTGGTGGGATGTGGCCCCTTCATGCCCTAAACTTGTGGGGAAAAAAATGGCCCACAAAGTTGGCTTGGCATCAAGAAACCCTTTTTTTCCCCCGCCTTTACAATTGTGGTGGTTGTCAAAAACGCCTGCCTTGTAATAACGCGTAATCCCCTCTTGAAACCGG
  5   1   2       bld Brn1 5g                         IMAGE:6952738.5p                                                                              CTGGACCGGTCCGGAATTCTCGGGATCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCCACTGGTGCAGCAAAGGCTGTCGGGAAAATTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTTCGTGTccccccccccAATGTGGTCCGCCGTGGATCTGAACTGGCCGCCTGAAAAACCCGGCCAAGTCCCAAGACTTCAAGGGCCGCCCTTTAAAACTGCTTTCGAAGGGCCCCAATGAAAGGGAATCCCGGGGGATAACT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6878355.5p                                                                               GGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCCTGAGCTGAACGGAA
  5   1   2       bld Tad1      in                    IMAGE:6878285.5p                                                                               GGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACGACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAAGTGCTGGTCAGAACATTATTCCCGCCNTGAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACCGGAATGGCTTTCCGTGTCCCCACCCC
  5   1   2       bld Tad1      in                    IMAGE:6879241.5p                                                                               GGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACTCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAAAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGGCTTCAACTGGTGCAACAAAGGCTGTTCGAAAAGTATCCCTGAAGCTGAACGGGAAAAATAACCCGGAATGGGCTTTCCGTGTCCCCCACCCCCAAATGTGTCCCGTCGGTGGATCTTGACCTGCCGCCCGGCANAAAACCGGT
  5   1   2       bld Tad2 5g3  in                    IMAGE:6872039.5p                                                                               GGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACCTTTGGCATTTGGTGAGGGGACTCATGACCAACTGGTCCATGCTTTTCACTGGCCACCCCAAAAAGAATGGTGGGATGGGCCCCATTCAGGGGAAAACCTGGTGGAAGAAGAATGGGCCAGAAAGGGGGGCCAAGGGTCCCAGAAAACATTTTATTTTTCCCCGGCCC
  5   1   2       bld Tad2 5g                         IMAGE:6932273.5p                                                                               GGACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGAACGTGGATGGCCCATCAGGGAAGCTTTGGAAGAGATGGCAGAGGTGCAGGTCAGAAACTTATTCCCGCCCTCAACTGGTTGCCCCAAAGGGCTGTTCGGAAAAAGTTATCCCTGAACCTTGACA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532276.5p                                                                               GGGAGCACCGAATANAATTGTCCCCTTCGAGGGGTTGATAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATATTCCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAGTATCCTGAGCTGAACGAAAATACGGAATGCTTNNCGTGTCCACCAATGTGTCGTCTGATCGACTGCGCTGCGAGCNGCAGTACATACTCAGCGCATAGATGCTGAGGCATGAGGATCTGATCCAACAGTGCCCGATCAGGAACATCCACTAGCACGATCGAGATT
  5   1   2       bld Tad2 5g                         IMAGE:6871852.5p                                                                                ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATATGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTTGTGGAGAGATGGCAGAGGTGCANGGTCAGAACATTTATTCCCCGCCTCAACTGGGTGCAAGCAAAGGGCTGGTCGGAAAAAAGTTTATCCCCTGGAAGCTGGAAACGGAAAAAA
  5   1   2       bld Ov1  5g                         IMAGE:5074538.5p                                                                                 GACCCACGCGTCCGCACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6879782.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGAACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTTCGTGTCCCCACCCCAAATGTGTCCGTTCTGGAATCTGACCTGCC
  5   1   2       bld Tad1 5g                         IMAGE:6879816.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTANAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCCATCAGGCAAGCTGTGGAAGGAATGGCAAAAGTGCTGGGTCAGAACAATTATTCCCGCCCTCAACTGGTGGCAGCAAAGGGCTGTCCGGAAAAAGTTATCCCTGGAAGCTGGAACGNGAAAAAATAACCCGC
  5   1   2       chi Tad2      in                    IMAGE:6873773.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCGGCAGATGCCCCCGTGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAGTGCATCCTGCACTACAAACTGTCTGGGCTCTCTCGCAAGGTCATCAACGACAACTTTGGCATTGNTGAGGGACTCATGACAGCTGTTCATGCCTTCACTGCAACCCAGAAAATGTGGATGGCCATCAGGGACTGTGAGAATGCAAGTGAGCNAACTATCCGCCATGGCGCAGGCGAGTACTATAGAAACGAGTCGTCCATGCTGTACTCGACCAAAAGCAAGAGACAGGGN
  5   1   2       bld Tad2 5g3  in                    IMAGE:6874662.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGGCTCCTCTCCCAAAGGTCATCCAACGACAACTTTTGGGCATTTGGTTGAAGGGGAATTCTTGGACAACCTGGTCCCATGGCCTTTTCCCTGGcccaccccagaaaaaaattgtggggaatgggccccctccaggggaaaaattttgggggaaaaaaaaattggccaaaaaaGGG
  5   1   2       bld Tad2      in                    IMAGE:6874149.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGGCCATCAGGGGAAGTTGTGGAGAGAATGGCAAAAGTGCCGGTCAGAACATTATTTCCCGCCTCAACTGGGGGCACCAAAGGCCTGTCCGAAAAGTTATCCCCTGAAACTGAACCGGGAAAAATAACCCGGAATGGGCCTTTCCCGGGGTCCCCAACCCCCAAATGTGTTCCCTCTGGGGG
  5   1   2       bld Tad2 5g                         IMAGE:6872884.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCGAAAGTCATCAACGACAACTTTGGCATCGTTGAGGGACGCCTGACAACTGGCCATGCTTTGACTGCCACCCAGAACACCGGGGATGGGCCCATCAGGAAGCTGGGGAAGAAATGGCACAAGGGGCTGGCTCAAAAAATTCATTTCCCGCCCTCCCCTGGGGGCAAGCTAAAGGCCGGGCCGGCAAAAGGCCTATCCCCTGGAACCCGCAACCGGAAAACAATACCCCGGGAATGGCGCCTTCCTCGGTGGTccccccaccccccACAATTTGTGTCCC
  5   1   2       bld Tad2 5g                         IMAGE:6874866.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCCATCAGGGAAAGCTGTGGGAGAGATGGCAAAAGGTGCCAGGTCCGAAACATTATTCCCCGCCCTCAACTTGGGGGCCACCAAAAGGCCTGTTCCGGNAAAAAGGTTTATCCCCCTGGAGCCTTGAAACCGGGAAAAT
  5   1   2       bld Tad2 5g3  in                    IMAGE:6874962.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGNAAGCTGTGGGAGAGATGCCAAAAGGTGCANGGTCANAAAACATTATTCCCCGCCCTCCAACTGGGTGCCAGCANAAGGGCTGGTCGGGAAAAAGTTAATCCCCTGGAGNCTGGAACGGNGAAAAAATAAAACCGGGAAATGGGGCTTTTTCCGGTGGGTCCCCCAC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6872604.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAAACTGTCTGGCTTCCTCTCGCAAAAGGTCAATCAACGACAACCTTTGGGCATTGGTTGGAGGGGACTCCATGGACCAACTGGTCCCCATGGCTTTTTCACCTGGCCCCACCCCAAAAAAGAACTTGTGGGGGAATGGGGCCCCCATTTCAAGGGGGAAAAACCTTGTGTGGGGaaaaaaaaaatggggcccaaaaaagggtgggcccggggggttcacaaaaaaaCCCATTTTA
  5   1   0       chi Tad2      in                    IMAGE:6872738.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAAGNTNNCACTTGCTATCAATGACCCCTTCATCNGACTTGGACTACATGGTGTACATGGTCCAAGTATGACTTCCCCCACGGGCCCGCTTTAAAGGGAACCCCCGCTTAAGGGGTGAAAAAAGGGGAAAACTTTGTGATTCTTTTATGGGGGGGCCCCACGGTTTTTTTcccccccccggggggtttttctctccccggggaggggggggggggggcccccccccccccccccaaaaaaaaaagaaattgggggggggggagaggaaaaaaatgagattgttggcgccccgccccccacgcccgcgcccccNCCN
  5   1   2       bld Tad2 5g   ?                     IMAGE:6876402.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGTGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAAAACATTATTTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGGAGCTGAACGGAAAAAATAACCGGGAATGGGCTTTCCGTGGTCCCCACCCCCAAAC
  5   1   2       bld Tad2      in                    IMAGE:6876117.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTNTGGCATTGNTGAAGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGGGGATGGGCCCATCANGGNAAACTGTGGAAAAGATGGCACCAGGTGCAGGGCCAAAACATTATTCCCGCCCTCAACTGGGGGCAACCAAAAGGCTGTTCGGAAAAAGTTATTCCCCTGAACCTTTAAACGGAAAAAAATAAACCGGGGAAAGGGGCCTTTTCCCGGGGGTcccccaaccccccaaaatggttggtccccctcccGTGGGGAATTTTA
  5   1   2       bld Tad2 5g                         IMAGE:6875571.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTANAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAAAGGTGCANGGTCAAAACATTATTCCCCGCCTCAACTGGGTGCCAGCAAAGGGGCTTGTCGGGAAAAAGTTAATCCCCCTGAACCTGAAACGG
  5   1   2       add Tad2 5g3  in                    IMAGE:6875603.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCNGGNNCAAAGNTNNTCAAGTCACTGGCTATCAATGACCCNCTTCACATTCCNNAAAAAGCN
  5   1   2       bld Tad2 5g                         IMAGE:6873018.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAAAAGACTGTGGATGGCCCCTCAGGGAAGCTGTGNGAGAGATGGCACAGGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCCACCAAAGGCTGTTCGGAAAAGTTATCCCTGGAGCTGAAACGGAAAAATTAACCGGAAATGGCTTTTCCCGGTccccccccccAAATGTGGTCCCCTCCTGGGATCTGTAACTGGCCGCCCTGGAAAAAACCCGGCCCAATACC
  5   1   2       bld Tad2 5g                         IMAGE:6873229.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTACAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAAGGAAGTTGTGGATAGATGGCAGACGTGCAGGTCAGAACATTATTCGCAGCCTCAACTGATGCACCAAATGCTGTCGGAAAAAGTATCCCCTGAGCTGTAACGGAGAAAATAACCCGGGAATGGGCTTTTCCCGTGGTCCCCC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6876635.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGGTGAGGGACTCATGACAACTGTCCATGCTTTCACTGGCACCCAGAAGACTGTGGGATGGGCCATCAAGGGAACCTGTGGAAAAAATGGCCAAAAGGTGCAGGGTCAAGAACATTATTTCCCCGCCTCAAACTGGGTGCCACCAAAGAGCTTGTTCGGGAAAAAAGTAATTCCCCTGGAGCCTGGAACAGGGAAAAAAATTAACACCGGGGAATTGGGCGTTTTTCCCCTGTGGTCTcccccaacccccccAC
  5   1   2       add Tad2 5g                         IMAGE:6874700.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGGGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAAGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCGTCCCTGCACTAAAAACCTGTCTGGGCTCCTCTCCCCAAGGGGATTCAACGACAACTTTTGGCCATTGTTGGAAGGGAACTCCTGAAAAACTGGTCCATGCTTTTCCCCTGCCAcccccacaaaaactgggggaagggccccctccaaggaaaaactggcgggaaaaaaatggccaaaaaGGTGCCACGGTCACAAAACTTTATTTCCCCCCGCCTCAACATGGGGGGCCaaaaaaaaGGCTGGTTCCCGGAAAAAAGCTTATTCCCCTTTAGACCTCGAACGGGGAAACAAATTAACCCCGGCCAAGGCGCCTTCTCCGCA
  5   1   2       bld Tad2 5g3  in                    IMAGE:6872735.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCNTGGCTCCTCTCGCAAAGGTCATCAACGACCACTTTGGCATTGTTGAAGGACTCATGACAACTGGTCATGCTTTCACTGCCACCCCGGAAGACTGTGGGATGCCCCATCCAGGAAACCTGTGGAAGAGATGGCAACAAGGGCAAGTCCAAAACATTTATTCCCCGCCTTCACTTGGGGGCAACAAAAGGCTTGTCCGGGAAAAAGTTATTCCCTTGAACCTGGAACCGGAAAAAAATAACACCGGGAAAGGGGCTTTTccccggggcccccccaaccccccAAAATT
  5   1   2       bld Tad2 5g3  in                    IMAGE:6875474.5p                                                                                 ACTCTGCAACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTANAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGNAAGCTGTGGAGAGATGGCAGAAGGTGCANGGTCAGAACATTATTCCCCGCCTCAACTGGGTGCAGCAAAAGGCTGGTCGGGAAAAGTTTATCCCCTGAGGCTGAAACGGGAAAAA
  5   1   2       bld Brn1 5g                         IMAGE:6954563.5p                                                                                  GCTGGGTAACCGGTCCGGAATTCCTCGGGATTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCCGTGGATCTGAACCTGCCGCCCTGCAGAAAACCGGCCCAGGTACGAATGACCATCAAGGGCCGCCCATTAAAAACTGGCATTCAGAGGGGCCCCAATGAAAGGGAAATCCCCTGGGGATACCACACCAAGGCACCCAAGGTTTGA
  5   1   2       bld Egg3 5g                         IMAGE:6326486.5p                                                                                   GATTCCCGGGGGACCAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAAGGGAATCCTGNNGATACACACACAGACCCAGGGTTGTCTCCACTGGACTTCA
  5   1   2       bld Eye1 5g3  in                    IMAGE:6949569.5p                                                                                   ATTTTCAAGATCACAGACTTCAGAGGGGTTGTATACACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGGTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAAATGGCTTTCCGTGTCCCCACCCCCAAATGTGGTCCGTCGTGGGATCTGACCTGCCCCCCTGCAAAAACCCGGCCAAGTACGAATGACATCAAGGGCGCCCATTAAGAATGCATTAGAAGGGCCCCAATGAAAGGGAAATCCTGGGGAAACACA
  5   1   2       bld Emb4 5g                         IMAGE:5541969.5p                                                                                    GTCCGACAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGTTTTCATTGCCACCCAGAAGACTGTGGATGGCCCATCACGGAAGCTGTCGAGATATGGCCTACGTGCACGTCACAACATTATTCCCGCCTCACCTGGTGCACCAAAGGCCGTCCGAAAAGTTATCCCTGACCTGAACGGAAAAATAACCGGAATGGGTTTCCGTGGCCCCCACCCCAAATGGTGTCCGTCGCGGGATCTGACCTTGGCCCCCTGCAAAAATCCCGGGCCAATCACCAATGACCTTTAAGGGGCCGCCACTTAACAACTGTCCTCCGCACGTGGCCCCATTGGAAGCGGAAATCCGCGTGGGAATACCACTACCACAAACCCACTTGTTGGCTCTCCCTCCN
  5   1   2       bld Bone 5g3  in                    IMAGE:8739231.5p                                                                                    TTACTAATAAAGGATCACATCGATAACGAATTCGTCCCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCTGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCACGGAAGCTGTGGAGAGATGGCAGAGGTGCATGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAACGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCGCCTGCAGAAGCGCCAGTACGATGACATCAAGCCGCCATAGACTGCATCAGAGGGCCCATGATGGAATCCTGGATACCACACAAGAACAGCTGTCTCCACTGGACTCATTGGTTGACCACTCACTCCTCCAATTCTTTGGAATGCCTGAATGCCTGGGCAT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4957279.5p                                                                                     CACGCGTCCGCACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACCACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCAT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5049133.5p                                                                                      CCACGCGTCCGCAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073977.5p                                                                                      CCACGCGTCCGCAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAA
  5   1   2       bld Ga18 5g3  in                       xlk69j13ex.5p                                                                                      GCAACAGGNCACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGANTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGANTGTGGATGGCCCATCAGGNANGCTGTGGAGAGNNGGCAGAGGTNNAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGNNTGTCGGAAAAGTTATCCCTGAGCTGAANGGAAAAATAACCNGGAATGGCTTTCCGTGTCCCCACCCCAAANG
  5   1   2       bld Emb4 5g                         IMAGE:4202094.5p                                                                                       CACGCGTCCGCAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGNTTAGGCTGAAAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAAGAGCGTGACCCCTCCCACATTAAGTGGNGAGATGCTGGTGCCGTGTATGTTGGTGAATCTACTGGAGTCTTCACACCCACAGAGAAAGGCTTCTCTGCACTTGAAGGGAGGGTCCAAAGCGTTGTCGTTATTTCCGCCCCCTTTAGCAAAATGCCCCNTATGTTGGTAGTTGGGNCGTTAACCCATGAGAAATTT
  5   1   2       bld He1       in                    IMAGE:4407285.5p                                                                                       CGCGTCCGCACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTTTCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAG
  5   1   2       bld Ov1  5g                         IMAGE:6317323.5p                                                                                       CCACGCGTCCGAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTTCACTGCCACCCAGAAGACTGTGGATGGGCCATCAGGCAAGCTGTGGAGAGATGGCAAAGGCGGCTGGTCAGAACATTTATTCCCCGCCCTCAACTGGGGGCAACAAAAGGGCTTGGCGGAAAAAAATTATTCCCCTGGACCCTGAACGGGGAATAAATTACCCCGGAATCGGCTTTTCCGGTGGTcccccaccccccAAAAGGTTGGCCCCGTCCCTGGGAACCTGAAACCTGCCCGCCCTTGGCCAAAAAGCCCGGGCCCAAGTTAAGCAATGGACCCTTCCAGGGGCCCCCTCCATTTTAAAAAAACGGGCATTCCAAAGAAGGCGCCCCATTGGAAAAGGGGGAAAACCCTTGGGCGGAATAACACCC
  5   1   2       bld Oo1  5g                         IMAGE:5085410.5p                                                                                         CACGCGTCCGGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTANAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCANAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTNGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGNCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCCAATGAAGGGGAATCCNTGGNGATACACCCNAAGAACC
  5   1   2       bld Emb4 5g                         IMAGE:5515667.5p                                                                                         ACAGGACACAGACTTCCGATGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCNAAGGCTGTCGGAAAAGTTATCCTGAGCTGAACGGAAAATAACCGGATGGCTTTCCGTGTCCCACCCCAAATGTGTCCGTCGTGGATCTGAC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4202119.5p                                                                                          CAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTTGTTATCTTCGGCCCCTCAGCAGATGCCCCCATTGTTTGTGTTGGCGTGAACCATGAAAAA
  5   1   2       bld Bone 5g                         IMAGE:8743478.5p                                                                                          CAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACGGATGGCTTTCGTGTCCCCACCCCAAATGTTTTCGTCGTGATCTGACTGCGCTGCGAGCGCAGTACGATGACTCAGCGCATAGACTGCATCGAGTATTGAGATCTGGAACCACAAGACAGTGTCTCA
  5   1   2       bld Bone 5g3  in                    IMAGE:8739362.5p                                                                                          CAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCGTCGTGATCTGACTGCGCTGCAGAGCCGCAGTACGATGACTCAGCGCATAGACTGCATCGAGCCCAATGAAGGATCTGGATCATCAGACAGTGTCTCACTGACTCATGGGTGACTCAGTC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739814.5p                                                                                          CAGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAGACTGTGGATGGCCCATCAGGAGTTGTGGAGAGATGCAGAGTGCTGTCAGACATATCCCGCCTCACTGTGCAGCAAGCTGTCGAAAGTTATCCCTGACTGAACGAAAATACGATGCCTAGTTCATCATTGTCGTCTGATCGACTGCCCTGCAACGGCAGTCATGACTCAGGTCCATAGAACTGCTATAGGCCATTG
  5   1   2       bld Te2N 5g                         IMAGE:7764825.5p                                                                                           AGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAGCCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGNCCATCANGNAAGCTGTGGAGAGATGGCAGAAGTGCANGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAGTATCCCTGAGCTGAACGAAAAAATACNGAATGGGCTTTCGTGCCCCACCCCAATGTGTCGTCCG
  5   1   2       bld Tail 5g                         IMAGE:8543928.5p                                                                                           AGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAAANGTGCAGGTCAAAACATTATCCCGTCTCAACTGTGCAGCAAGGCTGTTCGAAAGTTACCTTGAGCTGACCGAAAAATACGGATGGCTTTCGTGTCCCCACCAATGTGTCGTCATGATCGACTGCGCTGCNAACCGGGCATA
  5   1   2       bld Lmb2 5g3  in                    IMAGE:8635520.5p                                                                                           AGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAG
  5   1   2       bld Bone 5g3  in                    IMAGE:8739403.5p                                                                                           AGGACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCGTCGTGATCTGACCTGCCGCCTGCAGAAGCGCAGTACGATGACTCAGCGCATTAGACTGCATCGACGTCATGAAGAATCTGGATACACACAAACCAGTTGTTCTCCCACTGGACCTTCCATGGGTGACA
  5   1   2       bld Emb4      in                    IMAGE:4957764.5p                                                                                            GACGCGTGGGTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACC
  5   1   2       bld Brn1 5g                         IMAGE:6951897.5p                                                                                            GCTGGGGTACCGGTCCGGAATTCTCGCGGATAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTCCCGCTTCAACTGGGTGCACAAAGGGTGTCCGAAAAATTATCCCCTGAGCTGAACGGaaaaaaaaaCCGGGAATGGCTTTTCCGTGTCCCCCACCCCAAAATGTGTCCCCTCCTGGGATTCTGAACCTGGCCGCCCTTGGAAAAAACCCGGGCCCAAGTAACGAATGGAACATTCAAAGGGccccccccTTTAAAAGAATTGGCCACTCCAAAAGGGGCCCCCCAATTGAAAAGGGGGAAAATCCCTTGGTGGGGTATTACAccccccccAAAGAAACCCCC
  5   1   2       bld Thy  5g                         IMAGE:8546793.5p                                                                                            AGGACACAGACTTCAGAGGGGTTGATAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGATCATGACAACTGTCCATGCTTCACTGCCCCCAGAAACTGTGGAGGCCCTCAGGGAACTGTGGAGAGATGGAGAGTGCAGTCAGACATTATCCGCTCACTGGGCAGCAAGTGCGAAAGTTCCTGACTGACGAAATACGGATGCTTCTGTCCACCAATGGCTCTGATTACGCCTGAAGCGCATCATACTAGCGCTAATGTAAGGCAGAGACTGACCCAACGTGCCCGATAGGACCCCCTAGACGATCGA
  5   1   2       bld Tbd1 5g                          Tbd1-da93a01.y1                                                                                             GACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGGAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAAGCCTCTCTGCACTTGAAAGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTATGTTGTTAGCA
  5   1   2       bld Emb4 5g                         IMAGE:5514039.5p                                                                                             GACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGNCAAGGCTGTCGGAAAAGTATCCNTGAGCTGAAACGANAATAACNGAATGGGCTTCGTGTCCCACCCAATGTGTCGTCGTGATCGACTGCGCTGCAA
  5   1   2       bld Brn1 5g                         IMAGE:7019285.5p                                                                                             TTCCGGATCTTCAGAGGGGTTGATAAACCTAACCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCANAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGANAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGGATCTGACCTGGCCGCCTGCAAGAAGCCGGGCCAANGTACGGATGAACATCAAGGGGGCCGCCATTTAAGAACTGCATCAGAAGGGGCCCCAANTTGAAGGGGGAANTCCCTGGGGAATTACACCACCAAGGACCCAGGG
  5   1   2       bld Em10      in                    IMAGE:7981256.5p                                                                                             ATTCCCGGGATCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAGGCTGTCGGAAAAGTTATCCTGAGCTGACGGAAAAATACGGAATGGGCTTCGTGTCCCACCCAATGTGTCGTCTGGACTGACTGCGCTGCAAAGCGGCAGTACAGACATCAGCGCATAGACGCTCAAGGCCATGAGGG
  5   1   2       chi Ov1                             IMAGE:8329063.5p                                                                                             AACATCTCCAAGTTGATGACTGCGCCACTCCCGTGTCCCCAATCCTGTATTTTGGATTTGGCGAACCCTCTCCCCCCCATTCCGTTTGTGGTGATTCGGCCTACTATTGATCCCTGCTATGCTTATGTCACTTCTGGGTGTGCACGGCTTGAAACCATTTTTACTTCCGTGTTTTGTGTCTTGATTTCACTACCCCCCTCCGATACTTTTATGCAACTTATGATGCTGATAATGGCAAGCTGATCATCAATGACTCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGTTGTGGATAGATGGCAAATGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCNGAAAGTTATCCCTGAGCTGAACG
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8531883.5p                                                                                             GACACAGACTTCAGAGGGGTTGATAAACCACATCTAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGACTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAATGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTATCCCTGAGCTGAACGGAAAA
  5   1   2       bld Ov1  5x                         IMAGE:6318160.5p                                                                                              ACACAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTGTGGGCATTGTTTGAGGGACTCATGACAACTGGCCATGCTTTCACTGCCACCCAGAAAACTGTGGATGGCCCTTCAGGCAAACTGTGGAAAAAAGGCAAAGGTGCTGGTCCGAACATTAATTCCCCCCTCCACTGGGGGCAGGAAAGGCGTGCCGAAAAAATTATTCCCCGGAGGCTGAAACGGAAAAAATAAACCCGAGAGGGCTCTGTCCAGGGccccccccaccccAGAGAGGGGGCCCGGCCCGTGGAAACTTGGGACCTGGCCCACCTCGGCAAGAAAGCCCGGGACAAGGTATGACAGGACACTCTCGGGGCCCCGGCCCTCAAAAATTGCGTTCGTAGGTGGGCTCACCTGCAACGGATCACCCTCCGGGCGCGAGTGTCCGCAGGCCAAGGGGTCGGGATTTAGCTGTAACGTTTAGACGGGTGGAGAAGTGACCTACGCTGCGCGTCTGCGGGCGCGACGCCGGATTGCGGGAGATAGGNCGCACGAACGAACGAACGTTACGGCGGAAGACGACGCTTCCCGTCCGCGAACACAAAGAGAAGAGCGGCTCCACCAGACCGCAGGCACCGGGTGGGTGTGAGCAACTAAGGGG
  5   1   2       bld Oo1  5g                         IMAGE:5085405.5p                                                                                              CACGCGTCCGCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGNCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCANAGGGGCCCAATGAAGGGGAATCCCTGGGATACACANCNAGAACCAGGN
  5   1   2       add Brn1 5g                         IMAGE:6951769.5p                                                                                              TCCGGATCTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGGAAGCTGTTGAAGAGAAGGGCACAGGTGCCTGGTCAAAAACATTATTTCCCCGCCTCAACTGGGTGCCAGCAAAGAGCTGTCCGGAAAAAATTTATCCCCCTGAACCTTGAACGGAAAAAAATAACCCCGGAAATGGCCTTTTTCCCGTGTGccccccacccccAAAATGTTGGTCCGGCTCCGTGGGAATCTTGAACCCTGGCCCCGCCCTTGCACAAAAACCCCGGGGCCCACAGATACACAAATGGACCATTCCAAAGGGACCGCCCCCATTTT
  5   1   2       bld Brn1 5g                         IMAGE:6955768.5p                                                                                              GGCTGGACCGGTCCGGATTCTCGGGATCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAAGCCGCCATTAAGACTGCAT
  5   1   2       bld Bone 5g                         IMAGE:8741141.5p                                                                                              ACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACCTGCGCTGCAGAAGCGCAGTACGATGACTCAGCGCATTAGACTGCATCAGAGGGCCAATGAAGGGAAATCCTGGGTTGCCACCA
  5   1   2       bld Bone 5g                         IMAGE:8741342.5p                                                                                              ACACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAGCTGTCGAAAAGTTATCCCTGGCTGACGAAAATACGATGCTTTCTGTCCCACCAATGTGTCGTCTGATCTGACTGCGCTGCAGCCGGCCAGTACCATGACTCAAGCCGCCATAGACTGCCATCGAGGCCATGAG
  5   1   2       bld Kid  5g                         IMAGE:7012260.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCANAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATNAACGGATGG
  5   1   2       bld Te2  5g                         IMAGE:7394216.5p                                                                                               GATAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAAGTATCCTGAGCTGAAACGAAATACNNGATGGNNCTTCGTGTCCACCAATGTGTCGTCGTGATTGACTGCGCTGCGAGCCGCAGTCATACTCAGCGCATAACTGTCAGGCATGAGGACTGGACCCAACAGTGCCAGATCAGGATCTCCA
  5   1   2       bld FaB  5g                         IMAGE:8073069.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAA
  5   1   2       bld Ov1  5g                         IMAGE:8330306.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGATAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCTCAAAGGTCATCAACAACAACTTTGGCATTGTTGAAGGACTCATGACAACTGTCTATGCTTTCACTGCCACCCATAAAACTGTGGAAGGCCCAACTAGAAAGTTGTGGAAAGAATGCAAGGTGCTAGGTCAAAATTTATTCCCCCTCTAATGGTCAACAAAAGTTGTCGAAAAATTATTCCTGAGCTGAACGAAAATTAC
  5   1   2       add Tail 5g3  in                    IMAGE:8541979.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGNCAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGTCAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATATTTCCCGCTCAACTGTGCAGCAAGGCTGTCGGATAGTTATCCTGACTGACCGAAAATACCGGAATGGCTTCGTGTCCTCCCCAATTGTCGTCGGGATCGACTGCGCTGCAAGCCGCAGTAGATGACTCAGCGCATAGATGCTCAAGCC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739348.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACGGATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCTGATCTGACTGCCGCCTGCGAAGCGCAGTACGATGACTCAGCGCCATAGACTGCATCGAGGCCAATGATGAATCTGGATACTCAGAACAGTGTCCCTGACTCATGCACTAGTCTCACAGGAGGCTAGTCTGAAACTT
  5   1   2       bld Bone 5g3  in                    IMAGE:8740326.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTTATCCTGAGCTGAACGGAAAATAACGAATGGCTTTCGTGTCCCCACCCCAAATGTGTCGTCTGATCTGACTGCCGCCTGCAAAGCGCAGTACAATGACTCAGCGCATTAGACTGCATCGAGCCAATGAGGATCTGGATACACCAAAACAGTTGTTCTCCACTGACCTCCAATGGGTG
