Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 29 Nov 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8548867.5                     271 PI      89          3     1178                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012767120 Xl3.1-IMAGE:8740761.3 - 630 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                           50    79   199   221   268   288   323   338   334   341   346   353   349   357   353   359   353   360   360   364   357   366   357   367   362   370   365   375   364   383   368   394   367   401   365   410   363   422   364   431   369   447   375   464   374   469   370   469   366   472   374   479   377   483   386   487   387   488   382   491   378   495   392   500   389   505   393   508   389   510   424   517   427   516   433   520   443   525   437   521   440   528   431   532   484   539   488   546   481   554   482   557   493   558   481   555   481   550   471   544   461   549   463   552   327   551   406   546   349   549   367   552   354   551   332   548   330   546   321   539   312   527   285   514   287   503   283   489   263   477   259   463   255   454   256   441   256   431   256   417   255   402   255   389   251   367   247   355   248   337   249   309   247   294   242   281   239   271   244   268   241   264   235   261   235   261   218   260   220   256   214   255   218   255   206   247   209   246   207   245   201   244   200   242   168   215   113   171    75   154    64   131    61    92    28    53    11    36
                                                                   SNP                                                                                                               -----------T
                                                                   SNP                                                                                                                                                                                                                           ------GT----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------G---
                                               BLH ATG     111    2135                                                                                       
                                               BLH MIN     111     219                                                                                       
                                               BLH MPR     105     219                                                                                       
                                               BLH OVR     111     109                                                                                       
                                               CDS MIN     111      72                                                                                       
                                               EST CLI      65      72                                                                                       
                                               ORF LNG     111       9                                                                                       
  5   1   2       bld Brn1                            IMAGE:4740371.5p                                                                                                                                                  GAAGGTTGGAATTAACGGATTTGGCCGTATTGGGCGCCTGGTGACCCGTGCTGCCTTTGATAGCGGCAAAGTTTAAGTCACTGCTATCAATGACCCCTTCATCGACTTGCACTCCATGGTC
  5   1   2       chi Lmb2                            IMAGE:8639157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTCTTAAAGTTGTTAGCAATGCATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTTGGTTTCCTGGATAGATAATTAATGCGGCTACTTTCACCGTGTTGTGCATGTTAAGTGTTACAAGTCACTATGATTAATTACTTGTTTCCTTCTAGCCCTCtttatttgatttttttatattcgtttactgctttttttcttgagttgttttctaatgtatcatttcattttttttatttatttataatttcgtctattcatctttccttaataatattagtacataatatttttttattctacctattttattatatgtatctagtagtcgatatcttattttttatcttcttcattattttATAATTC
  3   1   2       bld Ga12 5g3  in                         XL144a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTAGCAATGCATCNTGCACTACAAACTTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGCAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTG
  3   1   2       bld Ga12                                 XL202a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTAGCAATGCATCTTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCANNGNCAACTTTGGCATTGTTGAGGGACTCATNACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGNNGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACAGAAGGGGTCCAGAGTCGCCCATCCTGC
  3   1   2       bld Ga15      in                       XL513b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCTGCACTACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGANTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGC
  5   1   2       bld Lmb2      in                    IMAGE:8636198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAAGTATTAAGGGGGGTaaaaaaaaaaTCGAATTCGTCCCCGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaTGG
  5   1   2       bld Lmb2      in                    IMAGE:8635904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCATTTTTATGACGGCTTCAAATCGTTTCGATTCGTCCCGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAAACCATGATGAAACATCACaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Lmb2                            IMAGE:8638285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCCAGAAGACTGTGGATGGCCCATCAGGGAAGCTGTGGAGAGATGGCAGAGGTGCAGGTCAGAACATTATTCCCGCCTCAACTGGTGCAGCAAAGGCTGTCGGAAAAGTTATCCCTGAGCTGAACGGAAAAATAACCGGAATGGCTTTCCGTGTCCCCACCCCAAATGTGTCCGTCGTGGATCTGACCTGCCGCCTGCAGAAGCCGGCCAAGTACGATGACATCAAGGCCGCCATTAAGACTGCATCAGAGGGCCCAATGAAGGGAATCCTGGGATACACACAAGACCAGGTTGTCTCCACTGACTTCAATGGTGACACTCACTCCTCCATCTTTGATGCTGATGCTGGAATTGCCCTGAATGAAAACTTTGTGAAACTGGTTTCCTGGTATGATAATGAATGCGGCTACAGCCACCGTGTTGTGGATCTTATGTGTCACATGGCATCTAAGGAATAAGCACTTGTCACCTGTCAACCCCTCTTCTCACTGAAGGGGTCCAGAGTCGCCCATCCTGCTAGTCTGTCACTGTTTCTGTGTTCCTAAATAAACCATGATGAAACATCaaaaaaaaaaaaaaaaaaaaaaaGGCGGCCCGCAGG
  5   1   2       bld Lmb2                            IMAGE:8639475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAAACTGTCTGGCTCCTCTCGCAAAGGTCATCAACGACAACTTTGGCATTGTTGAGGGACTCATGACAACTGTCCATGCTTTCACTGCCACCC