  5   1   2       add Bone 5g                         IMAGE:8741759.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTTGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAAAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAACGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAAAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAAAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACCACTTTGGCATTGTTGAAGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGGAGAGATGGCAGAAGTGCAAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAGCTGTCCGAAAAGTTATCCCTGAACCTGAACCGAAAAATAACCGAATGGCCTTTCCGTGTCCCCAACCCCAATGTGTCGTCCTGGATCTGACTGCGCCCCTGCAAGCGCAGTACAATGAACTCAGCCGCATAGACTGCATCGAGGCCCATGAGGCATCTGGGAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740761.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGATCTGACCTGCGCTGCAGAAGCGCAGTACGATGACATCAGCGCATAGACTGCATCCGAGGCCCATGATGCATCTGGGATACCACAGACCAGTGGTCTCCACTGACTCCAATGTGAACCTCAGTCCTCCAAT
  5   1   2       bld Bone 5g3  in                    IMAGE:8739479.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGATCTGACTGCCGCCTGCAGAGCCGCCAGTACGATGACTCAGCCGCCATAGACTGCATCGAGGCCATGATGCATCTGGATACATCAGACAGTGGTCTCCACTGACTCATGGTGAACGTCATCCCTCAAT
  5   1   2       bld Bone 5g3  in                    IMAGE:8740784.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAAGCGGCAAGTACGATGACTCAGCGCATAGACTGCATCGAGGCAATGATGATCTGGATACCAACAGACAGCTGTCTCCACTGACTCAATGGGTGAAACCTCACATTCCTCCAATC
  5   1   2       bld Bone 5g                         IMAGE:8743550.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACGAATGGCTTTCCGTGTCCCACCCCAAATGTGTCGGTCATGATCTGACTGCGCTGCAGAAGCGCAGTACGATGACTCAGCGGCATAGACTGCATCGAGTCATGAGATCTGGGAACACACAAGACAGGTGTCTCCACTGACT
  5   1   2       bld Bone 5g                         IMAGE:8743181.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTATCCCTGAGCTGAACGAAAAATAACGATGGCTTTCGTGTCCCCACCCAAATGTG
  5   1   2       add Bone 5g                         IMAGE:8742710.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCAACTGCCACCCAGAAGACTGTGATGCCCATCAAGGAAGTTGTGGAAGATGCAGAGGTGCAGTCCAACCTATTCCGCCTCACTGGTGCACAAGCTGTCCGGAAGTTATCCCTGGACCTGAACGAAATTACCGAATGGCATCGGTCCACCATGTCGTTGATTGACTGCCTGGAACGCATCATGAACTAGGCCATTAACTGCGCTCAAGGCCATTAG
  5   1   2       bld Bone 5g                         IMAGE:8741283.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCGTCGTGATCTGACTGCGCTGCAGAAGCGGCAGTACGATGACTCAGCGCATAGACTGCATCAAAGGCCCATGAAGGAATTCTGGGATTACACCCCAGGAAC
  5   1   0       chi Bone      in                    IMAGE:8739576.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTTCTCTTAAGTTGTTAGCAATGCATCCTTGCACTACAAACTGTCTTGGCTCCTCTTGGCAAGTCATTCAACGACAACTTGGCATTGTGAGGACTCATGACACTGTCATGCCTCATGCCACGGAAACTGTGGATGCCATCAGGAGTTGTGGAGATGGCGAAGTCAGATCGAACTATTCCGGCCTCTGGGCCCAAGGCTCGTAAGTATCCTAAGTCAGAATCGAGGTTCGTCCACAATGTCT
  5   1   2       bld Bone 5g3  in                    IMAGE:8740470.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGATGCCCATCAGGAAGTTGTGGAAAGATGCAAGTGCTGTCAGACATTATTCCCGCCTCACTGGGTGCAGCAAAGCTGTCGAAAGTTATCCCTGACTGACCGAAATACGATTGCTTCAGGTCCCACCAATGTCGTCTGATCTGACCTGCCCCTGCACGGCAATACATGACTCAGCCTAGATCGTCTAAGGCCATGAGAATCTGGTACCAAAACGTTTGTCCCCGA
  5   1   2       bld Bone 5g                         IMAGE:8743124.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTTCCTCTCGCAAAAGTCATCAACGACAACTTTGGCATTGTGTGGAGGACATCATGACAACTGGTCCAATGCCTTTCACTGGCCCACCCAGAAGAACTGTGTGATAGGCCCATCTCGGGAAGCTGTTGGAGAGATATGCAGAAGTGCAAGGTCAGAACATTATTCCCGCCTTCAACTTGGTTGCAGCCAAGCTGTCCGGAAAAGTTATTCCTTGAACCTGAACCGGAAAAATAACCGGAATGGCCTTTCCGTGTTCCCACCCCAAATGTGTCCGTCCTTGGATC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740210.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAAACTCTCTTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGGAAAGGGCATCAACGAACAACTTTGGCA
  5   1   2       bld Bone 5g                         IMAGE:8743139.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAGCTGTCGAAGTATCCCTGAGCTGACGAAAAATACCGATGGCTTCCGTGTCCCACCCCAATGTGTCCGTCGTGGATCT
  5   1   2       chi Bone                            IMAGE:8741737.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAAGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTTCCCAACCACCAGAGAAGGCTCCTCTGCACTGAAGGGAGGTGCCAAGCCTGTCGTTATCTCGCCCCCTCAGCAAATGCCCCCTGTTTTAGTTGGCGTGACATGAGAAATTTGAAACCTCTTAAAGTGTAGCATGCTCTGCATTAAAATGGTTGGTCTCCTCGAAGGTCTCAGACACATTGCATTGCAGGACTTAAACTGACTGCTTATGCCTAAATGGATGCCTCGGGACCTGCAGTGCCATGTGTTTCACATTCGCTCAAATGGCCCACTGTTAGATTCGTAAAGAAAAAAACCGGGTGTGCCTGGGCCCCAATGGCCCCGGTAAGGGGCGGGGGACGCATTAAA
  5   1   2       bld Bone 5g                         IMAGE:8744107.5p                                                                                               CACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCACGTCAGACATTATTCTCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACCTGCGCTGCAGAAGCCGCAGTACGATGACATCAGTCGCATTAGACTGCATCAGAGGCCCATGAGGATCTGGCATACACAGAACAGGTGTCTCCACTGACTCCATGGGTGAACCTCATCT
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3201224.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCATGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAGAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAATGTCATCAACGACAACTTTTGCATTGTTGATGGACTCATGACGACTGTCCATGCTTTCACTGGCACCCAGAAGACTGTGGATGGCCCATCATGTAAGCTGCTGAGAGATGGCAGACGTGCAGGTCATAACATTATATCCGCCTCAACTGGT
  5   1   2       bld Emb4 5g                         IMAGE:5543416.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAAACGAAAAATAACCGGAATTGGCTTTCCGTGTCCCCACCCCCAATGTGTTCCGTCCTGGGATCTGACCTGCCGCCTGCAGAAACCCGGCCAAGTACCATGGACTCCAGGGCCGCCCATTAAGACTGCATCAAAAGGGCCCCAATGAAGGGAAATCCTGGGAATACCCACCAAAAACCAGGTTG
  5   1   2       bld Emb4 5g                         IMAGE:4683660.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCANAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCCGGAATGGCCTTTCCGTGTCCCCACCCCANATGTGGTCCGTCCTGGGATTCTGACTGCCCGCCCTGCAGAAAGCCCGCCCAAGGTACGCATGACCATCCAAGGCCCCGCCATTTAAGACCTGGCTTCCGGAAGGGGCCCCAATGGGAAAGGGGAATCCCTGGGGGATAA
  5   1   2       bld Emb4 5g                         IMAGE:5570989.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGGGGATGGCCCATCAGGGGAACCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCCTCCACTGGTGGCACCAAAGCTGTCGGAAAAGTTATCCCTGGAGCTGAACGGAAAAAATAACCGGAATGCCTTTTCCGGGTCCCCACCCCAAAAGGTGTCCCGTCGGGGGAATCTGACCCTGGCCCCCTGTCAAAAAACCCGGCCCAAGTAACGATGGACCTTCAAGGGCCCCCCATTTAGAACTGGCATTCAAAAGGGCCCCAATGGAAGGGGAATCCCTGGGGAAACCTCCCCAGGAACCGGGTTGGCCCTCCCA
  5   1   2       bld Emb4 5g                         IMAGE:5572379.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAAAAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAACTGAACGGAAAAATAACCGGAAATGGCTTTCCGTGTCCCCACCCCCAAATGTGGTCGGCCCTGGGAACTGGACTTGGCCCCCTGCAAAAACCCGGCCACGTACCGATGGACCTCCAGGGCCGCCCTTAAAAAACTGAATTCAGAAGGGCCCAATTGGAAGGGGAATTCCCTGGGGAAACCCCCCAGAGACCCAgggggggggCCCCACGTGGAGCTTCCAATAGGGGGAC
  5   1   2       bld Eye1 5g                         IMAGE:6959168.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGGTGTCCCGTCGTGGATCTGAACCTGCCCGCCTGCAGAAAGCCGGGCCCCAAGTACGATGAACAATCAAGGGCCGGCCCATTAAAGACTGGCATTCAGAAGGC
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956667.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAAACGGAAAATAACCGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGGATTCGGACCTGCCGCCCTGGCAAAAGCCGGGCCAAGTACGATGAACATCT
  5   1   2       bld Tail 5g3  in                    IMAGE:8542547.5p                                                                                                CCAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATTAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCA
  5   1   2       bld Bone 5g3  in                    IMAGE:8739360.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAAGCGGCAGTACGATGACTCAAGCGCATAGACTGCATCGAGGCCCATGAATGCATCTGGATAACACACAAGAACAGTTGTTCTCCCACTGACTTCAATGGGGTGAACACTTCAATC
  5   1   2       bld Bone 5g                         IMAGE:8743313.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAGCTGTCGAAAAGTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAAATGTTGTCCGTCGTG
  5   1   0       chi Bone                            IMAGE:8741617.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCCAGGAGCGTGACCCCCTCCAACATTTAAGTGGGGAGATGCTGGTGGCCTGTATGTGTTGGAATCTTACTGGAGTCTTCACAACCACCGAAGAAGCCTCTCTGCACTTGAAGGAAGTGCCAAGCGTGTCGTATCTTCGCCCCCTCACAAATGCCCCCATTTGTGATTGCTGAACATGAAAATTGAAACTCCTAAGTGTAGCATGACTCTGCATAAAATGTTGTCTCTCGAGGCTTCAGACTTGCATGTAAGAGTGGAACTTCCTGGTTTCTGCCGAAAACTGTAGGCCTCTGAGTTGGGAAGGGGGGATGGATTCAATCTGCGTAAACGCCCAAGGTGATAAGTCCCCTGCCCAGCAAAGGGGA
  5   1   2       add Bone 5g3  in                    IMAGE:8740169.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAAGCCTCTCTGCACTTGAAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAAATATGAAGAACTCCTCTTAAAGTTGTTAGCAATGCATCCTGCACTAACAAACTTGTTCTGGCTCTCTCGCAAGTCATCACGAACACCTTGGCATTGTTGAGGGACTTCATGACAACTGTTCCATTGCTTTCACTGCCACCTGAGACTTGTGGATGGCCATTCAGGATTGTGGAAGATGCAAGTGCAGGTTCGAACCATTATTCCGCCCTCACTGGTGGCGACAAGCTTCGAAAGTTATTCTGACTGAGCGAAATATCCGAATGCTTCTGGTCCACCAGTTCCTCCGAAATGACTGCCTGGAAGCGGCATCAGTAATCG
  5   1   2       chi Bone      in                    IMAGE:8740217.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACACAGAAGAAGGCCTCTCTTGCACTGAAGGGAAGGGGCCAGGCGTGTCCGTTATTTCGCCCCCTCAGCAGATGCCCCATGGTTGTAGTTGGCGTGGACCTGGAAAATTAAAAAACTCTCTTAAGTTGTAGCATGATCTGGACTAAACTGTTGGCTCTTTGAAGGTATCAGCGACTTGGATTGTGAGGATCTGACCGGCTGCTTCTGCACTAAATGGAGGCCTAGAGTTGAAAGGGAGTGTCAAATTCCGCCATGGCCCAGGTCGAATTCTGGACGGAATCAAGGTTGTCACATTTTTCCTGTTTATTGCCGGAAAAACCCGTAATATCTGCTTTATA
  5   1   2       bld Bone 5g                         IMAGE:8743469.5p                                                                                                ACAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAGTATCCCTGAGCTGACGAAAAATACGATGCTTTCGTGTCCCCACCCCAATGTGTCGTCCTTGAATCGGACTGCGCTGCCAGCGCAGTACATGACTCAGCGCATTAGACTGCATCGAGTCAATGAAGAATCCTGGATACACAGACAGAGTT
  5   1   2       bld Ga18 5g3  in                       xlk72h09ex.5p                                                                                                ACAGACTTCAGAGGGGTTGNTAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGNTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGANTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGNCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTNCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGNACGGAAAAATAACCGGGAATGGCTTTCCGNGTCCCCCACCCCAAATGTGTCCGTCNNNGNATCTGACCTGCCGCCTGCAG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4202314.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAA
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3548400.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCACAGGTCATCAACGACAACTCTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCCGCTCAACTGGTGCAGCCAAAGCTGTCCGAAAAAGTATTCCCTGACTGAACGGAAAAATAACCGGATTGCTTTTCGTGTTCCCAACC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959087.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACT
  5   1   2       bld Emb4 5g                         IMAGE:5570592.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTTCCGTCGTGGAATCTGAACCTGCCGCCCTGCAAAAACCCCGCCCAAAGTACCAATGACATCAAAGGCCGCCCATTAAAAGACTTGCATCAAAAAGGGCCCCAATGGAAAG
  5   1   2       bld Ov1  5g                         IMAGE:6317022.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGATCTGACCTGCCGCCTGCAGAAACCGGCCAAGTACGAATGACATCCAAGGCCGCCCATAAAGA
  5   1   2       bld Kid  5g                         IMAGE:7008955.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAAACTGAAAAATACCGAATGGNCTTTCGTGTCCC
  5   1   2       bld Eye1 5g                         IMAGE:7020226.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCANAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAAATGGCTTTCCGTGTCCCCACCCCCAATGTGTCCCGTCGTGGGATCTGAACCTGCCGCCCTGCAGAAAGCCGGGCCAAAGTACGNNAATGACATCAAGGGCCGNCCATTTTAAGACTGGGCATCAGAAGGGGCCCAAATGGAAAGGGAAAATCCTGNNGATACANCACAAGGAA
  5   1   2       bld Ga12 5g3  in                         XL197d07.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGNANAGGTCATCAACGACAACTTTGNGCATTGTTGAGGGACTCATGACAAC
  5   1   2       bld Ov1  5g                         IMAGE:8329978.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACNG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8329445.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGG
  5   1   2       bld Ov1  5g                         IMAGE:8330374.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAGTTTATCCTGAGCTGAACGGAAAAATAACGGGAATGGGCTTCG
  5   1   2       bld Lmb1 5g                         IMAGE:8533407.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAGGCTGTCGGAAAAGTATCCNTGAGCTGAACGAAAAATACCNGATGGCTTNCGTGTNCCCACCAATGTGTCGTCGTGGACTGACTGNCGCTGCAGAGCCGGCAGTACATGACTCAGGCGCATAGATGCTCGAGGCCATGAGGATCTGGATCCCA
  5   1   2       bld Lmb1 5g                         IMAGE:8535856.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTCCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAAGTATCCTGAGCTGAAACGAAAAATACCGAATGGGCTTCGTGTCCCACCCAATGTGTCGTCGTGATCGACTGCGCTGCGAAGCGGCAATACATGACTCAGCGCATAGACGCA
  5   1   2       bld Spl  5g                         IMAGE:8462403.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTNCCGCCTCACTGGTGCAGCAAAGCTGTNCGAAAGTTATCCTGAGCTGAAACGAAAATACGGAATGCNNTTCGTGTCCACCCAATGGTCGTCGTGACTGACTGCGCTGCGAGCCGGCAATACATACTCAGCGCATAAATGCTCGAGCCATGAGGATCTGGTACCA
  5   1   2       bld Bone 5g                         IMAGE:8741093.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAAGCGGCAGTACGATGACATCAGCGCATAGACTGCATCAGAAGCCCAATGAAGGTATCCTGGGAATACCACCAACAAGAACCAG
  5   1   2       bld Bone 5g                         IMAGE:8742373.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACCGGATGCTTTCCGTGTCCCCACCCCAAATGTTGTCCGTCGTGATCTGACTGCCGCCTGCAGAGCGGCCAGTACGATGACTCAGCGGCATTAGACTGCATCGAGGCCAATGAAGAATCTGGGATCACCAGAACAGTTGTCTCCCACTGACTTCAATGGTGAACACTCCA
  5   1   2       bld Bone 5g                         IMAGE:8743711.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAACGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGCCCATCAAGGAAGTTGTGGAGAGATGCAGAAGTGCTGTCAGACATTATTCCCGCCCTCACTGGTGCAGCCAAGCTGTCGAAAGTTATCCCTGGCTGACCGAATACGGATGCTTCTGTCCCACCCATGGTCGTCTGGATCGACTGCCCTGCAGCGCAGTCATGACTCAGCGCATGACTGCATCAGTCATGAGATCTGGTACACAGACAGT
  5   1   2       add Bone 5x                         IMAGE:8741644.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTTCTTCCAAGGAGCGTGACCCCTTCCAACATTTAATTTGGGGAGAATGCTTGGTGCCGTTGTATGTGGTTGAAATCTTATTGGAAGCCTTCACAAACCACCAGGAGAAAGCCTTTCCTTACATTTAAAGGAAGTGGCCAGCCTTGTCCTATATCTCGCCCCCTCACCAGAGCCCCCATGTTGAGATTTGCCTGAACAAGGAAAATTAGAAACTCTCTAAAGTGTTACATGACTCTGATAAATTGTGGTCCCTCCGAGGCTCACACACTTGATTTAAGAATTAAATGCCGTTTTTGCCAAAATGGAGCCTCGGAGTTGGGATTGGAATGCGTAAATTTCCTCAATCGCCCATGTTTTAATTCCTGCAGAAAGACGttttttttttCT
  5   1   2       bld Bone 5g3  in                    IMAGE:8739729.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATACCGGATGGCTTTCCGTGTCCCACCCCAAATGTGTCGTCGTGATCTGACTGCGCTGCAGAAGCGCAAGTACGATGACTCAGCGCATAGACTGCATCGAAGGCCATGAAGGGAATCCTGGGAATACACCCAGAACCAG
  5   1   2       bld Bone 5g3  in                    IMAGE:8740675.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGTCATCAACGACACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAAGGAAGTTGTGGAAAGATTGGCAGAGTGCAAGTCAGAACATTATTCCCGCCTCAACCTGGTGCAAGCAAGCTGTCGAAAGTTATCCCTGACCTGACGAAAAATACCGATGCTTCCTGTCCCACCAAATGTGTCGTCTGGATCTGACCTGCCCCTGCAGCCGCAGATCATGAACTCAGCGCATAGACTGCATCAAGCATTGAGGAATTCTGGTTCCCGGACCGGGTGTGTT
  5   1   2       bld Bone 5g                         IMAGE:8741149.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCGTCGTGGATCTGACTGCGCTGCAGAAGCCGGCAGTACGATGACTCAGCGCATTAGACTGCATCAGAAGGGCCAATGAGGGAATTCTTGGGATTACCCCCCCAGG
  5   1   2       bld Bone 5g                         IMAGE:8742654.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGTCATCAACGACACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGCCCATCAGGAGTGTGGAGAAGATGCAGAGTGCTGTCAGACATTATTCCCGCCTCACTGGTGCAGCAGCTGTCGAAAGTTATCCCTGGGCTGACGAAATAGCGAATGCTCTGTCCACCCAATGGTCGTCTGGATCTGACTGGCCCTGCAGCGCAGTCATGACTAGGCCATGACCTGACTAGGCCCATGAGGAATCTGTATAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740629.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAAGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGAACAACTGTCCATGCTTTCACTGCCACCCAGAAGAACTGTGGATGCCCATCAAGGAAGTTGTGGGAAGAGAATGGCAAGTGCTGTCAGACATTATTCCCGCCTCAACTGTGCAGCAAGCTGTCGAAAGTTATTCCTGACTGACGAAAATAACGATTGCTTCGTTCCACCAAATGTCGTCTGATGACTGCCCTGGACGCAATCATGATAGCCATGACGTCAGACCATAGGATCTGGAACCCAACCGGTGTC
  5   1   2       bld Bone 5g                         IMAGE:8743291.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGCTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTTCCCCCACCCCAA
  5   1   0       chi Bone                            IMAGE:8742981.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAAGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGAGATGCTGGTGCCGTGTATGTGTGGAATCTACTGGAGTCTTCAACAACCACAGAGAAGCCTCTCTTGCACCTTGAAGGAGGTGCAAGCGTTGTCGTATTCTCCGCCCCTCAACAGAAGCCCCCATTGTTTGTAAGTGCCTGAACCTGAGAAATATGGAAACTCTCTTAATTGTACAAGATCTGCATAAACTGTTGTCCTCTGAGGTCACAGAAACTTGATGTTAGGACTGGGAACGTGCTGGTACGTCAAAACTGAGTCTCGAGCTGGGAATGGGATGGTTAAATTTCTCCAATGGCCACCGTCTAATTACAGCGAATCGCGGGGGTTGTccccccccA
  5   1   2       add Bone 5g3  in                    IMAGE:8740222.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGGAGCGTGACCCCTCCAACATTAAGTGGGGGAGGATGCTGGGTGCCGTGTATGGTGGTGGGAATCTACTGGAAGTCTTCACAACCACAGAGGAAGGGCTCCTCTGGCACTTTAAAGGGAAGGTGCCAAGGCGTGTTCGTTATCTCCGGCCCCTTCACAGATGCCCCCCAGTTTGGTAGTTGGCGTGAACATGAGAATTTGAGAACTCTCTTAAAGTTTTAGCAATGATCTGGGATAAACGGTCTGGGTCCTCTCAAAAGGA
  5   1   2       bld Bone 5g3  in                    IMAGE:8740937.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAACGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACCTGCCGCCTGCAGAAGCCGGCCAGTACGATGACATCAAGCCGCCATTAGACTGCATCAGAGGCCCATTGAAGCATTCTTGGATACACACAAGACATTTGTTCTCCCACTGAACTTCAAATGGGTGGAACCTTCAATTCC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740284.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGATGGCTTTCCGTGTCCCCACCCCAAATGTTGTCCGTCGTGGATCTGACTGCGCTGCAAAAGCGCCAGTACGATGACTCAGCCGCAATAGACTGCATCGAGCAATGAAGGAATCTGGGAAACACAAGACAGTTGTCTCCATTGACTCAATGGTGGAACTCCATTCCTCCT
  5   1   2       add Bone 5g3  in                    IMAGE:8740055.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAAGCCTCTCTGCACTTGAAAGGGAGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTAACAAACTGTCTGCTCTCTCGCAAAGTCATCAACGAACAACTTGCCATGTTGAGGACTCATGACACTGTTCCATGCTTCACTGCCACCAGAAAACTGTGGATTGTCCATCAGAAGCTGTGAAGAATGGCAAGTGCAGGTCGAAACTATTCCGCCTCACCTGGTGCAGCAAGCTGTCGAAAAGTTATCCTGACCTGACGAAAATACGATGCTTCCGTTCCACCCAGGTACGTTGGAATGACTGCCCTGAAACCGCAATCTG
  5   1   2       bld Bone 5g                         IMAGE:8743699.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAGACTGTGGATGGCCCATCAGGAGCTGTGGAAAGATGCGAGGTGCAGTCAGAACATTATTCCCGCCTCCACTGGTGCAGCAAGCTGTCGAAAGTTATCCCTTGACTGAACGAAATACGATGCTCATTCCACCATGTCGTCTGATGGACTGCCCTCAACGGCAAGTCATGACTCAGGCCCATAGACCTGCATCAGCCATT
  5   1   2       bld Bone 5g3  in                    IMAGE:8739431.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACGGATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAGCACAGTACGATGAACTCAGCGCATAGACTGCATCGAGACAATGAGGAATCCTGGATACACAAGACAGTGGTCTCCACTGACTCATGGTGAACCTCATCGC
  5   1   2       bld Bone 5g                         IMAGE:8740826.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGATCTGACCTGCCGCCTGCAGAAGCGGCCAGTACGATGACATCAGCGCCATTAGACTGCATCAGAGGCCATGAGGCATCTGGGATACCACAAGAACAGCTGTCTCCACTGACTCATTGATGAACACTCACATCCGTA
  5   1   2       bld Bone 5g3  in                    IMAGE:8740472.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCGCCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACGAATGGCTTTCCGTGTCCCCACCCAAATGTGTCGTCTGGATCTGACTGCGCCTGCAAAGTGCAGTACATAGACTCAAGCCCCATAGACTGCATCAAGCCCATGAGATCTGATACAACAGACCGTGTTCCCATGACTCAGAACTGATCCTACTTGAGTCCAGTGCTCTGA
  5   1   2       bld Bone 5g                         IMAGE:8742011.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCACGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCGGCAGTACGATGACATCAAGCGCATTAGACTGCATCGAGCCCATGGATGCATCTTGGGATAACACACAAGACAGTTGTCTCCCACTGACTTTCCATGGGTGAACACTCCAA
  5   1   2       bld Bone 5g                         IMAGE:8741921.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCACGGAAGTTGTGGAGAGATGGCAGAGGTGCACGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCACCCCAAATGTGTCCGTCGTGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAGCGGCATTAGACTGCATCGAGCCCATGATGCATTCTTGGATACACACAAGACAGTTGTCTCCCACTGACTTCATGGTGAACACTTCAGTTCCTTCCT
  5   1   2       bld Bone 5g                         IMAGE:8742446.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACGGATGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCTGATCTGACTGCGCTGCAAAGCGCCAGTACGATGACTCAGCCGCATAGACTGCATCAAGGCCCAATGAGAATCTGGAACACAAGACCAGTTGTCTCCATTGACTCATGTGAACCTATCTCACTTAGGGTCCTAGTCTGGGTAATGTGTTCG
  5   1   2       bld Bone 5g                         IMAGE:8744136.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACCTGCCGCCTGCAGAGCGGCCAGTACGATGACATCAGCGTCATTAGACTGCATCAGAGGCCCATGATGGCATCTGGGAATACCACAGAACAGTTGTCTCCACTGACCTCAATGGGTGAACTCACTCC
  5   1   2       bld DMZ  5g3  in                         xl274p05.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCA
  5   1   2       bld DMZ  5g3  in                         xl283a14.5p                                                                                                 CAGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5047219.5p                                                                                                  GACTTCAGATGGGTCCCATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGGTCATGCTTTCACTGCCACCCAGAAGACTGTGGAT
  5   1   2       bld Ooc3 5g                         IMAGE:3472631.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCT
  5   1   2       bld Emb4 5g                         IMAGE:4930623.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGNAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAAGTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCCTTTCCGTGTCCCCACCCAAATGTGTCCCGTCGTGGATCTGACCTGCCCCCCTGCAGAAAGTGGCCCAGGTACGATGGACATCAAGGGCCGCCCATTAAGACTGCCATCAGAGGGGCCCCCATGGAAAGGGGAATCCCTGGGGATACCCCNCCAAGACCCCGGA
  5   1   2       bld Emb4 5g                         IMAGE:4682410.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGTTGTGGAGAGATGGCAGAAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAAATGGCTTTCCCGTGTCCCACCCCCAATGTGGTCCGGTCGTGGATCTGAACTGCCGCCTGCAGAAGCCGGNCCAAGTACGATGACATCCGGGNCCGNCCATTAGACTGCATCAGAGGGNCCCAATGAAGGGAATTCCTGGGGATACACACAAAGAACCAGGTTGGTCTCCACT
  5   1   2       bld Emb4 5g                         IMAGE:5570253.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGAACTGTGGATGGCCCATTAGGGAAAGTGTGGAGAAGATGGCAAAGGTGCCTGGTCAGAACATTAATTCCCGCCCTCCACTGGGTGCCACAAAGGGCTGGTCGGAAAAATTTATCCCTTGAGCTTGAACGGGAAAAATAAACCGGGAATGGGCTTTCCCGTGGTCCCCACCCCCAAAATGTGGTCCCGCTCGGGGGAATCTTGAACTTGGCCGCCCTGGCAAAAAACCGGGCCCAAGGTACCAATGGCACTTCAAAGGGCCGGCCCTTTTAAAAAATTGGCATCCCGAAAGGGGCCCCAATTGGAAA
  5   1   2       bld Emb4 5g                         IMAGE:4683659.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCCAATGTGTCCCGTCGTGGGATCTGACCTTGCCGGCCTGCAGAAAGCCGGGCCAAGGTACCGATGGACATCAAGGGCCCGCCCATTAAGAACCTGCATTCAGAGGGGCA
  5   1   2       bld Ov1  5g                         IMAGE:6317208.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGGATCTGACCTNGCCGCCTGCAGAAGCCGGCCAAGTACGATGNACATCAAGGGCCCGCCATTAAAGACTGC
  5   1   2       bld Ov1  5g                         IMAGE:6318792.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTANAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTATTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGGATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCCGGCCAAGTACGATGACATCAAGGCCCGCCATTAAGACTGCATCAGAAGGGCCCAATGGAAGGGAAATCCTGGGGATACACACCAANCACCAGGGTTGGTCTCCCCCTGGAACTTCCAATGGGGTGACT
  5   1   2       bld Brn1 5g                         IMAGE:6953791.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAAACGGAATGGCTTTCCGTGGTCCCCACCCCAAATGTGTCCCGTCGTGGGATCTGAAACTGGCCCGCCTGGCAAGAAGCCCGGCCCCAAGTTACGGATGAACATTCAAAGGGCCCGCCCATTTC
  5   1   2       bld Brn1 5g                         IMAGE:6953772.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGGAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCCAATGTGGTCCGTCGTGGAATCTGACCCTGGCCGCCTGCAGAAACCCGGCCCAAGTACCAATGGAAATCCAAGGGCCGGCCCTTTAAAAACCGCCATTCAAAGGGGGCCCCAATTGAAAGGGGAAATTCCTGGGGGAATTcccccccccAGGACACCACGGTTGTGTGCTCCCCT
  5   1   2       bld Brn1 5g                         IMAGE:6951849.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCCTGAGCTGAACGGAAAAAATAACCGGGAATGGCTTTCCCGTGGCCCCCACCCCCAAAATGTGGTCCGTTCGTGGGATCCTGACCTGGGCCGCCCGGCAAAAAACCCGGGGCCACAGGTACCAATTGGACCTTCCCAGGGCCCGCCCCCTTTAAGAAACCGGCCCTTTcaaaaagggggcccccaaagggaaaagggggg
  5   1   2       bld Eye1 5g3  in                    IMAGE:6949313.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGGACACTGTCCATGCTTTCACTGCCACCCAGAAAACTGTGGATGGCCCCAtcagggaaaactgtggaaaaaatgggcaaaaaggtgcagggtcaaaaaCATTTAATTCCCGCCCTCAAACTGGTGGCACCAAAAGGCTGGCCCgaaaaaaattttccccctgaaaccgaaaacgggaaaaaaTTAACCCGGGAAATGGGTTTTTCCCGTGG
  5   1   2       bld Eye1 5g                         IMAGE:6946219.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCNGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAAGGCCGCCCCATTAAGAACTGCATCAGAAGGGGCCCAAATGAT
  5   1   2       bld Sp1  5g                         IMAGE:5511650.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCTCTGAGCTGAACGGAAAATAACGGAATGGCTTTCGTGTCCCACCCCAATGTGTCGTCGTGATCTGACCTGCGCTGCAA
  5   1   2       bld Te2  5g                         IMAGE:7211441.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACCGGAATGGCTTTCCGTGTCCCACCCCAAATGTGTCCCGTCGTGGATCTTGACTGCCGCCTGCAGAAGCCGGGCAAGTACGATGACATCAGGCCCGCATTAAGCTGCATCGAAGGGCCCATGAAGGGATCCCTGGAATACCAAAAACCAGGTGTCTCCCCGGACTCCAAGGGGGAC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075535.5p                                                                                                  CAGACTTAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAGTATCCTGAGCTGACGGAAAATACNGAAATGCTTCGTGTCCCACCCAATGGTCGTCTGATCGACTGCGCTGC
  5   1   2       bld Lmb1 5g                         IMAGE:8534405.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACGGAATGGCTTTCGTGTCCCCACCCAA
  5   1   2       bld Lmb1 5g                         IMAGE:8534130.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGGGCTTCGTGTCCCACCCCAATGTGTCCGTCGTGGATCTA
  5   1   2       bld Lmb2 5g3  in                    IMAGE:8635901.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTATCCCTGAGCTGACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGATCTGACCTGCCGCCTGCAGAGCCGGCCAGTACGATGACTCAGCCGCCATTAGACTGCATCAGAGGCCAATGAGGGATCCTGGGA
  5   1   2       bld Bone 5g3  in                    IMAGE:8739407.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAGCTGTCGGAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAGCACAGTACGATGACTCAGCGCATAGACTGCATCGACGTCATGAGGATCTGGGATCCACAGACAGGTTGTCTCCACTGACTCAATGATGAAACCTCATCCTTCCCAT
  5   1   2       bld Bone 5g                         IMAGE:8742520.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCCGCCCTCACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACCGGAAAAATAACCGGATGCTTTCCTGTCCCCACCCAAATGGTGTCCGTCTGATCTGACTGCCGCCTGCAAGCCGCCAGTACATGACTCAGCCGCCATTAGACTGCATCAGCCCATGGAGCATCTGGATACACCAAGACCAGTGTCTCATGACTCAGTGACTATCTGCCAATCTAAGGAAGCCCGGAT
  5   1   2       bld Bone 5g                         IMAGE:8742081.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCGTCGTGATCTGACTGCCGCCTGCAGAAGCGGCAGTACGATGACATCAAGCGCATAGACTGCATCGACGCCCATGAATGCATCTTGGAATACACACAGAACAAGTTGTCTCCCACTGAACTTTCCATGGTGGAACACCTTCAGC
  5   1   2       bld Bone 5g                         IMAGE:8743709.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGTGCAGCAAGCTGTCGAAAGTATCCCTGGCTGACGAATACGATGCTTCGTGTCCCCACCCATGTGTCGTCTGAATCTGACTGGCGCCCTGCAGCGCAGTACAATGACTCAGCCGCATAGACTGCATCAGCTCAATGAAGGAATCTGGCATC
  5   1   2       bld Bone 5g                         IMAGE:8742849.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAAGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAGACTGTGATGCCCATCAGAGCTGTGGAGAGATGCAGAGTGCAGTCAGACATTATCCCGCCTCACCTGTGCAGCAAGCTGTCGAAAGTTATCCTGACTGACGGAAAATACGGATGCTTCAGTCCCACCCATTGTTCGTCTGAATCGACTGCCCCCTGCAGCGCAGTCATGACTCAGCCCATGACTGCATCAAGGCCCATGAGGAATCTGGGATAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739220.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCGTGTCCCACCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCAAAAGCGCAAGTACGATGACTCAGCGGCATAGACTGCATCGAGGCGATGACGGAATCCTGGATACAACAGACCAGGATGTCTCCACTGACTTCATGTGAACCCTCACTCCTTCCATCT
  5   1   2       bld Bone 5g3  in                    IMAGE:8740702.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAGCCGGCCAGTACGATGACATCAGCGCATTAGACTGCATCAGAGGCCATGATGCATCTTGGATACACACAGACAGTTGTTCCTCCACTGACTTTCAATGGGTGAACACTTCAACTTC
  5   1   2       bld Bone 5g                         IMAGE:8743672.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAACGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATACGGATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACTGCGCTGCGAAGCAGCAGTACGATGACTCAGGCGCAATAGACTGCATCGAGGCCCATGATGCATTCTGGAACCACACAAGAACAGCTGC
  5   1   2       bld Bone 5g                         IMAGE:8741501.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTATCCCTGAGCTGAACGAAAAATAACGAATGCTTTCCGTGTCCCCACCCAAATGGTGTCCGTCTTGATCTGACTGCGCTGCTAGCGCAGTACAATGACTTCAGGCGCATAGACTGCATCGAGCCCATGAGGATCTGGGATCCCA
  5   1   2       bld Bone 5g                         IMAGE:8742758.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAAGATGGCAGAGTGCTGTCAGACATTATTCCCGCCTCACTGGTGCAGCAAGCTTTCGAAAGTTATTCCTGACTGACGAAATACGATGCTTTCGTGTTCCCACCCATGTGTCGTCTGATCTGACTGCCCCTGCAGCGGCAGTCAATGACTCAGCGCATAGACTGCATCAAGCCCATGAGATCCTGGTTAC
  5   1   2       bld Bone 5g                         IMAGE:8741383.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCACGGAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCCAAATGTGTCGTCGTGATCTGACTGCCGCTGCAAAAGCTGCAGTACGATGACTCAGCGGCATAGACTGCATCGAAGGGCCCAATGAAGGAATCTTGGGAATACCCCCAGAAAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740191.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACCTGCCACCCAGAAGACTGTGATGCCCATCAGGAAGTGTGGAGAAAATGGCAGAGTGCAGTCAGACATATCCCGCCCTCAACTGGTGCAGCAAGCTTGTCGAAAGGTTATCCTGACTGACGAAAATAACGATGCTCATTCCCACCAATGGTCGTCTGACTGACTGCCCTGCATCGCAGTCATGACTCAGGCCATAGACTGCACTCAAGCCATAGGATCTGGTTAC
  5   1   2       bld Ga18 5g3  in                       xlk55i15ex.5p                                                                                                  AGACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGNCTCTCTGCACTTGAAGGGAGGNGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGNCCATCAGGGAANGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTNGNGCAGCAAAGNNTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACNGGAATGGCTTTCCGTGTCCNCACCCCAAATGTGT
  5   1   2       bld Neu4      in                    IMAGE:4084255.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTC
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200177.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAAAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTGCCGGCTCAACTGGTGCAAGCAAGGCTGGCCGGAAAGTTATGCCTGAGCTGAAACGGAAAATGACCCGAAATGGCTTC
  5   1   2       bld Tbd1 5g3  in                     Tbd1-da96d05.y1                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTTGTCTGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACCACTGTC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959199.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959826.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGA
  5   1   2       bld Emb4 5g                         IMAGE:5572559.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGGTCCGTTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAAGCCGCCATTAAGACTGCATCAGAGGGCCCAATGGAAGGGAATCCTGGGATACACCCAAGAACAGGTTTGTCTCCC
  5   1   2       bld Emb4 5g                         IMAGE:4683539.5p                                                                                                   GGACGCGTGGGCGGACGAATACCAGGTCAANTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGATAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGGCATCAACGACAACTTTGGCATTGTTGAGGCACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATTAGGGGAAATTGGGGAAACATGGCCACAGGTGGCTGGGTCAGAACAGTTATTCCCGGCCTCAAATTGGGGGCAGCCAATAGGCTGTCCGGAAAAAACTTATCCCCTGGAGCCTGAAACGGAAACAAATAAACCCGGCAAAGGGCCTCTTCCCGTGGTTGcccccccccccAAAATGGTTTCCCCGTTCCCCGGGAACTTTTGAAACCTGTCCCGCCCTTTGGCAGAACAACCCTCGTCCCACCACGCACCGTAACTGGAACAATCCCAGAGGCGCGCCCGCCCAACTTTACAAAAACGCTGGCCTTCTCGCAAAAACGGGGCGCCTGCACCATTCTGAGACGG
  5   1   2       bld Emb4 5g                         IMAGE:5571163.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCCGGAAAAGTTATCCCTGAGCTGAAACGGAAAAATAACCGGGAATGGCTTTCCGTGTCCCCCACCCCAAATGGTGGCCCGTCGTGGGAATCTGAACCTGGCCCCCCTGGCAAAAAGCCCGGCCCAAGTACGAATGGACCTTCAGGGCCCGGCATTTAAGAACTTGCCTTCAGAAGGGCCCCCAATGGAAGGGGAAATCCCGGGGAATCCCCCCCAAGAACCCGGGT
  5   1   2       bld Bone 5g                         IMAGE:8742463.5p                                                                                                   GACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCGCCTCACTGGTGCAGCAAAGCTGTCGGAAAAGTATCCCTGAGCTGACGGAAAAATAACGATGGCTTTCGTGTCCCCACCCAAATGGTGTCGTCTGATCTGACTGCCGCTGCAAGCGTCAGTACAATGACTCAGCGCATAAGACTGCATCAGGTATGAGAATCTGATACACAAGACAGGTTGTCTCCCTGACCTCATGTGGTGAAC
  5   1   2       bld He1  5g3  in                    IMAGE:4407693.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTTTGACTCCACCCACCGGCCGCTTTAAGGGAACCGTTAAGGCT
  5   1   2       bld Emb4 5g3  in                    IMAGE:4201878.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTTGCGTGAACCATGAGAAATATGAGAATTCT
  5   1   2       bld He1  5g                         IMAGE:4406955.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTNCATGCTATCACTGCCACCCCAGAGACTGTGGATGGG
  5   1   2       bld He1  5g3  in                    IMAGE:4406990.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTGTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATGCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGATGGACTCATGACAACTGTCCATGCATTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAACTGTGG
  5   1   2       bld He1  5g3  in                    IMAGE:4407030.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCTCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGGTCATCAANCGACACTTTGGCATTGTTG
  5   1   2       bld Ooc1 5g3  in                     Ooc1-db26c06.y1                                                                                                    CGCGTCCGGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGCAAG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959509.5p                                                                                                    ACTTTTTAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGNTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCA
  5   1   2       bld Brn1 5g3  in                    IMAGE:6950198.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGGAATGGCTTTCCCTTGTCCCCACCCCCAAATGTGTCCCGTCGTGGGATCTGGACCTGCCCGCCCGGCAGAAACCCGGCCCAAGTACCAATTGACATCAAGGGCCGCCATTTAAGACTTGCATCAGAAGGGGCCCAATGGAAGGGGGAATCCCGGGGGGAAACACCCACCAAGACCCCGGGTTTTTCTCCCACCTGAAACTTTCAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203327.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAAAGCC
  5   1   2       bld Te2  5g                         IMAGE:7394259.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAGGCTGTCGGAAAAGTATCCCTGAGCTGACGGAAAAATAACGGAATGGCTTTCGTGTCCCACCCAATGTGTCGTCGTGGACTGACTGCCGCTGCAGAGCCNGCAGTACATGACTCAGCGCATAGACGCTCGAGGCCATGAGGATCTGGACCCA
  5   1   2       bld Te2N 5g                         IMAGE:7766015.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAGTTATCCCTGAGCTGAACGGAAAATAACGGAA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532344.5p                                                                                                    GACTTCGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACTTATTCCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAGTATCCCTGACTGAACGAAAATACGGATGGCTTCGGTCCACCNAATGTTCGTCTGATTACTGCGCTGAAACCGCATACATATCAGCGCATAACGTCGAGCATGAGACTGACACAACGTGCCCGATAGGACCCCCTACACGTCGAGATGAGTCGAAGAACTGTGAT
  5   1   2       add Bone 5g                         IMAGE:8741768.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAAGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACCTGCCACCCAGAAGACTGTGGATGCCCATCAGGAGCTGTTGGAGAGATTGCAGAAGTGCAAGTCAGACATTATTCCCGCCTCCACCTGTGCAGCAAGCTGTTCGAAAAGTTATTCCCTGACTGACCGAAAATAACGGATGCTTCTGTTCCCACCCATTGTTCGTCTGGAATCGACTGCCCTGCAGCCGCAGTACATGACTCAGCGCATAGACTGCATCGAGCCATGATTATCCTGTATCA
  5   1   2       bld Ga18 5g3  in                       xlk51m12ex.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGNGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTNNAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAANNNTGTCGGAAAAGNTATCCCTGAGCTGAACGGAAAAATAACCNGGAANGGCTTTCCNTGTCCCCACCCCAAANGTG
  5   1   2       bld Ga18 5g3  in                      xlk129g23ex.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGNGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGNTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCA
  5   1   2       bld Ga18 5g3  in                      xlk134i15ex.5p                                                                                                    ACTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGANTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGNCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGNNCAGGTCAGAACATTATNNCCGCCTCAACTGGTGCAGCAAAGNNTGTCGGAAAAGNTATCCCTNAGCTGAACGGAAAAATAACCGGNATGGCTTTCCGTGTCCCCNCCCCAAANGT
  5   1   2       bld Ga18 5g                            xlk60c23ex.5p                                                                                                    ACTTCAGAGGGGNTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAANGCTGTGGAGAGATGNCAGAGGTNCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGNNTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAANGTNT
  5   1   2       bld Brn1 5g                         IMAGE:7019082.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCNGTCGTGGATCTGAACTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAAGGCCGCCATTTAAGACTGCATCAGAAGGCCCCCAATGAGGGGAATTCTTGGGGATACACA
  5   1   0       chi Ov1                             IMAGE:8331238.5p                                                                                                     CAGCAGAGGGGTTGATAAACCAAATCTCGTGTCTCCACAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAAAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAAGGAGGTGCCAAGCGTGTCGTTATCTCAGCCCCCTCAGCAAATGCCCCAATGTTAGTAATAGGCGTGAACCATGAGAAATATGAGAACTCTCGTAAAAGTTATTAGCAATGCATCCTGAAATACAAACTGTCTGGATCCTCTAACAAAAGTCATCAAAGACTAATATTGACATTGTTGAAAGACTCAGGACATCAGTCCATGCTTTCAAAGCCACCCaaaaaaaaGTTGAATGCCCATCAAGAATTATTTGGAAAGAAAGCTAAGGTACTGGTAAAATCAATGTTCCCGCATTACTGGTGACATAAAAGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328147.5p                                                                                                     CTTCAGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCA
  5   1   2       add Bone 5g3  in                    IMAGE:8739647.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGGTCATCAACGACAACTTTGGCATTGTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCAGAAGAACTGTGGATGGCCATCAGGAAGTTGTGGAAAGAATGGCAAGGTGCAGTCGAACTTATTCCGCCTCACTGGTGCAGCAAGGCGTGTCGAAAGTATTCCTGAGCTGACGGAAATAACGATGCTTTCCGGTCCACCAATGTCCGTGATGACTGCCCTGGAACGCAGTCGT
  5   1   2       bld Bone 5g3  in                    IMAGE:8739648.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCACTGTGCAGCAAGCTGTCGAAAGTTATTCCCTGACTGACGAAATAACGATGCTTCGTTCCCACCATTGTCGTCTGGACTGACTGCCTGCAGTGTCAGTCATGACTCAAGGTCCATAAAACTGCTCTCAAGG
  5   1   2       bld Bone 5g                         IMAGE:8742831.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGCCCATCAGGAGTGTGGAGAGATGGCAGAGTGCTGTCAGACATATCCGCCTCACTGTGCAGCAGCTGTCGAAAGTTATCCTGGGCTGACGAAAATACCGGATTGCCTCCTGTCCCACCAATGTCGTCTGGATCGACTGGCCTGCACGGCAGTCATGACTAGGTCCATAAACGATCAGGCCATGAGAATTCTGGGATTACC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740876.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAAGCACCAAGTACGATGACATCAGCGCATAGACTGCATCGAGACATGAGGATCTGGATCACCAAGAACAGTTGTCTCCACTGACCTCAATGGTGAAACAGTCATTCTTCA
  5   1   2       bld Bone 5g                         IMAGE:8741910.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACTGCCGCCTGCAGAAGCCGGCCAGTACGATGACATCAAGGCGCATTAGACTGCATCGACGCCCAATGATGCATTCTGGAATACCACAGACAAGGTTGTCTTCCCACTGAACTTCAATGGGTGAACTTACT
  5   1   2       bld Bone 5g                         IMAGE:8742994.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGAT
  5   1   2       bld Bone 5g                         IMAGE:8743534.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCACGTCAGATCATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGAAAAATAACCGGATGCTTTCGTGTCCCCACCCCAAATGTGTCGTCGTGATCTGACTGCGGCTGCAGAGCGCAGTACGATGACTCAAGGCGCATAGACTGCATCGAGTATGAGCATCTGGATCCACAGACAGTGTCTCCCTA
  5   1   2       bld Bone 5g                         IMAGE:8743224.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGCCTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCCTTTCCGTGTTCTCAAC
  5   1   2       bld Bone 5g                         IMAGE:8742775.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCACTGGTGCAGCAAGCTGTCGAAAGTTATCCCTGACTGACGAAAATACGATGCTTCTGTTCCCACCCATGTGTCGTCTGATTGACTGCCCCTGCAGTCGCAGTCAATGACTCAGGCGCATAGAACTGCTCGAAGGTCATGAAGGAATCCTGGATCACCAGGACG
  5   1   2       bld DMZ  5g3  in                         xl310i19.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCT
  5   1   2       bld DMZ  5g3  in                         xl309i19.5p                                                                                                     CTTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGA
  5   1   2       bld Tbd1 5g3  in                     Tbd1-da88e06.y1                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAATGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCTCTCAGCAGATGCCCGCATGTNTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATGCTGCACTACAAACTGTCTGGCTCCTCTCGCAGATGTCATCAACGACAACATTGGCATTGTTGAGGGACTCATGACAACTGTTCATGCTTGTACTGCCACCCAGATGACTGTGGATGGCCCATCATGGAAGCTG
  5   1   2       chi Tbd3                            IMAGE:3549861.5p                                                                                                      ACCTTCANAGGGTTGATAAACCAATTAAGTGACTACAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGTAAGTGAGGTTATGGGCATCTCTAGAATAATCACATGGGGAGTCGGTGGGTTCTCCTGCTTATGAATGCTGTTGTGTAACTATGTCCACTCTGCCCAGGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTA
  5   1   2       bld Oo1  5g                         IMAGE:6642992.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGAATCTGACCTGCCGCCTGCAGAAAGCCGGGCCAGTACGATGACATCAAGGCCGCCCATTAAGACTGCATCAGAGGGCCCCAATGAAGGGGAATCCTGNGGATACACACCAGGACCAGGTTGGTCTC
  5   1   2       bld Eye1 5g                         IMAGE:6945336.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAACCGGCCAAGTACGATGACATCAAGGCCCGCCATTTAAGACTGCATCAGAAGGCCCCAATGAAGGG
  5   1   2       add Brn1 5g                         IMAGE:6952104.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTTGCCACCCCAGAAAAACTGTGGATGGCCCCTCAAGGAAGCTGTTGAAAAGATAGGCAAATGTGGCAGGTCCCAAACATTATTTccccccccAACCTGGTGGCAACAAAGGCCGGTCCGAAAAAATTTATCCCTTGAGCTGAAAACGGAAAAATAAACCGGAAATGGCTTTTCCTTGGTCCCCCACCCCCAAATTGTGTTCCCCTCCGGGGAATCATTAACATTGTCGCCTTGGAGAAAAATCGGGCCACAGTTACTGAAGGTACATCCAAGGCGCCCCCCTTTAAAAAACTGGCGTTCCAAAAGAGGCCCCACTTGGAAGGTGAATACCCTCGTGAGATAAACACA
  5   1   2       bld Brn1 5g                         IMAGE:6955369.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGGATCTGACCTGCCGCCTGCAGAAGCCCGCCAAGTACGATGACATCAAGGGCCGCCATT
  5   1   2       bld Emb4 5g                IMAGE:4957764-IMAGp.IMAGp                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGCTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATT
  5   1   2       bld FaB  5g                         IMAGE:8072830.5p                                                                                                      CTTCAGAGGGGTTGATAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCATGGAAGTTGTGGAGAGATGGCAAAGGTGCTGGTCAGAACATTAATCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAA
  5   1   2       bld Tail 5g3  in                    IMAGE:8541636.5p                                                                                                      CTTCGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACAGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739493.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGGATGGCTTTCGTGTCCCACCCAATGTGTCCGTCGTGATCTGACTGCGCTGCAGAGCGCAGTACGATGAACTCAGCGCATAGACTGCATCGAGGTCATGAAGCATCCTGGATACACAAGACAGGTGTCTCACTGACTTCCATGTGACCCTCACTTCCTCCATCATGA
  5   1   2       bld Bone 5g                         IMAGE:8743687.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTTACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAAGTATCCCTGAGCTGAACGAAAAATAACCGATGCTTTCGTGTCCCACCCCAATGTGTCGTCTGGATCTGACTGCGCTGCGAGCGCAGTACGATGACTCAAGCGCATTAGACTGCATCGAGTCAATGAAGAATCTGGGATACACACAGACAGGCGTCTCA
  5   1   2       bld Bone 5g                         IMAGE:8742186.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCCGGAATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCGTGATCTGACCTGCGCTGCAGAGCCGGCCAGTACGATGACATCAGCGCATAGACTGCATCAGAGACGATGAGAATCTGGGATACACACAGACAGTGGTCTCCACTGACTCATGGGTGAAACTCCAGTTCGTCAATCTG
  5   1   2       bld Ga18 5g3  in                       xlk52a05ex.5p                                                                                                      TTCAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGNCCATCAGGGAANGCTGTGGAGAGATGGCAGAGNNNCAGGTCAGAACATTATTCCCGCCTCAACTNGNGCAGCAAANNNTGTCGGAAAAGTTATNCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTNTCCCCACCCCAAANGTG
  5   1   2       bld Ov1  5g                         IMAGE:5073463.5p                                                                                                       CCACGCGTCCGGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAA
  5   1   2       bld Bone 5g                         IMAGE:8742883.5p                                                                                                        CAGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAAAGAATGGCAGAGTGCTGTCAGACATTATTCCCGCCTCCACTGGTGCAGCCAAGCTGTCGAAAGTTATCCCTGACTGACGAAAATACGATTGCTCCTGTTCCCACCCAATTGTCGTCTGATCGGACTGCCCTGCAACGCAGTCATGAACTCAAGCCATAGACTGCATCAAGGCATGAGATTCTTGGAC
  5   1   2       bld Ov1  5g                         IMAGE:6316492.5p                                                                                                         AGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGGCCGTGGATCTGACCGGCCGCCTGCAAAAACCGGGCCAGTACGAAGACATCCAGGCCGCCCTTAAGACTGCATCCAAGGGCCCAAGGAAGGGAATCCTGGGGATACA
  5   1   2       bld Te2  5g                         IMAGE:7209337.5p                                                                                                         AGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCACGTCAGAACATTATTCCCCGCCTCACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGA
  5   1   2       bld Lmb1 5g                         IMAGE:8534369.5p                                                                                                         CGAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGGCTTCGTGTCCCACCCCAATGTGTCGTCGTGGATCTGACTGCGCTGCAGAGCCGGCAG
  5   1   2       bld Tail 5g                         IMAGE:8542851.5p                                                                                                         CGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCC
  5   1   2       bld Bone 5g                         IMAGE:8743526.5p                                                                                                         AGAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGAAAGTATCCCTGAGCTGAACGGAAAAATACCGGATGGCTTTCGTGTCCCCACCCCAAATGTTGTCGTCTGGATCTGACTGCGCTGCAGAGCAGCAAGTACAATGACTCAAGGCGCATAGACTGCATCGAGTCATGGATGCATCTGGGAACACACAGACAGCTGTCTCCCTGACTCA
  5   1   2       bld Emb4 5g                         IMAGE:4680520.5p                                                                                                          GAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTANCAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACCACTGTCCATGCTTTCACTGCCACCCCAGAAGACTGTGGATGGCCCATCANGGAAGTTGGTGGAGAAATGGCAAAAGTGGCTGGTCAGAACATTATT
  5   1   2       bld Emb3 5g                         IMAGE:3400911.5p                                                                                                          GAGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTACAGGAGCGTGACCCCTTCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGATATCTTGCGCCCCTCAGCAGATGCTCTCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGATGATAGCAATGCATTCTGTACTACAGACTGACTTGGTCCTCTCGCAGAGGTCATCAACGACATCTTATGCATACGTGAGGGACTCATGACTACTGTCTCTGCTTTC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4958862.5p                                                                                                          GAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTA
  5   1   2       bld Emb4 5g                         IMAGE:5542191.5p                                                                                                          GAGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCANGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGGTCCGCCGTGGATCTGAACCTGCCGCCTGCAAAAGCCGGGCCCAAGTCCGATGACATCCAAGGCCGCCATTTAGGACTGCACTTCCAAGGGGCCCCAATGAACGGGGAATTCCTGGGAATACCCCCCTAAAAACCCAGGCGTGTCCCTCCCACCTGCACT
  5   1   2       bld Tbd2 5x3  out                   IMAGE:3200386.5p                                                                                                           AGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTNTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTNTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAATGCTGTCCGAAAAGTA
  5   1   2       bld Gas8 5g3  in                    IMAGE:3518053.5p                                                                                                           AGGGGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGTGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGCCCATCANGGAAGTGTGGAGAGATGGCAG
  5   1   2       bld Tad1 5g3  in                    IMAGE:6877573.5p                                                                                                           GGGGGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAAGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAAACGAAAAATAACCGGAATGGCTTTTCGTGTCCCCACCCCAAATGTGTCCGTCGTGGGATCTGAACCG
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3550100.5p                                                                                                              CAGAGGGTTGTAAACAAACAGTGACTACAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8329111.5p                                                                                                              GGTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGA
  5   1   2       bld Tail 5g                         IMAGE:8544353.5p                                                                                                              GGTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAGGCTGTCGGAAAAGTTATCCTGAGCTGACGGAAAATAACGGAATGGCTTCGTGTCCCACCCAATGTGTCGTCGTGATCTGACTGCGCTGCAAAGCGGCAGTACATGACTCAGCGCATAGACGCTAGAGCCATGAGGATCTGGACAACAACAGTGCC
  5   1   2       bld Emb4 5g                IMAGE:4681270-IMAGp.IMAGp                                                                                                               GTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCCGGCCAAGTACGATG
  5   1   2       bld Ov1  5g                         IMAGE:8329841.5p                                                                                                               GTTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTTATCCTGAGCTGAACGGAAAAATAACCGGA
  5   1   2       bld Skin 5g                         IMAGE:8643665.5p                                                                                                               GTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACTTATTCCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAGTTATCCCTGACTGACGGAAAATAACGGAATGCTTTCGTGTCCACCCAATGGTCGTCGTGATCGACTGCGCTGCAAGCCGCAGTACATACTCAGCGCATAGACGTCGAGGCATGAGGATCGGACACAACAGTGCCCGATCAGGACCTCCACTAGCACGATCGAG
  5   1   2       bld Bone 5g                         IMAGE:8741091.5p                                                                                                               GTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCACGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTATCCCTGAGCTGAACGAAAATACCGGATGGCTTTCCGTGTCCCCACCCCAAATGTGTCGTCATGATCTGACTGCGCTGCAGAGCATCAGTACGATGACTCAGCGCATAGACTGCATCGAGTCAATGAGGGATCTGGGTTCACAGACCCG
  5   1   2       bld Bone 5g3  in                    IMAGE:8740431.5p                                                                                                               GTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAAGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGAACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGGAGATTGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGTGCAGCAAGCTTGTCCGAAAGTTATCCCTGAGCCTGAACGGAAAAATAACCGAATGCTTTCTGTCCCACCCAAAATGTGTCGTCTGATCTGACTGCGCCTGCAGCTGCCAATACATGAACTCAGCTCATAGACTGTATCAAGTCATGAGAATCTGGGTACCATGAAGTTGTTCCCGGACTCAATGA
  5   1   2       add Bone 5g                         IMAGE:8741740.5p                                                                                                               GTTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAACGCCTCTCTGCACTTGAAGGGAGGTGCCCAAGCGTGTCGTATCTCCGCCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAACTGTCTGGCTCTCTCGCAAAGGTCATCACGACACTTGGCATTGTTGAGGGACTCATGACACTGTCATGCTTCACTGCCACCCAGAAGACTGTGGATGGCCATCAGGAGCTGTGGGAGAGATGGCAAGGTGCAGTCCGACATTATTCCGCCTCACTGGGTGGCAGCAGGCTGTCCGAAAGGTATCCCTGACCTGAACGGAAATAACGGATGGCTTTCTGTCCACCATGGTTGCTGAATTGACTGGCTCGTAACGCAGTCATAACTCAGGGCGCCTTAAACTGGC
  5   1   2       bld Lu1  5g3  in                    IMAGE:4058374.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTTTCTGCACTTTAAGGGAAGTGCCCACCCTGTT
  5   1   2       chi Brn1      in                    IMAGE:4740741.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCTTCCAACATTAAGTGGGGAGATTCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTTACAACCACAGAGAAGGCCTCTCTTCACTTGAAGGCAGGTGCCAAGCCTGTCTATATCTTCTCCCCCTCTACACATGCCCCCATGTTGCATCTTTCTTCACTATGATAATATGAGAATTCTTTTAAATCTGCTACCTTTCATCCTGTCCTTCATCTTGTTCGTTTTTCTTCTAAAGTTCATTCCCCACACCTTTTGCCTTGTTTAAAGAAACACTA
  5   1   2       bld Emb4 5g                         IMAGE:5537245.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCNGCCTCACTGGTGCAGCANAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCCAAATGTGGTCCGTTCGTGGAATCTGACCTGCCCGCCCTGCCAGANGNCCGGCCCAAGTTACGAATGGACATCCAAGGCCCCGCCCCATTAAGAAACTGCCAATCCAGAAGGGCCCCCAATTGGAAGGGGAAATTCCGTGGGGAATAACACCACAAAGAAACCCAGGGGTTGGTCCTCCCCACCTGGGACCTTTCCAAAgggggggggAAAACTTTCAACTTTCTCTTTCCCAATTTCTTTTTTAAAATTGCCCCTGCATAGGGCCTTGGGGAAAATAATTGGC
  5   1   2       bld Emb4 5g                         IMAGE:5569943.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTTGAGGACTCATGGACACTGGCCATGGCTTTCACTGCCACCCAGAGAAACTGTGGATGGCCCATCAGGGGAAAGTTTGGGGAAAAAAATGGCAAAGGTGGCTGGTCCAAAACATTTATTTCCCGCCCTCAATGGGGGCAACCAAAGGGCTGTCCGGAAAAAGTTATCCCCTGAACTTAAACGaaaaaaaaaaccccgaaaggggtttttccgtgggtcccccccccccaaattgggccccccccccGGGAATTTGAAACGTGGCCGCCCTGGCAAAAACCGGCCCCCCAGTTCCCGTGGGCCCCCCGGGGGCC
  5   1   2       bld Te2  5g                         IMAGE:7210062.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCTACTGGTGCAGCAAGGCTGTCGGAAANTTATCCCTGAGCTGACGGAGAAATACGGAATGGCTTCGTGTCCCACCCAATGTGTCGTCGTGACTGACTGCGCTGCAAAGCCGCAGTCGATGACTCAGCGCATAGACGCTCAGAGCCATGAGGATCTGGATCACAACAGTGCCC
  5   1   2       bld Te2N 5g                         IMAGE:7764638.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCG
  5   1   2       add Bone 5g3  in                    IMAGE:8740354.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAGGACTGTGATGGCCCATCAGGAAGCTGTGGAAAGATGGCAGAGTGCAAGTCAGACATTATTCCCGCCTCACTGTGCAGCAAGCTTGTCGAAAAGTTATCCCTGGGCTGAACGGAAAATAACCGAATGCTTCGTGTCCCACCCCAATGTGTCGTCTGAATCTGACTGCGCTGCAAGCCGCCAATACAATGACTCAGGCGCCATTAGACTCGACAGGCCATGACGATCTGGTTACACAGAACGGTGTGTCCATGACATCTATGGTGACATACT
  5   1   2       bld Bone 5g                         IMAGE:8741101.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCGTGGATCTGACTGCGCTGCAGAAGCAGCAGTACGATGACATCAGCGCATAGACTGCATCAGAGGGCCCATGAAGGGAATCTGGGAAAACAACAACAAGAAACAGGGTGG
  5   1   2       bld Bone 5g                         IMAGE:8743975.5p                                                                                                                TTGATAAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCACGCAAGCTGTGGACAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAGTACGATGACATCAGCGCATTAGACTGCATCAGAGGGCCAATGATGCTTCTGGGATACACACAAGACAAGTTGTCTCACTGACTCAATGGGGTGACACCTCCACTCCTTCCAATCTTTTTGAATG
  5   1   2       bld Bone 5g                         IMAGE:8742949.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGAAGTTGTGGAGAGATGGCAGAGTGCTGTCAGACATTATTCCCGCCTCAACTGTTGCAGCAAGCTGTCGAAAGTTATTCCTGAGCTGACGAAAAATTACCGGATGCTTTCTGTCCCACCCCAAATGTGTCGTCTGAATCTGACCTGCGCCTGCAGTCGCAGATCATGACTCAGTCGCATAGACTGCCTCGAAGGTCATGAAGGGATCTGGATATCAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740356.5p                                                                                                                TTGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAGCTGTGAGAGATGGCAGAGTGCAGTCAGACATTATCCCGCCTCACTGGTGCAGCAAGCTGTCGAAAGTATCCCTGAGCTGACGAAAATACGATGCTTTCGTGTCCCACCCAATGTGTCGTCTGATCTGACTGCGCTGCAGCGCAGTACATGACTCAGCGCATAGACTGCATCGAGGCATGAGATCTGGATACATGACGTGTCCCATGACTCATGTGAACTCATCTCAATTTTATGC
  5   1   2       bld Brn1 5g                         IMAGE:7018519.5p                                                                                                                 TGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAACCGGCCAAGTACGATGACATCAAGGCCCGCCATTAAGACTGCATCAGAGGGCCCAAATGAAGGGGATCCCTGGGATACACACCAGGACC
  5   1   2       bld Bone 5g                         IMAGE:8743059.5p                                                                                                                 TGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCCTCCAGCAGATGCCCCCATGTTTGTAGTTGGCCTGAACCATGAGAAATATGAGAACTCTCCTAAGGTGTGTAGCCATGCATCCTGCACTTACCAAACTGTGCTTGCTCCTCTCTGCAAGGTCATCCAACGACAACACTTGGCATGGTGAAGGACATCCATGACAAACCTGTTCATGGCTTTCACTTGCCACCAAAGACACTGTTGGAATGGCCATCCAGGGAAGTGTGGGAAGATTGCCAAGTGCTGGTCCGAAACTAATTCCCGCCTCACCTGGTGCGACCAGCTGTCCGAAAAAGTTATCCCTGGCTGACCGAAAAATACCGAATGGCTTCCTGTCCCACCAAATTGTCCGTCTGGATCTGACTG
  5   1   2       bld Bone 5g3  in                    IMAGE:8740160.5p                                                                                                                 TGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCCATGACCAACTGGT
  5   1   2       bld Bone 5g                         IMAGE:8742751.5p                                                                                                                 TGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAGACTGTGGATGGCCCATCAGGAGCTGTGGAGAGATGGCAGAGTGCAGTCAGACATTATTCCCGCCTCACTGTGCAGCAAAGCTGTTCGAAGTATCCTGAGCTGACGAAAATACGATGCCTTCTGTTCCCACCCATTTGTTCGTCTGATTCTGACTGCGCTGCAGCGCAGTACATGACCTCAGCCCATAGACTGCATAAGTCATGAGGAATCTTGAATCCCCAGAACGTTGTTTC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740852.5p                                                                                                                 TGATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAAATGTGTCCGTCGTGGATCTGACCTGCGCTGCAGAAGCGCAAGTACGATGACATCAAGCGCATAGACTGCATCAGAGGCCCAATGAAGATCCTGGATACCACAGACAGTGGTCTCCACTGACTTCATGGTGAACCTTCACTCCTTCATCTTTGAATGCTTGAATG
  5   1   2       bld Brn3 5g                         IMAGE:8539980.5p                                                                                                                  TGATAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACCGGAATGGCTTCCGTGTCCCCACCCAATGTGTCGTCGTGGACTGCCCTGCGCTGCAGAGCCGGCAGTAGA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532367.5p                                                                                                                  TGATAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAAATTATTCCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAGTATCCCTGACTGAACGAAAATACGGATGGCTTCGTGTCCACCCAATGGTCGTCTGATTGACTGCGCTGCAAGCGCATACATATCAGCGCATAACGCTAAAGCATGAGGACTGGACACAACAGTGCCCGATCAGGACCACCACTAGCACGATCGA
  5   1   2       bld Tail 5g3  in                    IMAGE:8543119.5p                                                                                                                  TGATAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCNAGGCTGTCGGAAAAGTATCCCTGAGCTGAACGGAAATAACCGGATGGGCTTCGTGTCCCACCCAATGTGTCGTCGTGGACTGAACTGCGCTGCAGAGCCGGCAGTCGATGACTCAGCGCCATAGACGCTCGAAGCCATGAGGATCTGGAAACACAACAGTGT
  5   1   2       bld Thy  5g                         IMAGE:8551028.5p                                                                                                                  GATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCANGTCAGAACATTATTCCGCCTCACTGGTGCAGCAAGGCTGTCGGAAAAGTATCCTGAGCTGACGGAAAAATACGGAATGCTTTCGTGTCCCACCCAATGTGTCGTCGTGATTGACTGCGCTGCAAAGCCGCAGTACGATACTCAGGCGCATAGACGCTCGAGGCCATGAGGATCTGGACCAC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739303.5p                                                                                                                  GATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAACGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAATGTGTCCGTCGTGGATCTGACCTGCGCTGCAGAGCCGCCAGTACGATGACTCAAGGCGGCATAGACTGCATCGAGGCCATGATGATCTGGATACACCAGAACAGTTGTCTCCACTGACTTCAATGTGACTTCATCTCACTAGTCTATGCAGTATTGCCTTGCAGGTAAACCTG
  5   1   2       bld Bone 5g                         IMAGE:8743013.5p                                                                                                                  ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGCCGTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACTGTCCATGCTTTCACTGCCACCCAGAGACTGTGGATGGCCCATCAGGAAGTTGTGAGAGATGCAGAGTGCTGTCAGAACATTATTCCCGCCTCAACTGTGCAGCAAGCTGTCCGAAAGTTATCCCTGGCTGACCGGAAAAATAACGATGCTTCGTGTCCCCACCAATGTGTCCGTCCTTGGATCTCGACTTGCGC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740368.5p                                                                                                                  GATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCTCATCAGGGAAGTGTGGAAAGAATGGCAGAGTGCTGGTCAGAAACATTATTCCGCCTCACTGGGTGGCGAGCAAGGCTGTTCGAAAGTTATCCCTGACTGGACGGAAAATAACGGATGGCTTTCGTGTCCCACCCATGTGTTCCCTCTGGATTGACTGCCCTGCAATCGGCAAATACATGACTCAGGCCTAACTCGCACAGCCATGAGGTATCTAGATAACAGACGGTTCGGACCAGTGCAACTACTCTA
  5   1   2       bld Brn1 5g                         IMAGE:4740285.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACA
  5   1   2       bld Bone 5g                         IMAGE:8743857.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCCGGAATGGCTTTCCGTGTCCCCACCCCAATGTGTCCGTCGTGGATCTGACCTGCCGCTGCAGAGTGGCCAAGTACGATGACATCAGCGCATAGACTGCATCAGAGGCCATGAAGATCCTGGATACCACAGACAGTGGTCTCCACTGACCTCATTGTTGAACCCTCACTCCCTTCCAATCTTTGGAGTGGCTTGGAT
  5   1   2       bld Bone 5g                         IMAGE:8741743.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGCTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGAAAAATAACCGGAATGGCTTTCGTGTCCCCACCCCAAATGTGTCCGTCGTGATCTGACTGGCGCTGCAGAGCAGCAGTACGATGACTTCAGGCGCAATAGACTGCATCAGAAGGCCATGATGTATTCTTGGATACACACAAGACAGCTGT
  5   1   2       bld Bone 5g                         IMAGE:8741076.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAAATGTGTCCGTCGTGGATCTGACTGCGCTGCAGAAGCGCAGTACGATGACTCAGCGGCATAGACTGCATCGAGGGCCCATGAGGATTCTGGGATACACACAAGACAGGTTGTTCTCCCAC
  5   1   2       add Bone 5g                         IMAGE:8743679.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACACTTTGGCATTGTTGAGGGACTTCATGACACTGTCCATGCTTTCCCTGCCACCCAGAAAAACTGGGGATGCCCCATCAGGTAGTTGTGGAAGAGATGCAGGGCTGTCGAACATTATTTCCCCGCCCTCAACTTGGGGGCAGCAAGCTGTCGAAAGTAATCTGAACTGACGAAATTACGGATGCTCCGTTCCACACCCAATGGTCACTGATAGACCTGCCTTGGACGCTAATCATGTATCTC
  5   1   2       bld Bone 5g3  in                    IMAGE:8740507.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAGACTGTGGATGGCCCATCAGGAAGTTGTGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCGGAAAGTTATCCCTGAGCCTGACCGGAAAAATACCGGATGGCCTTTCCTGTCCCCCACCCAAATGGTGTCCGTCCTGGATCTGACTGCCGCCTGCAGCCGCCAAGTACCATAGACTCAAGCCCCATAGAACTGCACTCGAAGCCATGAGGATCTGGTACACTAAACGTGTCCATGGACTCCAAGTGACCTATCTCTCCACAC
  5   1   2       bld Bone 5g                         IMAGE:8742033.5p                                                                                                                   ATAAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCGCTGCAGAAGCCGCCAAGTACGATGAACATCAAGCGCATAGACTGCATCAGAGGGCCCATGAATGATCCTGGATACCACAGACAGTGGTCTCCACTGACTTCCATGGGTGACACCTCACTTCCTCCAATCCTTTGAATGCCTGGAAT
  5   1   2       bld Emb4 5g                         IMAGE:5514264.5p                                                                                                                    TAAACCAAATCACGTTACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAATCGGAAAATACCGGAATGGCTTTCCGTGTCCCCACCCAATGTGTCCGTCGTGGATCTGACCTGCCGCT
  5   1   2       bld Lmb2 5g3  in                    IMAGE:8635141.5p                                                                                                                    GATAACCTAATCAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAAGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAAGCAAGCTGTGGAGAATGGCAGAGTGCTGGTCAGAACTTAATCCCGCCTCACTGGTGCGCAAAAGTGTCCGAAAGTATCCTGACTGACCGAAATAACGGATGGCTTCGTGTCCACCCAATGGTCGTCTGGATGACTGCGCTGAAACCGGCATCATAATCAGCGCATAGACGTCGAAGCATGAGGATCTGATCCAACAGTGCCAGATCAGTATCTCTCCTG
  5   1   2       bld Brn1 5g3  in                    IMAGE:4741051.5p                                                                                                                     AAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTC
  5   1   2       bld Ov1  5g                         IMAGE:6318942.5p                                                                                                                     AAACCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGNAAAAATACCGGAATGGCTTTCCGTGTCCCCACCCCAATGTGGTCGTCGTGGATCTGACCTGNCGCCTGCAGAAGCCCGGCCAGTACGATGACATCAAGGCCCGCCATAAGACTGCATCAAAGGCCCCAATGGAAGGGAATCCTGGGAATACCACAAGGACAGGNTTGTCCTCCACTGGACTTCAATGGGGAAACTCACCTCCTCCCATTCTTTGATGCTGAAGCCTGGAAATTGCCCTTGATGGAAAAACTTTTGT
  5   1   2       bld FaB  5g                         IMAGE:8071641.5p                                                                                                                     AAACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGC
  5   1   2       bld Eye1 5g                         IMAGE:4757419.5p                                                                                                                      AACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTT
  5   1   2       bld Eye1 5g                         IMAGE:4743565.5p                                                                                                                       ACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATG
  5   1   2       bld Tail 5g3  in                    IMAGE:8542615.5p                                                                                                                       AACCTAATCAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACAGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGA
  5   1   2       bld Bone 5g                         IMAGE:8743878.5p                                                                                                                       ACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCACGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAGCCGCCAGTACGATGACATCAAGCCGCATAGACTGCATCAGAGGCCCATGAGGAATCTGGATACACACAGACAGGTGTCTCCACTGACCTCATGGTGACCCTCACTCTCATCCTTGATGCCTGGATGGCCTGGCAT
  5   1   2       bld Bone 5g3  in                    IMAGE:8739269.5p                                                                                                                       ACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCACCCAATGTGTCCGTCGTGGATCTGACTGCGCTGCAGAGTGCAGTACGATGACTCAGCCGCCATAGACTGCATCAGAGGCCCATGAAGGAATCTGGATACACAGACCAGTGCTCACTGACTTCATGTGACCTCACTCTCATCTTGGATGCTGAATGCTGGAAATTGAC
  5   1   2       bld Bone 5g                         IMAGE:8742202.5p                                                                                                                       ACCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAGCACCAGTACGATGACATCAGCCGCCAATAGACTGCATCGAGGGCCCATGATGCATCCTTGGATACACACAGACAGAGTCTCCACTGACTTCATGTGACCCTCACTCCTCAATCTTGAATGCCTGGAATGCCTGCAATGC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739301.5p                                                                                                                        CCTAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCACGCAAGCTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAATGTGTCCGTCGTGGATCTGACCTGCGCTGCAGAGCGCAGTACGATGACTCAGCGCAATAGACTGCATCAGAGGCCCATGAGGAATCCTGGATACCACAAGACCAGCTGTCTCCACTGACTTCATGGTGAACACTTCACTCCTCATCTTTTGATGCTGATGGC
  5   1   2       bld Bone 5g3  in                    IMAGE:8739250.5p                                                                                                                        CCAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAGCAGCAGTACGATGACTCAAGCCGCCATTAGACTGCATCGAGGCCCATGAGGATTCTTGGGATCACAGACAGGTGTCCCCTGACTTCAATGGTGAAACTCATCTCAATCTTTGATGCCTGAAGCCCTGAAATTGACG
  5   1   2       bld He1  5g3  in                    IMAGE:4408434.5p                                                                                                                         CAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGAC
  5   1   2       bld Eye1 5g                         IMAGE:6945892.5p                                                                                                                         CAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAAGGGCCCAATGNAAGGGAAATCCTGNNGATACACACAAAGACCAGGGTTGGTCT
  5   1   2       bld Thy  5g                         IMAGE:8551228.5p                                                                                                                         ACCAATCAAGTGACTAAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTNCCGCCTNCACTGGTGCAGCAAAGGCTGTCGGAAAAGTATCCCTGAGCTGAACGGAAAATAACGGAATGGCTTTCGTGTCCCACCCAAATGTGTCGTCGTGGATCGACTNGCGCTGCAGAGCGGGCAGTAGATGACATCAGGCGCCATAGACGCTCGAGGGCCCATGAGGAT
  5   1   2       bld Thy  5g3  in                    IMAGE:8548785.5p                                                                                                                         CAAATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATACCGGAA
  5   1   2       bld Lmb2 5g                         IMAGE:8639860.5p                                                                                                                         ACCAATCAAGTGACTAAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCANGTCAGAACATTATTCCCGCCTNCACTGGTGCAGCAAGGCTGTCGGAAAAGTATCCCTGAGCTGACGGAAAATAACGGAATGCTTCCGTGTCCCACCCAATGGTCGTCGTGATTGACTGCGCTGCGAGCCGCAGTACATACATCAGCGCATAGACGCTCGAGCCATGAGGATCTGGATCACAACAGTGCCCGACTAGGACTCTCCACTA
  5   1   2       bld Eye1 5g3  in                    IMAGE:4743568.5p                                                                                                                           AATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAACAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACN
  5   1   2       bld Brn1 5g                         IMAGE:6956156.5p                                                                                                                           AATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCCGCCATTAAGACTGCATCAGAGGGCCCCAATGAAGGGAATCCTGGGATACACCCAAGGACCAGG
  5   1   2       bld Lmb1 5g                         IMAGE:8536243.5p                                                                                                                           AATCAAGTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGACATTATTCCCGCCTCACTTGTGCAGCAAGGCTGTCNGAAAGTATCCCTGGCTGAACGAAAATACCNGATGGCTTCGTGTCCCACCAATGTTCGTCTGATTGACTGCGCTGCAAGCCNGCATACATACTCAGCGCATAGATGATCAAGCATGAAGATCTGATCCCAACGTGCCAGATCAGGATCTCTCTTAGCACGATCGAGACTGATGTCGAATAG
  5   1   2       bld Neu7 5g3  in                         XL012m16.5p                                                                                                                                 GTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTT
  5   1   2       bld Ga12 5g                              XL177f11.5p                                                                                                                                 GTGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTG
  5   1   2       bld Bone 5g3  in                    IMAGE:8740749.5p                                                                                                                                  TGACTACAAAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGCTGTGGAGAGATGGCAGAGGTGCACGTCAGACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCCGGAATGGCTTTCCGTGTCCCCACCCCAATGTGTCCGTCGTGATCTGACCTGCCGCCTGCAGAGCCGGCCAGTACGATGACATCAAGCCGCCATAGACTGCATCAGAGGCCCAATGAACGAATCCTGGATACACACAGACAGGTTGTCTCACTGACCTCAATGGTGACCACTCCACTCCTCCAATTCTTTTGAATGGCCTGGATGCC
  5   1   2       bld Tbd7 5g3  in                         XL088p22.5p                                                                                                                                          AAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTC
  5   1   2       bld Ga12 5g3  in                         XL144a22.5p                                                                                                                                          AAAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCAAGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAG
  5   1   2       bld Ga12 5g3  in                         XL176d23.5p                                                                                                                                           AAATGGTGAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGC
  5   1   2       bld Ov1                             IMAGE:6315949.5p                                                                                                                                            ATTCCTCCGAATCGTCGACCCACGCGTCCGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAAAGGTGCTGGTCAGAACATTATTCCCGCCCTCACTGGTGCAGCAAAGGCTGTCCGGAAAAGTTATCCCCTGACCTGAACCGGAAAAATAACCCGGAATGGGCTTTTCCGTGGTCCCCACCCCCAAATGTTGTCCCGGCCGTGGAAActgaccctgccccccctgcgaaaacccgggcaagtaccgaatgaccttccccggcccccccATTTAAAAAATTGCCTTCCGAAAGGGCCCCAAAGGCAAGGGAAAACCCCGGGGGATACACCCCCCACGAACCCGAGGCTTGGCCTCCCACCTGGACTTTCCAATGGGTGGAAAACTTCCATTTACTTCCAATTCTTTTGAAATCCCTATAACGCCCCGGGAATAATTTNGCCCCCCGGACATGCGGACACACCTTT
  5   1   2       bld Bone      in                    IMAGE:8740399.5p                                                                                                                                                AAATAGGTCAATGAAGAGATCATCATATTCGAATTCGTCCCGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAGTTGTGGAGAGATGGCAGAGTGCAGTCAAACATTATTCCCGCCTCACTGGTGCAGCAAGGCTGTTCGGAAAAGTTATTCCTGGCTGGACCGAAAAATAACCGGATGCTTTCGTGTTCCCCACACCAATGTGTTCCGTCCTGGATCTGACCTGCGCCCTGCCAAAGCCGCCCAGTACATGACATCAAGGCGCCATTAGAACTGCACTCAAGGGCCATGAGATCCTGGGATACCAAAACGTGTCCTGACTCATGTGAACCCACTCACTTAAGCATCGAATGCCGATGAACTTGAACGTTCCTGTGGAAGAAT
  5   1   2       bld Lmb2                            IMAGE:8639722.5p                                                                                                                                                 TGAAGGTTGGAATTAATGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAGGCTGTCGGAAAATTATCCCTGAGCTGACGGAAAAATAACGGAAGGCTTTCGTGTCCCACCCAATGTGTCGTCTGGATCGACTGCCGCTGCAAAGCCGCCATACGAGACTCAGGCGCATAGACGCTCGAAGCCATGAAGATCTGGAACACAGACGGTGCTCACGACTCAGGAACCTCTCACTGACGACTGATGCTGAGA
  5   1   2       bld Brn1                            IMAGE:4740371.5p                                                                                                                                                  GAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGTGCTGCCTTTGATAGCGGCAAAGTTTAAGTCACTGCTATCAATGACCCCTTCATCGACTTGCACTCCATGGTC
  5   1   2       bld Brn1      in                    IMAGE:4740730.5p                                                                                                                                                  GAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACttttttttttACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAGGGGAACCGTTAAGGCTGACAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCC
  5   1   2       add Tbd4                            IMAGE:4058853.5p                                                                                                                                                  TATTGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCTAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAACGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTGGTTATCTGCGGCCCCTCAGCAGATGCCCGCATGTATGAAGATGGCGTGAACCATGAGAAATATGATAACTCTCTTAGAGTGGAGAGCAATGCTTACTGCACTACAGACTGTATAGCTACTGTAGCATAAGTCATAACAGACAACATAGGCATGGTATGAGGACTCATGATACATGTACATGCTTACACTGCAGACGAGAGAATGTGGAATGCACATTCAGGA
  5   1   2       add He1                             IMAGE:4406896.5p                                                                                                                                                  GAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTGTTCCAGGAGCGTGACCCCTTCAACATTAAGTGGGGAGATGCTGGTGCCAGATATGTGGTAGAATCTACTGAAATCTGCACAACCACATAGAAGGCCTCTCTGCACTTGAATGGAGGTGCCAAGCGTGTGATT
  5   1   2       bld Tad2      in                    IMAGE:6872074.5p                                                                                                                                                   AAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAATTGTGGGAGAGATGGGCAGAAGGTGCAGGGTCCAGAACATTATTCCCCGCCCTCAACCTGGGTGCAAGCAAAGGCTTGTCCGGAAAAAAGTTAATCCCCTGGAACCTGGAACCGGAAAAAAATTAACCCGGGAAAC
  5   1   2       bld Bone      in                    IMAGE:8739715.5p                                                                                                                                                      GTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGGTGCAGTCAGACATTATTCCCGCCTCACTGGTGCAGCAAAGCTGTCGAAAGTTATCCTGAGCTGACGAAAATACGGATGGCTTTCATGTCCCACCCATGTGTCGTCTGAATTCGACTGCCCTGCAAGCGGCAGTACATGAACTCAGCCATAGACTGCATCAGTCATGAAGAATTCTTGGATTCACCAAGA
  5   1   2       bld Bone                            IMAGE:8741094.5p                                                                                                                                                       TTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAGTTGTGGAGAGATGGCAGAGTGCAGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGCTGTCGGAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTCCGTGTCCCCACCCCAAATGTGTCGTCGTGGATCTGACTGCGCTGCAAAGCGCCAGTACCATGACATCAGCGCCATTAGACTGCATCGAGTCATGAAGAATCTGGATACACAGACAGTGTCTCCTGACGTCAATGGTGAGACTACTT
  5   1   2       bld Lmb1                            IMAGE:8535589.5p                                                                                                                                                         TGGAATTACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCATGAAAGCTGTGGAGAGATGGCAGACGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAATGCTGTCGGAGAAGTTATCCCTGAGCTGAACGGAGAATAACCCGAATGGCTTTCGTGTCGCACCCAAATGTGTCGTCGTGATCTGACTAGCGCTGCAGATCCGCNAGTAGATGACATCAGGCGACATATACTGCTCCAGGCTATGAAGGATCTGGATACACACACAGTTGCTCACGATCATGGGACGACCCTCTCTGAGCGAG
  5   1   2       bld Lmb2      in                    IMAGE:8635089.5p                                                                                                                                                               AACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTATCCCTGAGCTGAACGGAAAAATAACGGAATGGCTTTCGTGTCCCACCCCAATGTGTCGTCGTGATCTGACTNGCGCTGCAGAGCGGCAAGTAGATGACATCAGGCGCATTAGATGCTCAAGGCCNATGAGGNATCTGGATAAACAGACAGTTGCTCCGACTCATGGACTCCTCTCTCTGAGCGAGCGATG
  5   1   2       bld Bone      in                    IMAGE:8739850.5p                                                                                                                                                                     TTTGGCCGTATTGGGCGCCTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAGAGATGGCAGAGTGCTGGTCAGAACATTATTCCCGCCTCACTGGTGCAGCAAAGCTGTCGGAAAAGTTATCCCTGAGCTGAACGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCAATGTGTCGTCGTGGATCTGACTGCCGCCTGCAGAGCGCAGTACGATGACATCAGCGCCATAGACTGCATCGAGTCATGAGATCTGATACACAAGAACAGTTGTCTCCTGACTCATGGTGAACCCACCTCCTCACCTTGAGCCG
  3   1   2       bld Ga18 5g3  in                       xlk72h09ex.3p                                                                                                                                                                     GGNTTNGNCGNNNNGNCNCCNNNNNNCCNNNNCTGCNTTTGATAGCGGCAAAGTTCAAGTNNCTGCTATCAATGANCCCTTCATCGNCTTGGACTACATGGTGTACATNTCAAGTATGACTCCNCCCACGGCCGCTTTNANGGGAACCGTTAAGGCTGAGAATGGNAAGCTGATCATCAATGNCCAAGTCNTCNCNNTCTTCCAGGANNGTGACCCCTCCANCATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACANNCACAGAGAAGNCCTCTCTGCNCTTGAAGGGAGGTNCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGNCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCANNCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCANCCCCTCTTCTCACTGAAGGGGTCCAGAGTCNCCCNTCCTGCTANTCTNTCACTGTTNC
  5   1   2       chi Bone      in                    IMAGE:8739563.5p                                                                                                                                                                                       CTGGTGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCGTTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGGCCACCCAGAAAGACTGTGGATGGCCCATCAGGAAAGTTGTGGAAAAGATGGCAAAGGTGCAGTTCAAAACATTATTCCCGCCCTCACTGGGTGGCAGCAAGGCTGTTCGGAAAAGTTAATCCTGGACCTGAACGGAAAATTAACCGAATGGCTTCCGTGTTCCCCACCAATTGGTTTCCCTCTGGATATGACTGGCCCTTGCAACCGCCAATTACATAGAACATAGGGCGCCTAAACGCTCTCAAGGCAGTAAAGGAATCTTGTTATCACAGAACACGGTGTTCCTCCGCAGCCTAG
  5   1   2       bld Eye1                            IMAGE:6958168.5p                                                                                                                                                                                           TGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCCGGAAAAGTTATCCCCTGAGCTGAAACGGAAAAATAACCGGAAATGGCTTTTCCGTGTCCCCCACCCCCAAATGTGGTCCCGTTCGGGGAATCCTGAACCTGCCCGCCCTTGCAAAAAACCCCGGCCCAAGTTTCCGAATGGACCTTTCCAAGGCCCGCCCCTTTTAAAAAACTTGCCATTCACAAAGGGGGCCCCCAAATGTAAA
  5   1   2       bld Bone                            IMAGE:8743782.5p                                                                                                                                                                                           TGACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCCGGCCAAGTACGATGACATCAAGCCGCCATTAGACTGCATCAGAGGGCCCAATGAAGGAATCCTGGATACACACAGACCAGGTGTCTCCACTGACTCATGTGACACTCACTCTCATCTTTGATGCTGATGCTGGATGCCCTGATGAAAACTTTGTGAAACTGATCTGCTTGATAATGGATTGCCGGCTACAGCCACCCGGGGATGTG
  5   1   2       bld Bone                            IMAGE:8741418.5p                                                                                                                                                                                             ACCCGCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGCCGCCATTAGACTGCATCAGAGGCCCATGAGGATCTGGGATACACACAAGACAGGTTGTCTCACTGACTCATGTGACCTCACTCCTCATCTTGATGCTGATGCTGGATGCCTGAATGAAAACT
  5   1   2       bld Lmb1                            IMAGE:8535027.5p                                                                                                                                                                                                 GCGCTGCCTTTGATAGCGGCAAAGTTCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAGACTGCATCAGAGGGCCCATGA
  3   1   2       bld Ga18 5g3  in                       xlk69j13ex.3p                                                                                                                                                                                                       GCNTTTGANAGCNGCAAANTTCAAGTNNCTGCTATNAATGACCCCTTCATCGNCTNGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGANCCGTTAAGGCTGAGAATGGNAAGCTGATCATCAATGNCCAAGTCATCACCNTCTTCCAGGAGCGTGNNCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACANCCACAGAGAAGNCCTCTCTGCACTTGAAGGGAGGTNCCAAGCGTGTCGTTATCTCCGNCCCCTCAGNAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCANNNNTCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCANCCTGCTANTCTNTCACNGTTNCNNNNNCNAAA
  3   1   2       bld Ga18 5g3  in                      xlk134i15ex.3p                                                                                                                                                                                                       TGCCTTTGATANNGCAAANNNAAGTNNCTGCTATCAATGACCCCTTCATCGACTTGGACTNCATGNTGTACATGTTCAAGTATGNCNNNNCCCNCGGCCNCTTTAAGGGANCCNTTAAGGCTGAGAATGGCAAGCTGATCATCAATGNCCAAGTCATCACCGTCTTCCAGGAGCNNGNCCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGNCCTCTCTGCNCTTGAAGGGAGGTNCCAAGCGTGTCGTTATCTCCGNCCCCTCAGNAGATGNCCCCATGTTTGTAGTTGGCGTGANCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATNNATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCNACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNNCCNNCCTGCTANTCTNTCAC
  5   1   2       bld Skin      in                    IMAGE:8640351.5p                                                                                                                                                                                                                          TTCAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAGTACGATGACATCAAGGCGCCATTAGACTGCATCAGAGGCCNATGANGGNATCTGGGATACCACAGACCAGTGTCTCATGACTCATGTGACCTCCTCTCATCTTGAGCGAGCTGATTGCTGATGAACTGTGACTGTTCTGTTGAATGAGCGTACGCCTGTGGACTAGTCATGA
  5   1   2       bld DMZ                                  xl275p05.5p                                                                                                                                                                                                                          TCAAGTCACTGCTATCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAG
  3   1   2       bld Tail 5g3  in                    IMAGE:8541979.3p                                                                                                                                                                                                                             ATTTGGCCTATTGGGCCAGTGACCGCGCCTTGAAGCAGTTCAAGTCAGTTCATGACCTTAGACTGGATCATGGTTACAGTCAGTAGATTCCACCCACGCCGCTTAGGGACGTAGCTGAGAATGCAGCTGATCATCATGACAAGTCATCACGTCTCAGGAGCGTGACCCTCACATAAGTGGGGAGATGCTGGTGCGTGTATGTGGTGGAATCTACTGGAGTCTCACAACACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTTGTTCATAAAAAAAACAACAG
  3   1   2       bld Brn1      in                    IMAGE:6956592.3p                                                                                                                                                                                                                              nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTCTTTnTnnnnnnnnnnnCnGnnnnnnnnTCnTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCCCCTTTGTGTAAGCTTCACGCTGTGGATCGATCTTGCTAGTACGTCTGTCGCAGTCATCATTCGTTCAGGTGCCTCACATAGGGAGTGTGTCGTTATGTGTGATTACTGAGTCTCACACCACAGAGAGGCTCTTGCACTGANGGGAGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTATCTGTTTCCTAA
  3   1   2       bld Ga18                              rxlk68c23ex.3p                                                                                                                                                                                                                                ANTNNCTGCTATCAATGNCCCNTNATCGNNTNGACTACANGNNGTACATGTTCAAGTATGACTCCANNNNGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGNNAAGCTGATCATCAATGNCCAAGTCNTCACCGTCTTCCAGGAGCGTGNCCCCTCCANCATTAAGTGGGGAGATNCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACANCCACAGAGAAGNCCTCTCTGCACTTGAAGGGAGGTNCCAAGCGTGTCGTTATCTCCNGCCCCCTCAGCAGATGNCCCCATGTTTGTAGTTGGCGTGANCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTNCCNCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCNACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNNCCANCCTGCTANTCTNTCACTGTNNC
  5   1   2       bld Tad2      in                    IMAGE:6875388.5p                                                                                                                                                                                                                                        TCAATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCCCGGGATCTGACCTGCCCGCCTGCCACAACCCGGGCCAAGTACCAATGACATCCAAGGCCGCCCCATTAAAGACTGGCATTCAGAAGGGGCCCCAATTGAAAGGGGAACATCCTCGGGGGATATCCCCCCAAAGGACCCCGGGTTTTGTTCCTCCCACCCTGGAACCTTTCAATTggggggggAACACCCTCCA
  5   1   2       bld Tail      in                    IMAGE:8541639.5p                                                                                                                                                                                                                                           ATGACCCCTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAG
  3   1   2       bld Bone 5g3  in                    IMAGE:8740472.3p                                                                                                                                                                                                                                                GTACACACAGTGTCATCTTGCCTATCCATGACACCTCATGACTGACTACCTGGTAACTTTCAGTATGGATCAGCCCGGCGCTTAGGAACGTAGCTGAGATTGGCAGCTGATCATCATGACAGTCATCACGTCTCAGAGCGTGACCCTCAACATAAGTGGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTCTT
  5   1   2       bld Te2       in                    IMAGE:7390349.5p                                                                                                                                                                                                                                                  CTTCATCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGAACAGGTTGTCTCCACTGACTTTCATGGTGACACTCACTCCTCATCTT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740470.3p                                                                                                                                                                                                                                                   GTACATATCGGTCACTCTAACATGGCCCTCATGACTGACTACTGGTACAGTCAGTATGATCACAACGCGCTTAAGGGACCGTAGCTGAGATTGGCAAGCTGATCATCCAATGACCAGTCATCACGTCTTCAGAGCGTGACCTCAACATTAAGTGGGGGAGATGCTGTGCCGTCTATGTGGTGGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCTCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCATC
  5   1   2       bld Tad2                            IMAGE:6933332.5p                                                                                                                                                                                                                                                      GGCGACTTGGACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAGAAGTTATCCCTGAGCTGAACGTGAAAATAACCGGAATGGGCTTTCGTGTCCCACCCAATGTGTCGCGTGATTGACTGCGCTGCCAACAGCATCATCTAGTGCTGTGCAGCTGCGCAGCTAGTCCTGACAAGGGN
  3   1   2       bld Bone 5g3  in                    IMAGE:8740326.3p                                                                                                                                                                                                                                                       GATCATTGGAACTCTACAATGTTGTACATGTTCAAGTTAGGATCCAACCACGGCGCTTAAGGGACCGTTAGCTCGAGAATTGCAGCTGATTCATTCAATTGACAGTCATTCACGTTCTTCAGGAGGCGTGACCCTTCACATTAAGTTGGGGGAGATGCTGGTGCGTTTTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTTGCTTTAGTTC
  3   1   2       bld Bone                            IMAGE:8739817.3p                                                                                                                                                                                                                                                        TGAGCAGTCTGGGATATACACTGGTTGACATGTTCAAGTAGAGTTCATCAACGCCGCTTTAAGGACCGTTAGCCTGAGGAATGCCAAGCTGATCATCAATGACAGTCATCACCGTCTGCAGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGGTGTATGTGGTGGAATCTACTGGAGTTCTTCACAACCACAGAAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740284.3p                                                                                                                                                                                                                                                          ACCTCTCTTATCAGAACTTGGACTACATTGTGTACAGTTTCAGATAGACTCACCTACGCCGCTAGAACGTTAAGCTGAGAATGGCAAGCTGATCATCAATGACAGTCATACCGTCTCAAGAGCGTGAACCCTTCAACATAAGTGGGGAAGATGCTGTGCGTGGTATTGTGGTGGAATCTACTGAGTCTTCACAACAACAGAGGAAGGCCTTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAAGTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCAG
  3   1   2       bld Bone                            IMAGE:8740131.3p                                                                                                                                                                                                                                                           TGCGTTTCTTAGAGCTTGAGCACTACAATGGTACCGTTCCAGTAGATTTCACCAAGCGCTTAAGGAACGTAAAGCTGGAAATGGCAAGTGATCATCATGACAAGTCATCACGGTCTGCAGAAGCGTGACCTTCAACAATTAAGTGGGGAAGATGCTGGTGCGGGGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAAGTGCCAAGCGTGTCGTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTGTAAGTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCTGT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740191.3p                                                                                                                                                                                                                                                              CTACATGAGCATTGGACATCCAGTGTGATACAGTTCAAAGATTAGATCCACCAGGCGGTTAGGGACGTTAAGCTGAATGGCAAGTGAATCACATTGACCAGTCATCACCGTTTCAGAGGCGTGACCCTCCAACATAAGGGGGGAGATGCTGTGCGTGTATGTGGGTGGAATCTACTGGAGGTCTCACCACCACCAGAGAAGGCCTTCTCTGCACTTGAAGGAAGGTGCCAAGCGTGTCGTTATTCTCCGCCCCCTTCAGCAGATGCCCCCATGTTTGTAGTTGCGTGAACCATGAGAAAATATGAGAACTCTCTAAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCAG
  5   1   2       bld Tad2                            IMAGE:6934733.5p                                                                                                                                                                                                                                                               GGCTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGGAAGCTGTGGAGAGATGGCAGAAGTGCACGTCAGAACATTATTCCCCGCCTCAACTGGTGCAGCAAAGGGCTGTCGGAAAAGTTATCCCTGGAACTGAACGGAAAAATAACCGGAATGGCTTTCCGTGGTCCCCACCCCAAATGTGTCCGTCCGTGGATCTGAACCTGCCCCCCTGCAAAACCCGGCCAAGTACGAATGACTTCAAGGGCCGCCCATTTGAAACTGCCATCAAAGGGGCCCCATGAAAGGGGAATCCTTGGGGATCCCCCCAAAGACCCGGGTTTTTCT
  5   1   2       bld Tad2                            IMAGE:6936190.5p                                                                                                                                                                                                                                                               GGGTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTTGAGAAGCCGGGCCAAGTACGATGAACCTCAAGGCCCGCCCATTTAAAGACTGGCATCAAGAAAGGGCCCCAATGTAAGGGGGAAATCCCTGGGGGAATACAAT
  5   1   2       bld Lmb2      in                    IMAGE:8636335.5p                                                                                                                                                                                                                                                                ACTACATGGTGTACATGTTCAAGTATGACTCCACCCACGGCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAACTTGTGAAACTGGTTTCCTGGTATGAATAATGGAATGCGGCTACAG
  3   1   2       bld Bone      in                    IMAGE:8739576.3p                                                                                                                                                                                                                                                                CTTACTAGAGACCTCTTGGGACTTACACTGGTTAACAGTTCAGTTGACTCATCTAGCGCTTAGGGATCGTTAGCTGAGAATGGCAGCTGATCATCATGACCAGTCATCACGTCTGCAGGAGCGTGACCCCTCCAACATTAGTGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTCTGGTTCCCTAAATTAAAAACCA
  3   1   2       bld Bone      in                    IMAGE:8739715.3p                                                                                                                                                                                                                                                                CAGATCTGGGAGCATAACCATGGTTAAACATGTCAAGTATGATCACCACGCCGCTTAAGGACCGGTAGGCTGAGATGCAAGCTGATCATCAATGACCAAGTCATCACGTCTTCAGGAGGCGTGACCCTCAACATTAAGTGGGGGAGATGCTGTGCGGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCCT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740443.3p                                                                                                                                                                                                                                                                 GAGACACCTCTACATGGACTTGGACTACATGGGTACATGTCCAAGTATGATCAACCAGGCCTATGACCGTTAGCTGGATGCAAGCTGATCATCAATGACAGTCATCACGTCTGCAGAGCGTGACCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCTTT
  3   1   2       bld Tad2      in                    IMAGE:6872074.3p                                                                                                                                                                                                                                                                  TTTCATTTTGTCCAATTTTTTATTCTCTCCAGTTGGCCCCGGTTTATTCCGCCGTTTTTTCCGGGGGGCGCCGTGGCCCCTCCCCACAACCTTTACAGGGGGGAAAATTGTTGGGGCCCTGTGTACGGGACGGGGATTTCCAACTGGGATTTTTCCACCACCCCCAAGGGGAGGGCCTTTTTTTGCCTTGAAAGGGGAGGGTGCCAAAGGGGTGTTGTTTATCTTCCCGCCCCCTTCCGGCGAGATGCCCCCCCAATGTTTGGTAGTTGGGCTTGAACCCCTGAGAAATATGGGGAACCTCTCTTAAAAGTGGTTAGGCAATGCTTCCCTCCAATACAAACTGTTTGGATCCTCTGGCAAAGGTCATCAACGACAACTTTGGCATTGTCGAGGGACTCATGACAACTGTCCATGCTTTCANTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGCGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGNGCAGCAAAGGCTGTCGGAAAAGTTGCCCTTTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACGNAAGGGGTCCAGA
  3   1   2       bld Bone      in                    IMAGE:8739563.3p                                                                                                                                                                                                                                                                  CGTTTACTATCGACCTTGGATACTAACATTGGGTTACATGTTCAGTATGACTCCACCACGCCGCTTAGAACCGTAAGCTGAGATGCAAGCTGATCATCATGACAGTCATACGTCTTCAGGAGGCGTGACCCTCAACATTAGTGGGAGATGCTGTGCGTGTTATGTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCTT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740055.3p                                                                                                                                                                                                                                                                   TTAGCAGAGTATGATTTCAACCTACACGCTTAGGGACCCGTTAAAGGCTGAGAATGGCAAGCTGATACATCCATGACCCAGGCCATCCACGTTTTCCAGGAAGCGTGACCCTTCCACCATTAGTGGGGAGATGCTGGTGCCGTGTATGTTGGTTGGAATCTTACTGGAGTCTCACCAACCACAGAGAAGGCCTTCTCCTGCCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCCGCCCCCTCCAGCAGATGCCCCCATGTTTGGTAGTTGGCGTGAACCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGAGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTG
  3   1   2       bld Bone      in                    IMAGE:8740399.3p                                                                                                                                                                                                                                                                   GAGCTCTGGAAATCTATCACATTGGTGTGTACAGTGTTCAAGTATATGACTCCAACCCACGTGCCTTAGGACGGTAGCTGAGGATGGCAGCTGATCATCATGACAGTCATCACGTCTCAGGAGCGTGACCCTCACATAAGGGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCTGTC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740431.3p                                                                                                                                                                                                                                                                      GCAGTCTGTGACTAGCACGTGGTACAATGTCAAGAAGATTCACCACGCGGCTAGTACGTTAGCTGAGATGGCAGCTGATCATCAATGACAAGGTCATCACCGTCTCCAAGAGCGTGACCCTCCAACAATTAAGTGGGGAAGATGCTGGTGCGTGTAATGTGGTGGAATCTACTGGAGTCCTCACAACCACAGAGAAGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTTCTT
  3   1   2       bld Tad2 5g3  in                    IMAGE:6872039.3p                                                                                                                                                                                                                                                                        CACCCCCCGCGGCCCGCTTTTAAAGGGGAAACCGTTTAAGGGCTTGAGAATTGGCAAGGCTGATTCATCCAATGACCCAAGGTCTTCCCCGTTTTTCCAGGGGGCGTGACCCCTTCCAAACATTAAGTGGGGAGGATGCTGGTGCCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTGGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCATC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740354.3p                                                                                                                                                                                                                                                                         GAGCTCTGGGAACTATACATGGTGTAACATGTTCAGGTTGACTCCACCCACGCGCTAGGATCGGTAGCTGAGATGGCAAGCTGATCATCAATGACAGTCATCACGTCTCAGGAGCGTGACCCTCACATAAGTGGGAGATGCTGGTGCGTGTATGTGGTGGAATCTACTGGAGGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCTGT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740629.3p                                                                                                                                                                                                                                                                         TGGACTATCACATGAGTGTAACATGTTCAAAGTATGGACTCCAACCCCACGGCGCTTATGACCGGTAGCTGGAATGCAGGCTGGATCATCATGACAGTCATCACGTCTCAGAGCTGACCTCCAACATTAGTGGGAGATGCTGTGCGTGTTATGTGGTGGAATTCTACTGGAGTCTTCACAACCACAAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTTT
  3   1   2       bld Bone      in                    IMAGE:8739850.3p                                                                                                                                                                                                                                                                          TACATCAGAGCTTGGGACATACATGTGTACATGTTCAGTTAGACTCCAACCAAGCGCTTATGACGGTAGCTGAGATGCAGCTGATCATCAATGACAGTCATCACCGTCTCAGGAGCGTGACCCTCCAACATTAGTGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740368.3p                                                                                                                                                                                                                                                                            GATACATGTCCCAAGTATGACTTCCACCCACGTCGCCTTAGCAACCGTTAAGGCTGAGAAATGGCAAGCTGATCATCATGACCCAGTCATCCACGTCTTCCAAGGAGGCGTGACCCTCCACATTTAGTGGGGGAGATGCTGGTGCCGTGTATGTGGTTGAATCTACTGGAGTCTTCACAACACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACCTGTTTTTCTTT
  3   1   2       bld Tad1      in                    IMAGE:6878594.3p                                                                                                                                                                                                                                                                              AATGTGGAACCCCAAGAGTTTCATTTTCCACCCGGTTTTTTTCCCCCAAAGGAAGGCGCGGTGAACCCCCTCTTCCCCAAACCTTTTAAAAGGTGGGGGGAAGAATGCTTGGGTTGCCGCGTGTTATGTTGGGTGGGAATTTTACCTGGAGGTCTTTCCACAAACCCACAGGAGAAAGGCCCTCTTTTGCAACTTGAAGGGGAGGTGCCCAAGGCGTGTCGTTATCTTCCGCCCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTGGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGGAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCGGAATCGCCCATCCTGCTACTCCCTTTTTTGAA
  3   1   2       bld Bone 5g3  in                    IMAGE:8740222.3p                                                                                                                                                                                                                                                                               TGAATGTGAACTATACATGGTTGTATACATGTCAAGTAAGATTCCACCCACGCCGCTTAGACCGGTAGCTTAATGCAGCTGATCATCAATGACAGTCATCACGTCTCAGGAGCGTGACCCTCCAACATTAGTGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGAGTCTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTCTT
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8532276.3p                                                                                                                                                                                                                                                                                 TGTGGGTATACAATGGTTCAGATATAGACCCCACCCCACGGCGCTTAGGACGTAAGCTGAGATGGCAAGCTGATCATCAATGACCAAGTCATCACGTCTTCAGAGCGTGACCCTCAACATTAAGTGGGAGATGCTGTGCCGTGTATGTGGTGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCTTTCATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCTTCCTGCTTAGTCTGTT
  3   1   2       bld Tad2 5g3  in                    IMAGE:6872735.3p                                                                                                                                                                                                                                                                                    CGGCCAAGGCGGGATTCCATCCAAGTGGCCCAAAGGTCATTCCCCGGTTCTTTCCAGAGAAGGCGTTGACCCCCCTCCCAACAAATTAAGGGGGGGGAGAATGCATGGTGCCCGTGTAATGTTGGGGGGAATTTTACTGGGGGTTCTTCACAACCCCCCGAGGAAAGCCCTTTCTGCCACTTGAAGGGGAGGTGCCAAAGCGGGTCGTTTTTTTCCGCCCCCCTCAGGCAGATGCCCCCCCATGTTTTGTAGTTGGCGTGAACCATGAGAAATATGAGACCTCTTTTAAAGTTGTTAGCCAAATGCATCCTGCACTACAAACTGTCTGGCTCCCTCTCGCAAAGGTCATTAAACGACAATTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTATAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740675.3p                                                                                                                                                                                                                                                                                     CATGTGTGTAACATGTGTTCAAGAGTATGACTCCACCCAAGTCGCTAATGATCGTTAGGCTGAGAATGCAGCTGATCATTCATGACAAGTCATCACCGTCTCCAGAAGCGTGACCCTCCACATAGTGGGAGATGCTGTGCGTGTATGTGGTGGATCTACTGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTCTTGTTTCACTAAAAAAACACCGA
  3   1   2       bld Bone 5g3  in                    IMAGE:8740507.3p                                                                                                                                                                                                                                                                                     TGAATATACCTAGTTGTAACGATGTCAGTATAGATCAACACGCGTTTATGCACCGTAAGCTGGATGGCAAGCTGATCATCATGAACAGTCATCACGTCTACAGAGCGTGACCCTCCACATTAGTGGGGAGATGCTGGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTTCT
  3   1   2       bld Bone 5g3  in                    IMAGE:8739729.3p                                                                                                                                                                                                                                                                                        ACATGTGTTCAATAGTAGACTCCCACCCCACGGCGGCTTTAAAGGACCGTTAGCTGAGATTGCAGCTGATCATCAATGACCAGTCATCACGTCTCAGGAGCGTGACCCTCCACATAGTGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTTTTTCTGTGTTTCATAATAACACATC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740160.3p                                                                                                                                                                                                                                                                                          TTAATTAGACTGGGATACATGGTGTTACATGTCAGATAGAATCCACCACGCGCTAGACGTAGCTGGATGGCAAGTGATCATCATGACAGTCATCACGTCTCAGAGCGTGACCCTCCACATTAGTGGGAGATGCTGTGCGTGTATGTGTGATCTACTGAGTCTTCACACACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTT
  3   1   2       bld Bone 5g3  in                    IMAGE:8739648.3p                                                                                                                                                                                                                                                                                           CCAAAGATTGAGATCTCCACCAACGGCGCTTAGGGACCGTATGCTGAGGATGCAGCTGATCATCCAATGACAAGTCATCACGTCTTCAGAAGCGTGACCCCTCCAACATTAGTGGGGAGGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTCAACAACACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTTCACTGTTTCTGGTTCGTTAAATAAAC
  3   1   2       bld Tail      in                    IMAGE:8541639.3p                                                                                                                                                                                                                                                                                             CCCACAGGATTTGATCACCCAACGCGTTAGGATCGTAGCTGAGAATTGGCCAGCTGATTCATCAATGAACCAAGTCATCACGTCTCAGAGCCTGGACCCCTCCAACATAGTGGGGGAGATGCTGTGCCGTGTTATGTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCGGGTCCCTAAAAAAAACCC
  3   1   2       bld Tail 5g3  in                    IMAGE:8543119.3p                                                                                                                                                                                                                                                                                                TACTGGTGTTACATGTTCAAGTTAGATCAACCAGACGCTAAGAACGTTAAGCTGAGAATGCAGCTGATCATCAATGACAGTCATCACCGTCTCAGAGCGTGACCCTCCACATAGTGGGGAGATGCTGTGCGTGTATGTGTGAATCTACTGGAGTCTTCACAACCACAGAGAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCTGGTCATAAATAAAAACA
  3   1   2       bld Bone      in                    IMAGE:8740217.3p                                                                                                                                                                                                                                                                                                TCCCGATTGAGATCTCCAACCAGGGCGCTTAGCATCGGTTAAGCTGAGAATGGCAAGCTGATCATCATGACCAAGTCATCACGTCTTCCAGGAGCGTGACCCTCCACATAGTGGGAGATGCTGTGCCGTGGTTATGTGTGATCTACTGAAGTCTCACAACCACAGAGAAGCCTCTCTGCACTTGAAGGGAGGTGCCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTTGTTCCTAAAAAAAAACC
  3   1   2       bld Bone 5g3  in                    IMAGE:8739814.3p                                                                                                                                                                                                                                                                                                TCAAGGTATTGATCCACCCACGGCCGCTATGATCGGTAGCTTGAGATGCCAGCTGATCATCATGACAAGTCATCACGTCTGCCAGGAGGCGGTGACCGTCCAACATAAGTGGGAGATGCTGTGCGTGTTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAAACCCA
  3   1   2       bld Bone 5g3  in                    IMAGE:8740356.3p                                                                                                                                                                                                                                                                                                 GTCCAAGGAGGATCCCACCCACGCGCTTTAGGGATCGGTAAGCTGAGAATGCAGCTGATCATCATGACAGTCATCACGGTCTTCAAGGAGGCGTGACCCTCCAACATAAGTGGGGAGATGCTGTGCCGTGTATGTGTGAATCTACTGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTGTTGTTTTCCTAAAAAAAAG
  3   1   2       bld Tad1                            IMAGE:6881170.3p                                                                                                                                                                                                                                                                                                   TTTTCTCCTAGGGGATAGCGAGAGGACCCCCCTTTCCCTAACCCCTTTAAAAGTTGGGGGAGGGAATTTCNCGGGGCCCCCCGTTTTAATGGGGGGTGGGAAATTCTAACCGGGGAGTTTTTTCCCCAACCCCCCGGAGAAAGGGGCCTTTTTTTGCACCTTAAAGGGGAGGTCCCCAAAGGGGGGTCGTTATTTTCCGGCCCCCCTTCAGCAGGATGCCCCCCCTGTTTTGTAGTTTGGCGTGAAACCATGAGAAATATGAGGAACTTTTCTTAAAAGTTGTTAGCAATGCATCGTGCACTACAAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCCCCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  3   1   2       bld Tail                            IMAGE:8541593.3p                                                                                                                                                                                                                                                                                                    CCAAGTATAGACTCCACCCAGCCGATTAACGAACCGTAGCTGAGAATGCCAAGCTGATCATCATGACCAGTCATCACGGTCTGCAGGAGCGTGACCTCACCATTTAAGTGGGGGAGATGCTGTGCGTGGTATGTGTGAATCTACTGGAGTCTTCACAACACAGAGAAGCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCTTCCTGCTAGTCTGC
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8531883.3p                                                                                                                                                                                                                                                                                                    GACTCTCCAACCCCCACCGGCCGCTTAAGGACGTTAGCTGAGATGCAGGCTGATCATCCATGACAGTCATCACGTCTCCATGGAGCGTGACCCTCGAACATTAGTGGGAGATGCTGTGCGTGGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCTGGTCCCTAAATAAAACCCG
  3   1   2       bld Bone 5g3  in                    IMAGE:8740210.3p                                                                                                                                                                                                                                                                                                    TCAGGTATTAGTCTCACCCACGACGCATTAAGGGACCGTTAGCTGATGCAAGCTGATCATCATGACAGTCATCACGTCTTCCAGAGGCGTGAACCCTCAACATAGTGGGGAGGAATGCTGTGCCGTGTATGTTGTGATCTACTGAAGTCTTCACACCACAGAGAAGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGTTGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTCTGTGTTCCCTAAATAATAACCT
  5   1   2       bld Brn1                            IMAGE:6955866.5p                                                                                                                                                                                                                                                                                                       GCCGCTTTAAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGGTCACCTGTCAACCCCTCTTCTA
  5   1   2       bld Lmb1                            IMAGE:8535480.5p                                                                                                                                                                                                                                                                                                        CCGCTTTTAGGGAACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGGCCCATGAAGGGATCCTGGGATCACACAAGACCAGTTGTCTCACTGACTTAATGGTGACCTCACTCCTCATCTTGAGCTGAGCTGGATTGCCTGATGAAACTTGTGAACTGTTTCTGTAGATATGATGCGCTCAGCAGTGTGTGATCGAGGTAATGCATCAAGATA
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8532367.3p                                                                                                                                                                                                                                                                                                        CAACACGGGGCGGCTTAAGGGAACGGTTAAGGCTGAGGAATGCAGCTGATCATCATGACAGTCATCACGGTCTGCAGAGCGTGACCCCCTCCACATAGTGGGAGATGCTGTGCCGTGTTATTGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTGGTCTGTCACTGTTTCTGTGTCACTAAATAAACCC
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8532344.3p                                                                                                                                                                                                                                                                                                        TATCCCAACGGGCGCCTTTAAGGAACGTTAAAGGCTGGAGGAATGCAGCTGATCATCATGACAGGTCATCACGTCTCAGAGGCGTGACCCCTCCACATTAGTGGGAGATGCTGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCTGGTCATAAATAAACCC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740169.3p                                                                                                                                                                                                                                                                                                        GTCAAGATATAGATTCCCACCCACGTCGCTTTAATGAACCGGTAGCTGAGATTGCAAGCTGATCATCATGACAAGTCATCACGTCTCAGGAGGCGTGACCTCACATAGTGGGAGATGCTGTGCGTGTATGTGTGAATCTACTGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTTTTCTAAAAAAAAACCTT
  3   1   2       bld Tad1                            IMAGE:6878715.3p                                                                                                                                                                                                                                                                                                          GCAAGATGACCCCAAAGTTCTTTCCCACGTTTTCTTCGCCAGGGAAGGCGTGGACCCCCTTCCCAAACAATTAGAGTGGAGGAGGAATGCCTGGTTCCCGGTGTTATGTGGGGGAATTCTACTGGAAGTCTTTCACCAACCACCAGAGAANGGCCCTCTCTGCACTTGAAAGGGAGGTGCCAAGCCGTGTCGTTATCTCCCGCCCCCTTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCTTGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  3   1   2       bld Bone 5g3  in                    IMAGE:8739231.3p                                                                                                                                                                                                                                                                                                             ACAGGCTTGCTTTAAAGGAACCGTAAGCTGAAGAATGCAAGCTGATTCATCATGACCAGTCATCACCGTCTCAGAGCGGACCCTTCCAACATTAAGTGGGGAGATGCTGTGCGTGTATTTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCAGTCGACA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6874962.3p                                                                                                                                                                                                                                                                                                              CGTTAAAGGGTTGAGAATGGCCAAGGTGATTCATCCATGGACCCAAGTTCTCCACCTTCTTCCCAGAAGCGTGCCCCCTCCAAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCTTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  3   1   2       bld Ga18      in                      xlk117c18ex.3p                                                                                                                                                                                                                                                                                                              CNNNGTCCGCCCNNNGTCCGCCCACGCGTCCGTGATCATCAATGNCCAAGTCATCNCCNTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGNNCTCTCTGCACTTGAAGGGAGGTNCCAAGCGTGTCGTTATCTCCNNNCNCTCANNAGATGCCCCCATGTTTGTAGTTGGCGTGAANCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATNNATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCNACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCANCCTGCTANTCTNTCAC
  3   1   2       bld Tail 5g3  in                    IMAGE:8541573.3p                                                                                                                                                                                                                                                                                                                 ATTCCACACCCACGGCCGCTTATGTACCGTAAGGCTGAGATGGCAGCTGATCATCCATGAACAGGTCATCACGTCTCCAGGAGCGTGACCCTCACATAGTGGGGAGATGCTGTGCGTGTATGTGTGATCTACTGCGTCTCACACCACAGAGAAGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCATGTTTCTG
  3   1   2       bld Tail 5g3  in                    IMAGE:8541636.3p                                                                                                                                                                                                                                                                                                                 CAACGGGCGCGCTTAGGAAACGTAGCTGAGATTGGCCAGCTGATCATCAATGACCAGTCATCACGTCTTCAGAGCGTGACCTCCATCATTAGTGAGGAGATGCTGTGCCGTGTATGTGGTGGAATCTACTGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACAGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAAACCT
  3   1   2       chi Tad1                            IMAGE:6877603.3p                                                                                                                                                                                                                                                                                                                    TTTCCGCCGGTTTTTTCCCAGGGAGGCTTTGAACCCCCTTCCAAACCTTGAAGGGGGGGGGGGATGGCCTGGTGGCCCCGGTTAAGGTGGGGGGGAATTTTAACTGGAGTTTTTTACCAGCCCACAGAAGAAGGCCTTTTTTTGCACTTGGAAGGGAGGGTTCCCAAGGGGGTTGGTTATTTTCCGGCCCCCCTCAGCAGGATGGCCCCCCATGTTGTAAGTTGGGCGGGAACCCTGAGGAAATAGGGGAACTTTCTTAAAGTGGTTAGGCAATGCATCTGCCACTACAAACTGTCGGGCTCTTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACGAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTCGTTTTTTGAAAAANNGNCTTCCCCCGGGGGGGGCGTTGGGAGAGGGCAGGGCGCAGATAGTGAGNAAGGGGGG
  3   1   2       bld Tad2      in                    IMAGE:6876117.3p                                                                                                                                                                                                                                                                                                                    GTCTCTTTCTTTCTCCCACCTTTTTCAGTGTGGTTACCTTGCTCTCTTCCGTCGCGCTAGGGTGTCTTCTGCGCGTCGCGACTTTTCTTATCGGAGTTCTTTGCTACATCCCCCCAGGGGATAGGCCCTTTTCTTTCCATTTTTAGAGGGAACGCTGCCCCAAGGCGGTTTTTTTTATTTTCACGCCCCCGTTCAGGCGGATGCCCCCCCACTTTTTGTAGTTGGCCGTGAACCATGACGAAATATGAGAACTTTTCTTAAAGTTGTTACCAATGCTTCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGTTCATCAACGACACCTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGCGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATCACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  5   1   2       bld Lmb1                            IMAGE:8533686.5p                                                                                                                                                                                                                                                                                                                    AACCGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCANGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCNAGTACGATGACATCAAGGCCGCCCATTAGACTGCATCAGAAGGGCCCATGAAGGGAATCTGGGATACACACAGAACCAGTTGTCTCACTGACTCAATGTGACACTACTCCTCATCTTGAGCGATGCTGGATTGCCTGATGAAACTTGTAAACG
  3   1   2       bld Bone 5g3  in                    IMAGE:8740937.3p                                                                                                                                                                                                                                                                                                                      CCTTAAGGAACGGTAAGGCTGAGGAATGGCAGGCTGATCATCATGACCAGTCATCACCGTCTCAGAGCGTGACCCTCCAACATTAAGTGGGGAGATGCTGGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCCGTCGACGC
  5   1   2       bld Lmb2                            IMAGE:8638761.5p                                                                                                                                                                                                                                                                                                                       CGTTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCATGGTGACACTCACTCCTCATCNTGATGCTGATGCTGGAATTGCCTGATGAAACTTGTGAACTGGTTNCTGTATGATATGATGCGCTACGCACGTGTGTGATCTAGTGTCATGCTCTAAGATAGCCTGTCCTGCACCTCTCTCTGAGGT
  3   1   2       bld Bone 5g3  in                    IMAGE:8740876.3p                                                                                                                                                                                                                                                                                                                        CTAAAGGATCGTTAAGGCTGAGGATTGGCAGCTGATCATCATGACCAGTCATCACGTCTCCAGAGCGTGACCCTCCAACATTAGTGAGGAGATGCTGTGCGTGTATGTGTGGAATCTACTGGAGTCTTCACAACCACCAGAGAAGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCAGTCTACCT
  5   1   2       bld Lmb2                            IMAGE:8638294.5p                                                                                                                                                                                                                                                                                                                         TTAAGGCTGAGAATGGCAAGCTGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCCACTGACTTCATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTTGCCTGAATGAAACTTTGTGAAACTGGTTTCCTGTATGANTATGATGCNGCTCAGCACCGTGTTGTGATCTATGTGTACATGCATCTAAGATAGCACTGTCACTGTCACCTC
  3   1   2       bld Bone 5g3  in                    IMAGE:8739403.3p                                                                                                                                                                                                                                                                                                                         GGGAGCCGTATAGGCTGAGAAATGGCAAGCTGATTCATCATGATCAGTCATCACCGTCTTCAGAGGCTGACCCTCACATTAAGTGGGGAGGATGCTGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCATGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCTTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGTTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTT
  3   1   2       bld Eye1 5g3  in                    IMAGE:6947798.3p                                                                                                                                                                                                                                                                                                                          CTGAGAATGGCCAAGCTGATCATCAATTGACCCAAGTCATCACNGTCTTCCAGGAGCCGTGACCCCTCCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTGTCGT
  3   1   2       chi Tad1      in                    IMAGE:6879241.3p                                                                                                                                                                                                                                                                                                                           AGCCCCCCTTTCCCAAGACATTTTAAAAGTTGGGTGGAAGAAATGCCTGGTTGCCCGTTGTTATTGTGGAGGGGGAATTCTACATGGGGGGTTTTTGCAACCACCCCCCGGAGGAAGGGGCTTTTTTGGCCACTTTGAAGGGGAATGGTGCCCAAGCGGTTTTCGTTATTTTTCCGCCCCCTTCAGGCAGATTGCCCCCAGTGGTTTGTAGTTGGGCGTGAAACCATGAGGAAATTTGAGAACTCTTCTTAAAGTTGTTTAGCAATGCTCCTGCCACTACAAACTGTCTGGCTCTTTTCGCAAAGGTTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTNGTCTGTTTTTGGGAACGCCCCCCATTATNGATATAATTAATAATGAGGCCTTTCGTCTTGCGTATGTTTGGNGGGGGGTGTTTTTTTT
  3   1   2       bld Bone 5g3  in                    IMAGE:8739493.3p                                                                                                                                                                                                                                                                                                                            GCCTTTAAGGAACCGTAAGGCTGAGAATGGCAAGCTGATCATCATGACAGTCATCACCGTCTTCAGAGCTGACCCTCCAACATTAGGGGGAGATGCTGTGCGTGTTATGTGTGGAATCTACTGGAGTCTCACACCACAGAGAAGCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCAACA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739479.3p                                                                                                                                                                                                                                                                                                                             CGTTTAGGCGTGGGGAATGGCAAGGCTGATTCATTCAATGACCAGTCATCACGTCTCAAGAGCGTGACCCTCACATTAAGTGGGGGAAGATGCTGTGCGTGTATGTGTGAATTCTACTGGAGTCTTCACAACCACAGAGAAGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTTCAGTTCAAC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740784.3p                                                                                                                                                                                                                                                                                                                             GGGAACCCGTTAAGGCTGAGGATGGCAAGCTGATCATCATGACCAGTCATCACCGTCTCAGGAGCGGGACCCTCACATAAGTGGGGAGATGCTGGTGCGTGTATGTGTGGATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCGTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATCCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTCTTGTTTCTCGTA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739220.3p                                                                                                                                                                                                                                                                                                                              TCACAGGCCGTTAAGGGATCGTAGCTGGAATGCAGCTGATCATCCATGACAGTCATCACGTCTCAAGAGCGGACCTCCACATTAAGTGGGGAGATGCTGTGCGTGTATGTGTGAATCTACTGGAGTCTCACACACAGAGAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTAGTTCAGTTTCA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6875474.3p                                                                                                                                                                                                                                                                                                                               GCAAGCCTGATCATCAAATGACCCAAGTCATCACNGTTCTTCCAGGAGNCGTGACCCCTCCCAACATTAAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCCACAGAGANAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCTTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCCT
  3   1   2       bld Bone 5g3  in                    IMAGE:8739348.3p                                                                                                                                                                                                                                                                                                                                TAAGGGCTGAGAATGGCAAGGCTGAATCATCAATGACAAGTCATCACGTCTTCAGGAGGCGTGACCCTCCAACATAGTGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCCACTGTTTCTGTTTTCCCTATAAGAACAAACCAC
  3   1   2       bld Bone 5g3  in                    IMAGE:8739269.3p                                                                                                                                                                                                                                                                                                                                 CTAAGAAATGGCAAGGCTGATCATCAATGACCCAAGTCATCACCGTCTGCAGGAGGCGTGACCCTCACATTAAGTGGGGAGATGCTGGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCATAAATTTAACGTTTGAGGA
  3   1   2       bld Brn1 5g3  in                    IMAGE:6950198.3p                                                                                                                                                                                                                                                                                                                                  AGGCCAGGTGATTCATCAATGACCCAGTCATTCACCTTCTTCCAGGAGGCGTGCCCCCTCCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACACCCACAGAGAAGGCCTCTCTGCACTGGAAGGGAGGTGCCAAGCGGGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTGTAAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCATC
  3   1   2       bld Bone 5g3  in                    IMAGE:8739250.3p                                                                                                                                                                                                                                                                                                                                  AGGGCTGAAGAATGGCAAGCTGATCATCATGACCAGTCATCACCGTCTCAGGAGGCGTGACCCTCACATAGTGGGGAGATGCTGGTGCCGGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGCTTAATAGTTCCTTGAAATGACAAGATACCT
  3   1   2       bld Tad1 5g3  in                    IMAGE:6878355.3p                                                                                                                                                                                                                                                                                                                                   GGCCCAAAGTCCTTCCCCGTTTTTCCCAGGGAGGGGGGACCCCCTCCAACCATTAAAGTGGGGGAGATGCCGGGTTCCCGTTTAAGGGGGTGGAATCTACCTGGAGTCTTCCCCAACCCACAGAGAAGGCCCTCTCTGCACTTGAAGGGGAGGTGCCCAAGCGTGTCGTTATCTCCCGCCCCTTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTTC
  3   1   2      seed Bone 5g3  in                    IMAGE:8740761.3p                                                                                                                                                                                                                                                                                                                                   GGGCTGAGGAATGGCAAGCTGATCATCAATGACAAGTCATCACGTCTGCAGGAGCGTGACCCTCCACATAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCCTAAATTAAACCAAGGTGA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739431.3p                                                                                                                                                                                                                                                                                                                                   GCAAGGCTGGATTCATCCATTGAACCCAAGGTCATCACCGTTCTTGAGGAGCGTGACCCCTCCAACATTAAGTGGGAGATGCTGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACCAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTCCTTTCTGTGTTCCTAAAAATACCCTTTCCATAA
  3   1   2       bld Brn1                            IMAGE:6950702.3p                                                                                                                                                                                                                                                                                                                                       GTGATTCATCAAGTGACCCAAGTCTTCACCGTTTTTCCCGGGAGCGTGACCCCTCCCAACTTAAAGTGGGGAGATGCTGGTGCCGTGTATTGGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTGAATGGTTCCTAAAAAAAC
  3   1   2       bld Bone 5g3  in                    IMAGE:8740852.3p                                                                                                                                                                                                                                                                                                                                       TGGAGAAATGGCAAGCTGATTCATTCATGAGCAAGTCATCACCGTCTCAGGAGGCGTGACCCTCACATAGTGGGAGATGCTGGTGCGGGGTATGTGGTGGAATCTACTGAGTCTCACAACCACAGAGGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACCCTTTCTGTTTCCTAAAAAAAAACCCAATTGA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739301.3p                                                                                                                                                                                                                                                                                                                                       AGATGGCCAGGCTGATCATCAATGACCAAGTCATCACCGTTCTCCAGGAGGCGTGACCCTCCACATAGTGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTCCTAAAAAAAAAAAGTAGATA
  5   1   2       bld Brn1      in                    IMAGE:6956592.5p                                                                                                                                                                                                                                                                                                                                        GCAAGCTGATCATCAATGACTAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGGATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCCACCGTGTTGTGGGATCTTATGTGTCACATTGGCATCTAAAGGAATAAACACTTGGTCACCTGGTCAACCCCCTCCTTCTTCACTGAAAGGGGTCCAAGAA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739407.3p                                                                                                                                                                                                                                                                                                                                        CAAGGCTGATTCATTCAATGACCCAAGTTCATTCACGTTCTTGCAGGAGCGTGATCCTCCAACATTAGTGGGGAGATGCTGGTGCGTTTATGTGGTGGAATCTACTGGAGTCTCACACCACAGGAGAAGGCCTCTCTGCACTTGAAGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCATCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCCTGGTTCCTAAAAATAAACGTAAATAG
  3   1   2       bld Bone 5g3  in                    IMAGE:8740702.3p                                                                                                                                                                                                                                                                                                                                        ATGGCAAGCTGATTCATTCAATGACCAAGTCATCACCGTCTCAGGAGCGTGACCCCTCCAACATAAGTGGGGAGATGCTGTGCGTGTATTTTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCATAAAAAAAAACCAATTGTA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739303.3p                                                                                                                                                                                                                                                                                                                                         AGATTGGCCAGGCTTGATCATCATGACCCAGTCATCACGTTCTTGCAGGAGCGTGACCCTCCACATAGTGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCATCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAATCTTCGGGGA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6874662.3p                                                                                                                                                                                                                                                                                                                                          CCAAGTCCATTCCCCTTTTTTCCCAGGGAGGCGTGACCCCTTCCCACCATTAAAGTGGGGAAGATGGCTGGTGCCCGTGTATGTGGGTGGAATCTACGGGAGTCTTTCACAACCCACAGAGAGGGCCTCTCTGCACTTGAAGGGAGGTGCCAAAGCGTGTCGTTATCTCCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCAGGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCAGTCACCCCCTCTTTTCACCGAAGGGGTCCAAACTCGCCCGTCATGCCTATTCCGTAGGGAA
  3   1   2       bld Eye1 5g3  in                    IMAGE:6949569.3p                                                                                                                                                                                                                                                                                                                                           CTTCAATGGACCAAGTCATCCCCGGTTCTTCCAGGAGGCGTGACCCCTCCAAACATTAAAGGGGGGAGATGCTGGTTGCCGTGTATGTGGTGGAATCTACGGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCGGCTTG
  3   1   2       bld Bone 5g3  in                    IMAGE:8740749.3p                                                                                                                                                                                                                                                                                                                                           CAAAGCTGATTCATCAATTGACCAAGTTCATCACCGTCTTCCAGGAGGCGTGACCCTCCACATAGTGGGGAGATGCTGTGCGTGTATGTGGTGGAATCTACTGGAGTCTTCACACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGGTCACTAAAAAAACCCCAGGAGA
  3   1   2       chi Tad2      in                    IMAGE:6875388.3p                                                                                                                                                                                                                                                                                                                                            GCCCTGGGGAGGCGGTGGACTCCCCTTCTCAACCATTAAAGGTGGGGGGAGGATCGTTTGGTTCCCCGTTATATTGTGGTGGAAATTTAACGGGAGTTTTTTCCCACCCGCCGGGGAGGGGCCTTCTCTGGCACTTGCAGGGGAGGTCCCAAAGCGTGTCGTATTTTCCGCCCCTCCAGCGGATGCCCCCATGTTTGTAGTTGGCGTGACCCATGAGAAATATGAGACTTCTCTTAAAGTTGTTAGCAATGCATCTTGCACTACAAACTGTCTGGTTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACACCTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCTTGAGCTGAACGGAAAAATAACCGGCATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACCGAGGGGTCTCAGACTCGCCCTTCCATTTAATAGCACTCCACAAGTCCTTTAAATAAGGCATG
  3   1   2       bld Tad1                            IMAGE:6878041.3p                                                                                                                                                                                                                                                                                                                                             TAAGTTAATCACCTGTTCTTTCCAGGGAGGCCGTGACCCCCTTCCAAACATTAAAGTGGGGGAGATTGCTGGTGCCCGTTTATGTGGGGGGATTCTACGGGGGTTTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCTTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  3   1   2       bld Tad1 5g3  in                    IMAGE:6879782.3p                                                                                                                                                                                                                                                                                                                                              CCAGTTCTTCCCCCGTTTTTCAAGGAGGCGGGACCCCTCCCAACATTAAAGGGGGAGAATGCTGTTTCCCATTTATGGGGGGGAATTTATCGGGAGTTTTCACAACCACGGAGAAGGGCCTCTTCTCCACTTGAAAGGGAGGTGCCAAGCGTGTTGTTTATCTCCGCCCCCTCAGCAGGATGCCCCCATGTTTGTAGTGGGCGTGAACCATGAGAAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTTGCATTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTGGGCATTGTTGAGGAACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAC
  5   1   2       bld Ga18      in                      xlk117c18ex.5p                                                                                                                                                                                                                                                                                                                                              TGATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGANCAGGNTNNCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATNNTGGAATTGCCCTGAATGAAAANTTTGTNAANTGNTT
  3   1   2       bld Bone 5g3  in                    IMAGE:8739362.3p                                                                                                                                                                                                                                                                                                                                               AGCTGTATCATCAATGACCAAGTTCATCACCCGTTCTTCCAGAGGCGTGACCCTCCACATAGTGGGGAGATGCTGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTCACACCACCAGAAGAAGGCCTCTCTGCACTGAAGGGAGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGGTCCAAAAAAAACCCCGGAA
  5   1   2       bld Bone                            IMAGE:8743482.5p                                                                                                                                                                                                                                                                                                                                                ATCATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCTCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAACTTTGTGAAACTGGTTTCTGGTATGATATGATGCGCTACAGCACGTGTGTGATCTTATGTTGTCACATGCATCTAGGATAGCACTGTCACTGTCACCTCTTCCCTGAGGGTCGAGTCGCATCTGCTAGTCTG
  3   1   2       bld Bone 5g3  in                    IMAGE:8739360.3p                                                                                                                                                                                                                                                                                                                                                GCTAGAGATGCAAGCTGATTTACTCCATGATCAAGTCATCCCGTCTCCAGAGCTGAACCCTCACATAGTGGGGAGATGCTGGTGCGTTATGTGGTGGATCTACTGAGTCTCACACCACAGAGAGCCTCTCTGCACTGAGGGAGGTGCCAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTTCTGTTTTTCAAATT
  3   1   2       bld Tad2      in                    IMAGE:6873773.3p                                                                                                                                                                                                                                                                                                                                                 GTTTTTCCAAGGGGGCGTTGACCCCTTTCCAACCATTAAAGTGGGGGAGATTGCCTGGTGCCCGTTTATGTGGTTGGAATTTTACTGGAGTCTTCCACAACCACAGGAGAAGGGCCTCTCTGGCACTTGAAGGGGAGGTTCCAAGCCGTGTCGTTATCTCCCGCCCCCTCAGGCAGATGCCCCCCATGTTTGTAGTTGGCGTGACCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCNTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTTGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTTTGGA
  5   1   2       bld Spl                             IMAGE:8462800.5p                                                                                                                                                                                                                                                                                                                                                   ATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCATGGTGACACTCACTCCTCATCTTTGAGCTGATGCTGATTGCCTGATGAAACTTGTGAACTGGTTCTGTAGATATGATGCGCTACGCACGTGTGTGATCTAGTGTCACTGCACTAGGATAGCCTGTCCTGTCACTCTCTACGAGGTCGATCCCTCTGTATGTCTGT
  5   1   2       bld Ga18      in                       xlk59j09ex.5p                                                                                                                                                                                                                                                                                                                                                   ATCAATGACCAAGTCATCACCGTCTTCCAGGAGCGTGACCCCTCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGNCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGNTNTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATNNTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGNTTCCTGGTAGGTTTTNNTCCCTCTATNNNNGCCCCCCTC
  3   1   2       bld Tad1 5g3  in                    IMAGE:6877573.3p                                                                                                                                                                                                                                                                                                                                                    ACCAAGTTCATCACCGTTTTCCCAGGGAGCGTGACCCCTTCCCAACATAAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTTGGAATCTACTGGAGTCTTCACAACCACAGAGAGGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATTTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTTC
  3   1   2       chi Tad1      in                    IMAGE:6878285.3p                                                                                                                                                                                                                                                                                                                                                     GGGAGTTACGCAGAAAATATATATGCCCGGAGTGCCCCCCCTTTTTTGAGGGACGATGAAAATGGCTCCCCCCCCCAAATGGTTTTGTTAAAGCTGTGGCCGGGGTTGAATCCCCCATTGGGGGGAAATTTTATTGGGGGAAACCTCTTTTTTTAAAAAAGTGTTTTTTTGGCGCAAAATGGGTTTTCTTTGCCCACATACCAAAAACGTTTTTTGGGGTTTCCTTTCTTGGACAAAAGTTTTCTTTTCTACTGGACAAATTTTTTGGCCATGTTTTGGGGGGGAACTTCCTTGGACCAACTGTTCCCCAGGCTTTTTCACTGGCCCCCCCCCAGAAGAAACTGGTGGATGGGCCCCTTCCAGGGAAGTTTTGGGAGAAGAATGCACGGAGGTGCTGGTTCAGAACATTTTTTCCCCCCTCAACTGGGTGCGCAAAAGGCTGTTGGAAAAAGTTATCCCTGAGCTGAACGGAAAATTAACCGGAATGGCTTTCCGGTTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCTTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTCTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTCCCTTTTTGGAAANNNNNNTTTTTTTTAAGTGGGCTGTTTTATTTATTTTTGTGGGTCCATGGGGCCTTT
  3   1   2       bld Tad1 5g3  in                    IMAGE:6881194.3p                                                                                                                                                                                                                                                                                                                                                      TTTCCAGGGGAGGGGTGGACCCCTTCCCAACATTTAAGGGGGGGGGACTGCCGGGTGCCGTGTTATTGTGGTGGGAATTTACGTGGGGTTTTCCACACCCCACAGGAGAAAGGCCTCTTCTGCACTTGAAGGGGAGTTGCCAAGCGTGTCGTTATCTCCGCCCCTTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCTTGAGAAATATGAGAACTCTCTTAAAGTGTTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATC
  3   1   2       bld Tail 5g3  in                    IMAGE:8542547.3p                                                                                                                                                                                                                                                                                                                                                       CAAAGTTCAATCACCGTTCTTCCCAGGAGGCGTGACCCCTCCAACATTAAAGTGGGGAGATGCTGTGCGTGTATGTGGTTGAATCTACTGGAGTCTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATTAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCAACACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCCTGTTTCCATAAAAAAAAAACCCCA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6876635.3p                                                                                                                                                                                                                                                                                                                                                              GGTGGACCCCTTCCAACCATTAAAGTGGGGAGAATGCCTGGTTCCCGTGGTAAGGTGTGGGAATTTAACTGGGATTCTTCCCAACCACCGGAGAAAGCCCTTTTTGCCACTTGAAGGGGAGGTGCCCAAGCCGTGTCGTTTTTCTCCCGCCCCCTCCAGCAGAGCCCCCCCATTTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTTGCACTACAAACTGTCTGGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGAGACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCG
  3   1   2       bld Tad2 5g3  in                    IMAGE:6872604.3p                                                                                                                                                                                                                                                                                                                                                               TTCTTCCAGGGAGGCGTGACCCCTTCCAACATTAAGTGGGGGAGATGCTGGTTGCCGGGTATGGGGGTGGAATCTACGGGGGGTCTTCACAACCCCAGAGAAAGCCCTTTCTGCACTTGAAGGGGAGGTGCCAAGCGTGTCGTTATTTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCCG
  5   1   2       bld Lmb2      in                    IMAGE:8636289.5p                                                                                                                                                                                                                                                                                                                                                                  ATCACCGTCTTCCAGGAGCGTGACCCCTCCAATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTATGTGTCACATGGCATCTAAGAATAAGCACTTGTCACCTGTCAACCCCTCTTCCTCACTGAAGGGGTCCAGGAGTCGCCCCATC
  3   1   2       bld Thy  5g3  in                    IMAGE:8548785.3p                                                                                                                                                                                                                                                                                                                                                                          TATGATCACAGCGCTAGACGTAGTGATGCAGTATTCAGCAGTCTCCGTCTCAGGCTGACCTCACATAGTGGAGAGTGTGCGGTAGTGTGATTATGAGTCTCCACACAGAGAGGCTTTGCACTGAGGGAGTGCAGCGGTAGTTATTCCGCCCCTCAGCAGTGCCCCATGTTGTAGTGGCGTGACCATGAGAATATGAGACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCTTCCTG
  3   1   2       bld Ga18 5g3  in                       xlk55i15ex.3p                                                                                                                                                                                                                                                                                                                                                                              TNNANNAGNNNGNNCCCTCNNCATNAAGTGGGGAGATNNTGGTGCNGTGTATGTGGTGGAATCTACTGGANNCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTNCCAAGCGTGTCGTTNTCTCCGNCCCCTCAGNAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCANNNATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCAACCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCNTCCTGCTANTCTNNCA
  3   1   2       bld Tad2 5g3  in                    IMAGE:6875603.3p                                                                                                                                                                                                                                                                                                                                                                                CACCATTAAGGTGGGGGAGATGGCTGGTGCCCGTGTATGTGGGTGGAATCTATACGGGAGTTTTTCACAAACCACAGAGAAGGCCCTTTTCTGCACTTGAAGGGGAGGTGCCAAGCGGTGTCGTTATCTCCGCCCCCTTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCNTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTGTCGGC
  3   1   2       bld Eye1 5g3  in                    IMAGE:6949313.3p                                                                                                                                                                                                                                                                                                                                                                                      NTGACCCTTCCACCTTAAGTGGGGAGATGCGGGTGCCGTGTATGTGGTGGATCTACTTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTTGTCGG
  3   1   2       bld Tad2                            IMAGE:6881547.3p                                                                                                                                                                                                                                                                                                                                                                                       CCAACATTAAGTTGGGGAGATGCTGGGTCCCGGTATGTGGTGGAATTTAACTGGAGTTTTCACAACCCACAGAGAAGGGCCTTCTCTGCACTTGAAGGGAGGTGCCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACGACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAC
  3   1   2       add Thy                             IMAGE:8548892.3p                                                                                                                                                                                                                                                                                                                                                                                        TTCCCGACATTCAGTCATGCACAGAGATGGAGCATCAGAAGTGGAGGAGCGAGGCAGTCAGACATATCCGCTCACTGGCAGCAAGCGTCGAAAAGTATCCTGAGTGACGGGTAGTTGTGCTCAAGGCTGACACTCAATATGACTTCATAATATAAACCAATAAACATGTTTGTTCATTATATCATGAATAGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGTGAGTCTGGATTCAGTTAACCCTGTGACTGCTGGTGCACATTGTTGGGTATTTTAACCTTCTCTTGTCTCGTTCAGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTAACTGATATTCCTGTAGGATGGGTGATACTCCAGTTAAGTGTCCTAAGCTAATGGTACTAAACAGACCACACAATCTCTTGCTATTAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTAGGTTTTTGTTTACTTCCCTCTATAGTTGCCCCCCTCCTACAGTTCTCGTCTCTAAATTCTCCTCTCCCCCAACAGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCT
  5  -1   2       bld Te2N                            IMAGE:7202678.5p                                                                                                                                                                                                                                                                                                                                                                                           GGGACCCCTCCAACTTTAAGGGGGGGAGAGGTGGTGCCGGTAAGGGGTGAATTTAATGGGGTTTTCACACCCAAGAGAAGGCCTCTCTGCACTTGAAGGAGGTGCCAGCGTGTCGTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCNTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATTTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTTTCCACTGACTTCAATGGTGACACTCACTCCTCCATTTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATTTGATGTGTCACATGGCATTTAAGGAATAAGCACTTGTCACCTGTCAACCCCTTTTTTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       chi Tad2      in                    IMAGE:6874149.3p                                                                                                                                                                                                                                                                                                                                                                                             ATTGGCCCGTGGTAATGGGGGGGGGAAATTTTACCTGGAAGTTTTTCCCCAACCCACAGGAGGAAGGGCCCTTTTCTGCACTTGAAAGGGAGGTGCCCAAAGCGTGTTCGTTTTTTCCCGCCCCCTTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAGTACGATGACATCAAGGCCGCCATTAAGACTGCATTAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTTCCNCTTCNTCCCTTTTTTTTGTAAGACCCCCCCGCCTTCTGCGTCTCCANTCAGGGGGGGATGAGTTGTGAGTGGGGGGTGNGNNGGGGGGGGGGGGGG
  5   1   2       bld Bone                            IMAGE:8741251.5p                                                                                                                                                                                                                                                                                                                                                                                             TCCAACATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAGGGGTCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTTCTGGTGTTTCCTAAATAAAAACCATGAATG
  3   1   2       bld Tad2      in                    IMAGE:6872738.3p                                                                                                                                                                                                                                                                                                                                                                                              AAGTGGGGAGATGCTGGGTGCCCGTGTATGTGGGTGGAATCTAACTGGAGTCTTCCACAACCACAGAGAAGGGCCTCTCTGCACTGAAGGGGAGGTGCCAAAGCGTGTCGTTATCTCCGCCCCTTCAGCAGATGCCCCCCATGTTGGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCC
  3   1   2       bld Brn1                            IMAGE:6951575.3p                                                                                                                                                                                                                                                                                                                                                                                              GTGGGGGAGATGCCTGGTGCCCGTGTATGTGGGTGGGAATCTACTGGAGTCTTCCCCAACCACAGAGAAAGGCCTCTTTGCACTGGAAGGGGAGGTGCCAAGCCGTGTCGTTATCTTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTT
  5   1   2       bld Lmb2                            IMAGE:8638361.5p                                                                                                                                                                                                                                                                                                                                                                                                AATATTAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGAATCTATGTGTCACATGGCATCTAANGAATAGCACTTGTCACCTGTCACCCTCTCTCATGAAGGGTCAGAGTCGCCATCTGCTATCGTCACTGTCTGTGTCTAAATAACATGATGACTCaaaaaaaa
  3   1   2       bld Tad1 5g3  in                    IMAGE:6880398.3p                                                                                                                                                                                                                                                                                                                                                                                                   TAAAGTGGGGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCG
  3   1   2       bld Brn1 5g3  in                    IMAGE:6956667.3p                                                                                                                                                                                                                                                                                                                                                                                                      GGGAGATGCTGGTGCCCGTGTATGTGGTGGAATCTACTGGAGTCTTCCACAACCACCAGAGNAAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAGAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTATCTGGTTCCA
  5   1   2       bld Lmb2                            IMAGE:8638627.5p                                                                                                                                                                                                                                                                                                                                                                                                            GGAGATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGANNACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCNGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAGCACTTTGTCACTGTCACCCTCTCTCACTGAAGGGTCAGAGTCGCCATCTGCTAGTCGTCATGTTCTGTGTTCTATAACCTGATGAACTCaaaaaaaaaaaaaaa
  5   1   2       bld Lmb2                            IMAGE:8636612.5p                                                                                                                                                                                                                                                                                                                                                                                                                ATGCTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGGCCCCTGCAGAACCGGGCAAGTACGATGACATCAGAGCCGCCATTAAAGACTGCTCACAGGGCTCCAAGGGAAGGTAATCCT
  5   1   2       bld Skin                            IMAGE:8642031.5p                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGTGCCGTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTAGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACGGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACGTGTTGTGGATCTGATGTGTCCATGGCATCTAAGGAATAGCACTGTCACTGTCACCCCTCTCTCCTGAAGGGTCAGAGTCGCATCTGCTAGCGTCATGTTCTGGTCTAATAACCTGATGACTCaaaaaaaa
  5   1   2       bld Bone      in                    IMAGE:8740787.5p                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGTTAATTGGGGGGGTGACACTCGTATTCGAATTCGTCCCCACAGAGAAGGCCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAAGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCATCCTGCTAGTCTGTCACTGTTTTCTGTGTCTAAATAAACATGATGAACATCgaagagagaaaaagagagagagaaataaaaaaaaaataaaaaaaaaTGGCGGCCGCAAGGCTGAATATTCCTAGACGCGGGCTTCGAGCCTCTCCGCCCCTATATGTTG
  3   1   2       bld Ga18 5g3  in                      xlk129g23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                     TGNTGCNNNGTATGTGNTGGAATCTACTGNANTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTNNCAAGCGTGTCGTTATCTCCNNCCCCTCANNAGATGNCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCANNNNNCCTGCACTACAAACTGTCTGNCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCATCCTGCTANTCTNNCACTNT
  5   1   2       bld Gas8      in                    IMAGE:3517193.5p                                                                                                                                                                                                                                                                                                                                                                                                                           GTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGTGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGNGATACACACAAAACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAANACTTTGTGAAACTGGTTTTCCTGTATGATAATGAATGCNGGTTCAACCACCGTGTT
  5   1   2       bld Gas8      in                    IMAGE:3517169.5p                                                                                                                                                                                                                                                                                                                                                                                                                           GTGTATGTGGTGGAATCTACTGGAGTCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGTGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGTCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGNGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCCTGATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCNGGCTACAGCCACCCTGTTGTGGATCTATGTGTTACATGGCA
  5  -1   2       chi Lmb2                            IMAGE:8638237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGTCCATGTGTGTGAGTACTCCTGCACATAATTCAGGATATTCTGTGAAGCAGAGTCNTGAGCCAATCTTTATCATGTGGCACAAGCACGAAGTTCTCAGCAGTCTTGGAACAACGTCACTCNTGAGCTCCATGACTATACGACCCAGCGGGCAGCCGTCAGCGGCGACGTCGAAAAAGACCCTGGGTAAAGCCATAGTGCAGAACGATAATAAACAGTGCTGCCCGGGAGCGTAAATGGCTGCTTCCTGAACTCTAATCAGCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaa
  5   1   2       bld Lmb2      in                    IMAGE:8636112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGACCGACAGGGGGAATGAAATCGTTTCGAATTCGTCCCCTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAAGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaagaaaaaaGAGGCGGCGCAGG
  3   1   2       bld Ga18 5g3  in                       xlk51m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                         GNATCTACNNNNNNTCACNACCNCAGNNGAAGGCCTCTCTGNNCTTGAAGGGAGGTNCNAAGCGTGTCGTTATNNTNNNCCCCTCAGNAGATGCCCCCNNGTTTGTAGTTGGCGTGNNNNATGAGAAATATGAGANCTCTCTTAAAGTTGTTAGCANNNATCCTGCACTACAAACTGTCTGNCTCCTCTCGCAAAGNTCATCANNGACAACTTTGGCATTGTTGAGGGACTCATGACANCTGTCCATGCTTTCNCTNCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCNACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCANCCCCTCTTCTCACTGAAGGGGTCCAGAGTCNCCCATCCTGCTANTCTNNCA
  5  -1   2       bld Emb4                            IMAGE:5440114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          NTGTAGATTTTTACATACCACAAGGAAGGCTTCTTTGCACTTGTAGGGAAGTGCCAAAGCGTGTCGTTATTTCCGCCCCCTCAGCAGATGCCCCCCAAGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCCTC
  3   1   2       bld Skin      in                    IMAGE:8640351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTACTGAGTCTCACACCACAGAGAAGCCTCTCTGCACTGAAGGGAGGTGCCAAGCGTGTCGTATCTTCCGCCCCNTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCCGGTCCNANAANCCAAAAnnnnnnnnnCCGCG
  3   1   2       bld DMZ  5g3  in                         xl310i19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTCACAACCACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTC
  3   1   2       bld Tail 5g3  in                    IMAGE:8542615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACTTCACTTAATGGAGTCGTCGTTTGTGATATGATTCCAACCAGAAGCTTGCATGAGGAGTGCCAGCGTCGTATTTCGCCCCTCAGCAGATGCCAATGTTGGTAGTGGCGTGACATGAGAAATATGAGACTCTCTAAAGTGTTAGCATGCATCTGCATACAACGTCTGCTCTCTAGCAAAGGTCATCACGACACTTTGGCATGTTGAGGGACTCATGACAACAGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGCTTCTGTGTCCTAAAAAAAAACACAAAAATGC
  3   1   2       chi Em10      in                    IMAGE:7981256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAAAAAGGGGGAGGGGCCTATGGGGATTAGGGTTTAAACCAGAAGGCTTTCCTTGAGGGGTGCCAGGTTTGTTTTCCCCCTTAGGAGGCCCCATGTTTAGTTGGGGAACCCAGGAAATTTGAATTTTTTAAAGTTGTAGCAAGCATCTGCATACAAACTGTTTGGTCTCTGCAAAGGTCATCAAGGGCACTTTGGCATGTTGAGGGAATCATGACAACTGTCCATGCTTCACTTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCT
  3   1   2       bld DMZ  5g3  in                         xl283a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAGAGAAGGCCTCTCTGCACNTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTG
  3   1   2       bld Bone      in                    IMAGE:8740787.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGCTTCTGTTTCCTTAAATAAACCGAAATGCT
  3   1   2       bld Lmb2      in                    IMAGE:8636289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGAAGGCCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATTTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTGGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCTGGTCCAAAAAACCAAACNNCCCCNNNNCCCCCC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCACACACGAGAGGCTCTCTCACTGAGGGAGTGCAAGCGTGTCGTATCTCCGCCCCTCAGCAGAGCCCCCATGTTGTAGTGGCGTGACCATGAGAATATGAGACTCTCTTAAAGTTTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACGTTCTGTGTCCAAGTTAACTTACTCTTT
  3   1   2       bld Lmb2      in                    IMAGE:8636335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTCTCTGCACTGAGGGGAAGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCNTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCTGGTCCAAAAAACCAAACCC
  5   1   2       bld Lmb2                            IMAGE:8638583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTCTCTGCACTTGAAGGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAAGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGATGCNGCTACAGCCACCGTGTTGTGGATCTATGTGTCACATGCATCTAAGGAATAGCACTTTGTCACTGTCAACCCCTCTCTCACTGAAGGGGTCAGAGTCGCCACCTGCTATCTGTCCTGTTCTGTGTTCTAATTAACCTGATGAACATCaaaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk108j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGCTGNNCTTGAAGGGAGGTNNCAAGCGTGTCGTTNTCTCCGCCCCTCANNAGATGNCCCCATGTTNGTAGTTGGCGTGANCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGNAATNNATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCNTCCTGCTANTCTNTCAC
  5   1   2       bld Ga18      in                      xlk108j14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACTTGAAGGGAGGNNNCAAGNGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAANNTGGNTTCCTGGNATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGGCATCTNANGGAATNAGCNCTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCNCCCATCCTGCTAGNCTGTCACTGTTTNTGT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGAAGGGAGGTGCCAAGCGTGTCGTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTCCAAATAACCGAACTTTT
  3   1   2       bld Te2       in                    IMAGE:7390349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGGAGGTGCCAAGCGTGTCGTTATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCGGGTCCAAAAAACAGAAGATAA
  3   1   2       bld Lmb2      in                    IMAGE:8636112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGAAGGGAGGTGCAAGCGTGTCGTTATCTCGCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCTTCCTGCTTAGTCTA
  3   1   2       bld Ga18      in                       xlk59j09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANGGANNTNCNAAGCGNGTNGTTATNNCCGCCCCTCAGNAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGACTCTCTTAAAGTTGTTANNANNNATNCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGNTCATCANCGACANCTTTGGCATTGTTGAGGGACTCATGACANCTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTAGGTTTTTGTTCCCTCTATAGTTGCCCCCCTCCTACAGTTCTCGTCTCTAAATTCTCCTCTCCCCCAACAGGTATGATAATGAATNNNCNACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCNNCCTGCTANTCTNNCAC
  3   1   2       bld Lmb2 5g3  in                    IMAGE:8635141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTGCCAAGCGTGTCGTATCTCCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCNTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACGTTTCGGGTCCAAAAAACCCAAAA
  5  -1   2       bld Tbd5                            IMAGE:3579974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCCAAGGTGTCGTGATCTCCGCCCCTCAGCAGATGNCCCCATGTTTGTAGTTGGCGTGAACATGACAAATGATGAGACTCTGTTAAAGTGGGTAGGCAATGCATCCTGCACTCCAACTGGTCTGGCTCTTCTCGGCGAGGGTCATCAACGACAACTTGGCATTTGTTAAGGATTCAATGACACTGTCCATGCTTTTCACTGCAACCCAGAAGGACTGTGGATGGCCCATCAAGGAAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTCAAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaa
  5  -1   2       bld Lmb1                            IMAGE:8532607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGTGTCGTTATTTTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCGTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Lmb2 5g3  in                    IMAGE:8635520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNTTCGTTATCTAGGCCCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTGTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTTCACGTTCCCNNCCCNNTNNCCCAAAANNNCCCCT
  3   1   2       bld Lmb2      in                    IMAGE:8635703.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGATACCAATGGTTTGAATTCGTCCCCCAGGTTTGTAGTTGGCGTGAACCATGAGAATTATGAGAATTTTTTAAAATGTGTTAGGAATGCTTCCTGCAATTCCAAACTGTTTGGGTCCTTTTCGCAAAGTGCTATAACGACCACTTTGGCCATTGTGAAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCGNNTCNANAAACCCAACCnnnnnnnnTTTT
  3   1   2       bld Lmb2      in                    IMAGE:8635089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGGGGTTTTTTTTCCCCCCCTTAGCAGATCCCCCAATTTTGTAGTTGGGGGACCCCTGGAAATTTGGAACTTTTTAAAGTTGTTAGCAATGCATCCTGCAATACAAACTGTTGGGCTCCTCTCGCAAGGTCTTTCAACGACACTTTTGGCATTGTGGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATCCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCCGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTGATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCGnnnnnnnnnnnnnnAAAnnnnnnnnnnCCGG
  5   1   2       bld Tbd3                            IMAGE:3548322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAATTATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGTGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTGTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATCATGAATGCTGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTGAAGAA
  5   1   2       bld Lmb2      in                    IMAGE:8636090.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGTTACCAAATGACGAAACACGATTCGATTCGTCCCGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaataaaacaaaaG
  5   1   2       bld Brn3                            IMAGE:8537880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCGCCCCCTCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAANGAATAGCACTTGTCACCCTGTCACCCCTCTCTCACTGAAGGGGTCAGAGTCGCCATCCTGCTAGTCTGTCACTGTTCTGTGTTCCTAATAAACATGATGAACATCnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnAAGGGCGCGCAGCTGT
  3   1   2       bld Lmb2      in                    IMAGE:8635469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTATATTTCTTTCCANNATCCTATNATTNAATTGATCGGGGGGTGACCCCTGAAAATACGAGAACTCTTTAAAGTGTTGAGCAGGCATCCTGCGCTACAAACTGTATGGCTCTCTGCGAAAGGTCATCAAGGACAATTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACGCTTCGNGTCCNNNAAACCCAAAA
  3   1   2       bld Ga18 5g3  in                       xlk52a05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNNNCGCCCCCNCAGCAGATGCCCCCANNNTGNNGTNGGNNNNNACCATGAGAAATATGAGAACTCTCTNAAAGTTGTTAGCAATNNATCCTGCACTACAANCTGTCTGNCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGNCTCATGACANCTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTNTCAACCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCANCCTGCTANTNNNCNCT
  3   1   2       bld Ga12 5g3  in                         XL197d07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCTCAGCAGATGCCCCCCATGTTTGTAGTTGGCGTGANCCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCT
  3   1   2       chi Ga18                              rxlk61p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCCCTCANNAGANGCCCCNTNTTNGTAGNNGNNNNNNNATGANAATATGANANTNNNNNAAAGTTGTNANNAANTNNATCCTGCACTANAAACTGTCTGGCNNCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACANCTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATNNNCNACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCANCCCCTCTTCTCACTGAAGGGGTCCAGANTCNCCCATCCTGCTANTCTNNCACTNT
  3   1   2       bld DMZ  5g3  in                         xl309i19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGCAGATGCCCCCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTC
  5   1   2       bld Lmb2                            IMAGE:8638595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAANGAAATAGCACTTGTCACCTGTCACCCCTCTTCTCACTGAAGGGGTCAGAGTCGCCATCCTGCTATCTGTACTGTTCTGTGTTCTAATAAACATGATGAACTCaaaaaaaaaaaaaaaaaaaaGGCGCCGCAGCTGAATCCTAACGCGCTCACTCTGCTATATGTCGATACTAATCGATGAAGATCTGTGATTGACACCACTGAGCTGA
  5   1   2       bld Lmb2      in                    IMAGE:8635703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGTTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCCTAATAAACCATGATGAACATCaaaaaaaaaaaaaaaaaaaaaGGGCGGCGCANGGCTGATACTCTAGACGCGGCTGAGCTCTCGCCTAAGTGAGTCGATACGTGATCAGACTGATAGATCATGA
  5   1   2       bld Lmb2                            IMAGE:8638219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGTAGTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACATGATGAAACATCaaaaaaaaaaaaaaaaaaaaaaaGGCGGNCCGCAGGCTGAATCTCTAGACGCGCTCGAGCTCTCGCCTATGTGAGTCTATACGTGATCAGACTGATAGATCATGAG
  3   1   2       bld Lmb2 5g3  in                    IMAGE:8635901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTGAACCTATGGAGAAAATATGAGAACTCTTTTTAAAGTGGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAAGGTCATCAACGACAAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCTTCCTGCTTAGTTCTG
  5   1   2       bld Lmb2                            IMAGE:8637120.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGGCGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCTAAATAAACCATGATGAACATCaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAGGCTGATTCTCTAGACGCGCTCAGCTCTCGCTATATGATCTATACTAATCAACTGAAGATCTTGTGATTGGACACCACTGATGATGAAA
  5   1   2       bld Lmb2      in                    IMAGE:8638138.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAACATCTAATaaaaaaaaaaaaaaaaaTG
  3   1   2       bld Lmb2      in                    IMAGE:8638138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCTCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGGTCCCTAAAATAAAAACCCA
  5   1   2       bld Lmb2      in                    IMAGE:8635469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTCTGTGTCCTAAATAAACCATGATGAACATCaaaaaaaaaaaaaaaaaaaaaGGGCGCCCGCAGCTGAATCNCTAACGCGCTCAGCTCTCCCTATGTGAGCTATACTAATCGACTGAAGACATGAGAGGGACAACCACTGATCATGAAATGCTATGTGAATGGACT
  3   1   2       bld Lmb2      in                    IMAGE:8636090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTGAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCTTCCTGCTTAGTCTGC
  5   1   2       bld Te2N                            IMAGE:7767091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACCATGAGAAATATGAGAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCTAAATAAACCATGATGAACATCAACaaaaaaaaaaaaaaaaaGGGCGGCGTTAATAACTCGAGAGTGTCCC
  3   1   2       bld Tbd3 5g3  in                    IMAGE:3548400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATATGAGAACTCTTTAAAGTTGTAGCAATGCATCCTGCACTACANACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATTTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATTTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAAAAAAAA
  5   1   2       bld Lmb2                            IMAGE:8637269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCAAATAAACCATGATGAACNTCNNANAAAAANAAANAANaaaaaaaaaaaaaannnnnnnnnnnnaaaaaaaaGGCGGCGCAGGCTGATTCTCTAACGGGTCGGCTCGCCTAAGTATCTTTTCTAATCCAATGAAGAACTGTGATTGACACCACTGTGGTGAAATG
  5   1   2       bld Skin                            IMAGE:8643876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTAGGTTTTTGTTCCCTCTATAGTTGCCCCCCTCCTACAGTTCTCGTCTCTAAATTCTCCTCTCCCCCAACAGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCTGCTAGTCTGTCACTGTTCTGTGTTCTNANNTAAACATGATGAACATCaaaaaaaaaaaaaaaaaaaaGGGCGGCGCAGGCTGATTCC
  5   1   2       chi Lmb2                            IMAGE:8639157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTTGGTTTCCTGGATAGATAATTAATGCGGCTACTTTCACCGTGTTGTGCATGTTAAGTGTTACAAGTCACTATGATTAATTACTTGTTTCCTTCTAGCCCTCtttatttgatttttttatattcgtttactgctttttttcttgagttgttttctaatgtatcatttcattttttttatttatttataatttcgtctattcatctttccttaataatattagtacataatatttttttattctacctattttattatatgtatctagtagtcgatatcttattttttatcttcttcattattttATAATTC
  3   1   2       bld Emb4 5g3  in                    IMAGE:4202119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTCTCTAAAAGTGGTAGCAATGCTCCTGCACACCAACTGTCTGGCTCCTCTCGCAAAGGTCATCACCGCAAACTTGGCCATGGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCACCCAGAAAGACTGTGAATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAAAGGTGCAGGTCAGACCATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCNCATCCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAA
  5   1   2       chi Lmb2                            IMAGE:8639923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTCTTAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAATAAACCCATGATGAACTCNNNANANNAnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnANNNANNAAAAGGGGCGGGGCTGTTCTAACCGGGCGGCCCGCCTAGGGGCTATCGACCACATAAATCTGGGTTGCACCCTAATCTAAAT
  5   1   2       chi Skin                            IMAGE:8642427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTNNNCCACCATCTNNNGGGATCCCCGATTCGAATCGNCCCCTGGCTCCTCTCGCAAAGGTCATCAACGACTACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAACACGGTGGATGGCCCATCAAGGAAACTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCACCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAAAGGGCCCAATGAAGGGAATCCTGGGATACACACTAGACCAGGTTGTCTCCACTGACTTTCATGGTGACACTCACTCCTCCATCTTTGAAGCTGATGCTGGAATTGCCCTGAATGAAAACTCTGTGAAACTGGGTTTCCTGGTCTGATAATGAATGCGGCTACACCCCCCCTGTTGTGGATCTGATGTTTCACCTGGCATCTAACGAATAAACCATTGCTACTGTTCACCCCTCTTTCTCCTGAAAGAGGCCACATCCCCCATCCTGCTAATTCGTCCTGTTTCTGTGTCCTACATAAACCAGCCTGATCCTCCTTATCTTTTAATCCGCTTCACCTACCATACTTAAATACCTTTATAAATAAAAAAAGAGGGGGCGCCGGGCTATTTTCTAACGAGCTCAGCCTCCCCTTCTGAGCTTAATTCTTTCAACAAAAAACTTATCTTTGAAAACCACCTTGCTGAAAAGtttttttttA
  3   1   2       bld DMZ  5g3  in                         xl274p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCAT
  3   1   2       bld Ga12 5g3  in                         XL176d23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAAAGTTGTTAGCAATGCATCTTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCNTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTG
  5   1   2       bld Lmb2                            IMAGE:8639410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTCCATTCTTGCGGTCCATCGATTCAATTCCCCCCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld Neu7 5g3  in                         XL012m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAA
  3   1   2       bld Ga12 5g3  in                         XL144a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTAGCAATGCATCNTGCACTACAAACTTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTG
  3   1   2       bld Ga12                                 XL202a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTAGCAATGCATCTTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCANNGNCAACTTTGGCATTGTTGAGGGACTCATNACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGNNGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACAGAAGGGGTCCAGAGTCGCCCATCCTGC
  3   1   2       bld Ov1  5g3  in                    IMAGE:8329111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATGCATCNTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAAAAAAAAAG
  3   1   2       bld Emb4 5g3  in                    IMAGE:4201878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAGGGTCATCACGACCACCTTGGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAACGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGGTCTCCCCTGAATTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCCTGCTAGTCTTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8329445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGTTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAAAAAAAAAG
  3   1   2       bld Ga15      in                       XL513b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGANTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGC
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCTGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAAAAAAAAAG
  5   1   2       bld Lmb2      in                    IMAGE:8636198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAAGTATTAAGGGGGGTaaaaaaaaaaTCGAATTCGTCCCCGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaTGG
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3201224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCGCTACATACGGTCTGGCTCTTCTAGCAAAGGTCATCAACGACAACTTTGGCATTGTAGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCAAAAAATGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCAAAAAAAA
  5   1   2       bld Lmb2      in                    IMAGE:8635904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCATTTTTATGACGGCTTCAAATCGTTTCGATTCGTCCCGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCACaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Lmb2                            IMAGE:8639428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCNNANANNaaaannaaaannaaaaaaaaaaaGGGCGGCCGCAAGGCCTGAT
  5   1   2       bld Lmb2                            IMAGE:8638285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaaaaGGCGGCCCGCAGG
  5   1   2       bld Lmb2                            IMAGE:8639475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCC