Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL405f19ex.5                        156 END     2           0        1                (no blast hit)
     2   2.0    0Xl3.1-xl286c09.3                           39 END     2           0        5                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL482p21ex.5                        123 PI      79        271      817                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7765642.5                      35 PI      79        272      810                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8319714.5                      15 PI      75        272      649                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012767134 Xl3.1-IMAGE:7299545.5 - 492 ESTs
                                                                       ......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7299545.5                                                                                                                                                                                                                                                                 CGTCGCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAACCTGTAATCAACATGGCAGGAGTGGTGTTAATGTCACAGGGCTCCTTTTTATTTTATTTTTTTTAAATTGTTTTTCCTTCCCAGTGTACAGAGTTAAAAGCTGCTCTACTTAAACCGTATAAGCTTTCAAGAAGTCATTTATCCCACTGAGCCCCCTGCTCCCTAATTTGATGAACGCACTAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGGCAGCCGTTTTTATACAAGTCTTGAATATGGCGGCAGTAGTCAACGAGCTGATTAAAATTAAAAAATAAAAAAAAATGTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCACTGTCCTGCGGGAGTTGTCCAATACCTACGTGGGAAGAGCGACTATTGAGCGTAACTGTTAATACTGCTGCGTGTTAGAGGGTAAAACTTACTGTTTGCTGGAATGGTCTGCGACAGAATGCTTTGCAATGCATTTTAAACCCTTTTGTAGCAAAAGGGGTTAATTACTTCGGGTACACTGACTTGTTTTAATTTTTTTTTGTGGCATTGGTAAATAAAAATTTCTAGAACTGTCTTGTCACACTGACTTTGTGTAGAGAAATGGTGGGTGGGGGGGTTATTATTGTGCCTTTTGGCAGGAGACCTGGGGTTTTCCGGATAAGGGATGTTTCCATAACTTGGATCTTCATACCTTTAAAGGGGCGGTTAACTAAGTATGTTATAGAATGGCCAATTCTAAGCAACCTTTCAATTGGCCT
                                                  Xl3.1-CHK-1012684998                                                                                                                                                                                                                                                                       CATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAAxxxxTxATCAACATGGCAGGAGTGGTGTTAATGTCACAGGGCTCCTTTTTATTTTATTTTTTTTAAATTGTTTTTCCTTCCCAGTGTACAGAGTTAAAAGCTGCTCTACTTAAACCGTATAAGCTTTCAAGAAGTCATTTATCCCACTGAGCCCCCTGCTCCCTAATTTGATGAACGCACTAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGGCAGCCGTTTTTATACAAGTCTTGAATATGGCGGCAGTAGTCAACGAGCTGATTAAAATTAAAAAATAAAAAAAAATGTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCACTGTCCTGCGGGAGTTGTCCAATxxCxxxxxxGGxAGAGCGxxxxTxGAGCGTxAxxxxTAATACxxxxxxGTGTTAGAGGGTAAAACTTACTGTTxxxxGGAATGGTCTGCGACAGAATGCTTTGCAATGCATTTTAAACCCTTTTGTAGCAAAAGGGGTTAATTAxxTxxGGTACACTGACTTGTTTTAATTTTTTTTTGTGGCATTGGTAAATAAAAATTTCTAGAACTGTCTTGTCACACTGACTTTGTGTAGAGAAATGGTGGGTGGGGGGGTTATTATTGTGCCTTTTGGCAGGAGACCTGGGGTTTTCCGGATAAGGGATGTTTCCATAACTTGGATCTTCATACCTTTAAAGGGGCGGTTAACTAAGTATGTTATAGAATGGCCAATTCTAAGCAACCTTTCAAT
                                                      consensus depths                                                                                                                                                                                                                                                                      4    10     7    12     8    15     8    19    10    23    10    25    13    31    14    35    28    55    34    72    39    84    54   119    57   124    60   133    67   152    78   165    82   174    86   183    86   185    91   193   103   199   101   208   161   220   202   227   210   231   214   237   215   238   216   239   221   240   221   244   223   244   223   244   225   246   230   249   229   249   231   252   227   253   226   255   229   258   229   262   228   264   238   266   242   270   239   272   238   271   238   269   237   272   231   270   230   270   230   267   232   265   232   267   234   269   239   272   229   271   233   268   232   270   209   270   227   266   227   263   209   256   204   258   205   258   201   254   198   253   191   250   185   244   157   235   156   222   143   215   141   203   139   196   132   194   109   189   108   188    98   180    89   173    82   167    80   164    77   154    73   152    75   151    71   144    57   120    39   105    33    86    30    81    47    77    24    67    24    67    25    64    29    68    37    69    39    68    40    68    40    66    42    69    46    70    45    70    44    70    43    72    48    72    48    73    50    74    51    75    56    78    55    78    54    76    53    78    53    79    57    80    58    80    56    77    56    80    55    80    57    80    54    80    61    84    63    89    62    91    62    90    62    92    64    92    64    93    61    95    61    93    59    93    59    92    59    92    55    92    41    81    42    74    39    69    37    68    31    59    29    60    30    61    31    62    31    62    32    66    31    66    31    67    32    68    32    70    32    70    34    74    35    74    35    74    34    75    34    75    25    78    27    80    30    81    33    83    34    86    31    79    43    70    46    71    47    71    51    69    54    65    56    65    59    67    56    67    58    67    60    68    64    70    66    71    66    71    61    72    62    71    65    71    60    70    58    70    62    68    60    69    60    68    58    67    57    67    58    65    50    63    30    62    28    60    27    60    27    60    28    60    28    59    28    59    23    59    24    58    23    58    24    58    23    58    20    54    19    47    18    43    25    36    16    32    16    29     9    23     4    14     4    10     4    10     4    10     3    10     5    10     5    10     4    10     5    10     4    10     3     9     4     9     3     9     4     9     3     8
                                                                   VAR                                                                                                                                                                                                                                                                                                     TGGCTGCTTCTTTCCGCCTCGCCTATATTGTGACCGCGCACGCATCCTTACCGTGCCCGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                 GCTTGAGCCGGGCGGTTCTTACGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                         TGGAAGGAGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                     GAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATAATATAGAATGGCTGTCTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTGCTGATTCTTTTTCAGCTTGCAAATGGGGGTCACTGACCCCATCTAAAACTAATGCTCTCTAAGGCTACAAATGTATTGTTATTGCTACTTTTTATTACTCCTTTTTCTATTCAGGCCTCTCCTATTCATATTCAAGTATCTGTATCCATGTCAATGCATGGTTGCTAGGGAAATTTGGACCTTAGCAACCATAATGCTGAAATTCCAAACTGGAGAGCTGCTGAATAAAAAGCTAAAACAACTGAAAAACCACAAATAGAAAATGAAAGCCAATTGCAAATTGTTTCAGAATATCACTCTCTACTCATACTAAGTTATCTCAAAGGTGAACAACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGACTTGTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCATTGGTTAATAAAAATTTCTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTGTCCAATG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T--G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G-----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A--------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----A-----T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G--
                                               BLH ATG     271     804                                                                                                                                                                                                                                                                 
                                               BLH MIN     271     138                                                                                                                                                                                                                                                                 
                                               BLH MPR     271     138                                                                                                                                                                                                                                                                 
                                               BLH OVR     271      71                                                                                                                                                                                                                                                                 
                                               CDS MIN     271     138                                                                                                                                                                                                                                                                 
                                               EST CLI     103      31                                                                                                                                                                                                                                                                 
                                               ORF LNG     271       2                                                                                                                                                                                                                                                                 
  5  -1   2      seed Bla2                            IMAGE:7299545.5p NGGGGGGGAAGAATATTTCCCCGCCCCTTTTTGGGTGGGGGAGGGAATTCCCGAAACTTGCTTTCCGAGAAATATCTATAGAAAAAGTGGGTCCGGGTGGGGCTTAAATAGATTCCCGGGGCGATTTCTTGGGGAGGAAAGGCGTTTTTTCTCCAACCCTGAgggggggaaaacttggatttttgggggttggggCCAGCTTTGTCCCCCNCCAATTGCCGGTAGGGCATTGCGCGCCTCTCTTTTAAAGGTTTTTCAGCCGCGGTTTGGGAAGTGCCATCTTAGCGGTGTGGGGTGCTGGTGTTTTTTCCGCTTCGCTAAGTTGTGACGGCAGGATCCTTGCGTGCCCGAGCTGAGCCGGGCGTTTTTACGCTGGAGGAGCTGGAGTCAGTGGAAACAATAACCACCGCCGCCCGTGGGGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCTAAGAGC
  5   1   2       bld Emb9 5g                         IMAGE:7977108.5p                                                                 ACTTCGGGGTGAGATGTAAGTCGCTTTATTTCTCCTCCCCTAACCTTGTGAGCTGGTGGGAATTAACATTGTGATCGTATTCGTGTGTGCTCGAGCGCCAAGCCTTTGCTGCCCCACCCAAATTTGCCTGGTAGTGCGCATGTGCGCTGCCTCCTCTTTCTAAGTGTTATTCTCATGCCCGCGCTCTGGTGACGTCGCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGGACCCCGGAGGTGAAACATTTTCTGCCCCAA
  5  -1   2       chi Emb1                            IMAGE:6635147.5p                                                                  CTAGTAGTNAATAAGGTGGTGCTGGACAGGGTCACCGCAGCGTAGACACTCGCGGGCAGATTGGTCAACTGGATAGGCTACGGATTTCGAGGCGGGCGCGGNGTGAGTGGNGACGCTATCCGGAGNGTTGTGAGGACAGAGGACCCCCCACATTGCATACGGGGAGTGCGGATATACAGAATGTAATGTAAGGAGGAGGGTTGGAATGACACATTATTTGAGACACGTTATACACTGGTGTTCATTGAGGAGCTACGGTGCGTGCACGCTCTGTAGGAGGACAAATGTGAGAAACCGCCCCGTGTGTTGTTATAGACCTCTTAGAATGAGTAATAGTGATGAGAGGGGTGAGGGGATAGTAGAATTAGATGGAGATTGGTGAGGTNTTATATGAATAGTNAATAGAGATTCACCCTCAGGTGTTGTTGTATGATGAGATGTGGGAACCCCGTGAGTCCCGATTGAACACAGAGAGGAGAATCCCCAAGAAGATGTGTTTAATGTTATATAGTGGGTGTGTGGCATGAGAAGGGGTGGTGTGGGCGCGCAATGCCACGGTGTAGGGATGGTCATGATTTTGTGAATTGGTGATATATTTGTATTGGAACTGTGAGAGTGTAGTGAGCCCCGGAAGAGTGTAGGTGGTAGAATTTGGGATATGAGTGAAGTAAGATTGAGGGATGGGTGGCCGTTAGGGTGGTATGAGGGTATGAAGGAGGTGGGTAGAGAGACCTATTGGGTGGGGGTACCCCGTGACCTTGAAGGGAAAGAATGGTTGAACCTGGAGGAAGTAGGCGAGTTTAGAGGAGATGTCGGTGTTTTGATTGTGAGGTGTTTTGTAGGGAGGCCTATCGGTAAGGGGTTCAGGAGTCGTGGGACGGGGCGAGGAATGTCGGGGCATGATCAGATCGTTTGTCAGCGTATTGTTACATGGAATGGTGCGCAAAAAGGAAAGATGGGGTGAGGGAAGTGTTTCAGATGGTTACAGGGCCAGGCATGCAAGTCAGGAGTGGTAACAAGAAAAACACGTGCCTTGTCATATCCGTGAGAAACATGCGGTATCGCGCACACACACACCCTGTTCTCATTGCGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGANTTTATaaaaaaaaaacccacgcgtccgcccacgcgtccg
  5   1   2       bld Ooc2      in                    IMAGE:3747289.5p                                                                                               TCCCCTAACCTTGTGAGCTGGTGGGAATTAACATTGTGATCGTATTCGTGTGTGCTCGAGCGCCAAGNCCTTTGCTCGCCCCACCACAACATTTGCCTGGTAGTGCGCATGTGNCGCTGCCTCCTCTTTCTAAGTGTTATTCTCATGCCCGCGCTCTGGTGACGTCGCCATCCTTAGTAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGG
  5   1   2       bld DMZ  5g3  in                         xl236f15.5p                                                                                                                                                           ATTTCTCCTCCCCTAACCTTGTGAGCTGGTGGGAATTAACATTGTGATCGTATTCGTGTGTGCTCGAGCGCCAAGCCTTTGCTGCCCCACCCAAATTTGCCTGGTAGTGCGCATGTGCGCTGCCTCCTCTTTCTAAGTGTTATTCTCATGCCTGCGCTCTGGTGACGTCGCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATT
  5   1   2       chi DMZ       in                         xl226o05.5p                                                                                                                                                                                                   GGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGATGTCGGCCGGAAAAATCGTAAGATGTACGATCATTCGAATCCCACTAACCGCACGATAATTTCGAAGGATTGGTCGGACTTCCCTAAAATCGGTCGTTCGGCAAGAAGAATCGTCACGTCTATGGGGAGTTCAAAAGGCAGATGTTTTCACCCCTTTAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAAC
  3  -1   2       bld Ga11                            IMAGE:3474797.3p                                                                                                                                                                                                    ATCCAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCATCTCCAATTACCCGGGTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAATCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAA
  5   1   2       bld Ov1  5g                         IMAGE:8330034.5p                                                                                                                                                                                                                                                CATGCCCGCGCTGGTGACGTCGCCATTCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGTCGT
  5   1   2       bld Ga18 5g3  in                      xlk159k13ex.5p                                                                                                                                                                                                                                                 CATGCCCGCGCTCTGGTGACGTCGCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGNCTACGTTGTGCACGCGCNCNNTCCTTGCCGTNNCCGAGCTTGAGCCGGNGNNTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGGNANNNNNGTCTCTACAAGAATCTTAAAGCGGCTCANCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGNNNACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGNNNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGNTGGAAACAAGAAGNATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGNGACATGGCAAACCGTATCTNCGCCTACGNTACATGGAATGCTCTNNAAAAACGAAAGATGGCGTGAGGNAANNGTTTGAGCTGGCTACACGNNNNG
  5   1   2       chi Oo1                             IMAGE:6639807.5p                                                                                                                                                                                                                                                         GCTGGTGACGTCGCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTANAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGAANAACCTGCCTTCTGATTNNGTGTCAGTAAGACCAGTTTTCAGAAGTGTATGTCCCCACAGGTTTTGAGAACTATGTGGCAGAACATAGAAGTGGATGGCAAGCAGGGTTGAGTTTGGCCCTATGGGGATACAGCTTGGCCAAGAAAGATTATGGACCGGACTGCCAACCCTCTGGGCCTATTCCCGAAACCCTGGATGGTAATATTTAAAGGGGGCTTTTTCCAATGGATAAGGCCCCCGAACAGGTTTaaaaaaaaccattaccctgggaaaaaattggcccccccggaaggggggaaaaaacttttttttgggccccccaagggggggcccacttttatttttttAAAGTGGGGGAAAAAACAAGAAAAAGGGGATTCTTGGCGCGTTTATTGGTGTGGGAACCACCCCCCCTCCGGAAgggggggggcttcccccccccaaaaatgtggaaaccggggggcccccctggggggaaacccccacaaaaaaaaaaGGGGTCTTGGGGAAATTGTGTGTGGAAAACACCCGGTTTTTTCTTTccccccccTCCTAGGGGTTTTATATTGGGGGAAAAGGGTCTTTCCTCCCaaaaaaaacaccaaaaaaaaaatggcgcttttgagggaagaaaaaaaattttttttaaaaaGTGGTGGGATAAACACACGGGGGGGACCCCCCTCCCCT
  5   1   2       bld DMZ  5g3  in                         xl237p09.5p                                                                                                                                                                                                                                                                     GCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACATGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCAC
  5   1   2       bld Oo1  5g                         IMAGE:5084211.5p                                                                                                                                                                                                                                                                           CTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGGAACAGGAGCCTGTGAAGCCCCGAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAAATGCTCTGCCAAAAACGAAAGATGGCGTTGAGGGGAAATGTTTTGAGCTGGGCTACACGGGGCAGCCCCTGCAAAGCTAAGGCGTGGGCAAGGAAGAAAAACCT
  5   1   2       bld Ga12 5g3  in                         XL160g24.5p                                                                                                                                                                                                                                                                                    AGTAGTGTGTTTGCTGCTGGCTGCTTCTTTCCGCCTCGCCTATATTGTGACCGCGCACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCC
  5   1   2       bld Lu1  5g                         IMAGE:4056433.5p                                                                                                                                                                                                                                                                                      TGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGGGGAGTGTGCTTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGGAAGCAGGTTGAGTTGGCCCTATAGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTGTGTGCTATCCAGACACTGATGTTATGTTAATGTGCTTTCCATTGATAGCCGGACAGTGTAAAGAGGTACGTGGTAAATGGACGACTGGAGTGAACATTACTTGC
  5   1   2       bld Egg3 5g                         IMAGE:6870608.5p                                                                                                                                                                                                                                                                                      TCCCGGGGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGGAAGATGGCGTGAGGGGAAGTGTTTTGAGCTGGCTACACGGGGCAGCCCCTGCAAGGCTTAGGGCGTGGCAAGAAAGAAAAACCACCGTGCCCTTCCTCGATCTAAACAGAAGAAAACATGCCCGGTATTTGGCACCACCACACCAA
  5   1   2       bld Ga18 5g3  in                       xlk55k02ex.5p                                                                                                                                                                                                                                                                                            TTGGGTGCTGGCTGCTTCTCTCCGCCTCGNCTACGTTGTGCACGCGCNNCNTCCTTGCCNNNNNGAGCTTGAGCCGGNNNNCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGGNANNNNNGTCTCTACAAGAATCTTAAAGCGGCTCANNGTGAGANATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGNGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGNTGGNAACAAGAAGGNTCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGNGCCTGTGAAGCCCGAAGAA
  5   1   2       bld Oo1  5g                IMAGE:3403975-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                 CTGCTGGCTGCTTCTTTCCGCCTCGCCTATATTGTGACCGCGCACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCCTTTCCATTGATA
  5   1   2       bld Ga12 5g                              XL144f19.5p                                                                                                                                                                                                                                                                                                   GCTGGCTGCTTCTTTCCGCCTCGCCTATATTGTGACCGCGCACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGG
  5   1   2       bld Ga12 5g3  in                         XL217a14.5p                                                                                                                                                                                                                                                                                                    CTGGCTGCTTCTTTCCGCCTCGCCTATATTGTGACCGCGCACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCA
  5   1   2       bld Oo1  5x3                        IMAGE:6637565.5p                                                                                                                                                                                                                                                                                                        TGGACCGGTCCGGAATTCTCCGGATTGTGACCGCGCACGCATCCTTATCGCGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGGAAGTGTTTGAGCTGGCTACACGGGCCGCCCTGCAAGCCCAGGCGTGGGAAAGAAGAAAAAACACGGGGCCTTCTCCATCTAACTGAGGAAACCTGCCCGTATTTGCGCACACACACCAACCTGGTCCTCCCTTGGGGGGATCGGGGAGCCAACGGGGCAGCAAAGGGGTGAAGCCCCACGGGCGAAACCGTACCGTCCCCAGAAAAATCCC
  5   1   2       bld Ga10 5g3  in                    IMAGE:3558141.5p                                                                                                                                                                                                                                                                                                          CTCCGCCTCGCCTACGTTGTGTTCGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAAAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACAC
  5   1   2       bld Int2 5g                         IMAGE:8528752.5p                                                                                                                                                                                                                                                                                                           TCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTCCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGTCGTGACATGGCAAACGTATCTCCGCTACNGCTACTGAATGCTCTGCAAAACAAAGATGCGTGAGGAAGTGTTGAGCTGCTACCGGCAGCCTGCAGCTAGCGTGCAGAAGAAACACTGCTCTCTCTACGAGACTGCGATGCCACCCACTATCAT
  5   1   2       bld Ov1  5x3                        IMAGE:6318467.5p                                                                                                                                                                                                                                                                                                            TCATGCCCGCGCTCTGGTGACGTCGCCATCCTTAGCAGTGTGTTGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGGCAGCCCTGCAAGCTAGGCGTGGGCAAGAAGAAAACCACGTGCCTTTCTCATCNTANCAGAGAAACATGCCGGTATTGCACACCACACAAACCTAATTTCCCCATACTCCTCTG
  5   1   2       bld Egg3 5x3                        IMAGE:6326393.5p                                                                                                                                                                                                                                                                                                                   ATTGGATCGATTCCCCGGGCATCCTTAGCAGTGCGTTGGGTGCTGGCTGCTTCTCTCCGTCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCCTCTGGNGGCACTGNGGAGTGCAGCAAGGGGTGAAAGCCCACGGGCAAAAACGTACAGAGTCACAGAAA
  5   1   2       bld Emb1 5x3                        IMAGE:6636615.5p                                                                                                                                                                                                                                                                                                                         GCCTATATTGTGACCGCGCACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAACACGTGCCTTCTCCTCTAACTGAGAAACATGCCGTATTGCGCACACACACAAACTGGTCTCATTGGGGGGATCGGGAGCCACCGGGCACCCAGGGTGAAACCCCACGGCGAAACCTAACAGTTCCC
  5   1   2       chi Emb4                            IMAGE:5537075.5p                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCACTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCCATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGGAATGATGAACACCCTCGCAGGGGAGCTCACCCAAATGAAACAGGAGCCTGTGGAAGCCTGAAAAAAGGCGTGACCTGGGCAAACCCGTATTCTCAGCCCTATGGCTACATGGAAATGCCTCCTGcaaaaccaaaaaaatgggggggaagggaaaaTGGTTTGAACCTGGGCTACCCGGGGCAGCCCCTGCAAAGCCACggggggggggAAAGAAAAC
  5   1   2       bld Ga12 5g                              XL194m22.5p                                                                                                                                                                                                                                                                                                                                 CGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAA
  5   1   2       bld Oo1  5g                         IMAGE:5079918.5p                                                                                                                                                                                                                                                                                                                                  GCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTGTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGAGAGGTTAGAAAACATACTTGGAGAAATGCGACCCCGGAGTGAAACATTTCTGCCCCAAGGTGCCCCATTATTTTAGTTTGGAAACAAGAGGGATCTGCGTTAATGATGAAACGCCCTCGTAAGGGGCCTCACCCAAAATGAAACAGGAGCCCTGTGAAAGCCTGGAAAAAAGGTCGTGAAAATGGCAAAACCGTATCTTCCGCCTACGGGTTACCTTGGAAATGCTCTGCAAAAAACAATAAAATTGGCGTGGAGGAAAATGGTTTGAATCTGGCTTACCGGGGGCAGCCCCTGGAAACTTAAGGGGTGGGCAAGAAAGAAAAACCACGGGGCCTTCCTCCTTTTTAACCGGAGAAAAACTTGGCCGTATTGGCCACACACCCCCAACCCTAATTCCCCCATACTTCCCTCTTGGGNGCCACTGGGGAAAATGCCAANCAAGGGGGTGGAAAccccccccGGCAAAAAAAGTTTAACGGTCCCC
  5   1   2       bld Em10 5g                         IMAGE:8322308.5p                                                                                                                                                                                                                                                                                                                                  GTGACCGCGCACGCATCCTTACCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAA
  5   1   2       chi Spl                             IMAGE:8464469.5p                                                                                                                                                                                                                                                                                                                                  CTGTTCCGTGTCAGAACGAGCTTGACTGACGTTACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGATGGTGTCAGGGACATAATAAAAGTTAAATTAAAGGCGAACCATCCCTTTAAAGCCCTTGGCTGCTTGAAAACTACCTTAGGAGCAGCCAGTAGAAGGCACAATCTTTGGTCCAGACCAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCACATGGAGCTCACCAAAATGAAACAGGAGCCTGTTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCACCCTATGGCTACATGGAATGCTCCTGCAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAACTGGCTACCTGGCAGCCCTGCAGCTAGCGTGGGAAAAA
  5   1   2       bld Neu7 5g3  in                         XL039f14.5p                                                                                                                                                                                                                                                                                                                                       CGCATCCTTGCCGTGCCCGANCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGG
  5   1   2       bld Te1  5g                         IMAGE:6928899.5p                                                                                                                                                                                                                                                                                                                                             GGGGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGACGCAACGCATGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCATACATAGAAGTGGATGGCAAGCAAGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGACCACATACCTGAGAAATGGACCCTCGGAAGTGAGACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGTAACTAGAATCGATCTGCGTAATGATGAACACACTCGTAAGGGAGCTCAACATAATGAAACATGAGCCTGCTGAACCCAGCAATAAGGTCGTCGACATGGCAAACCGGTATCATTCGCCTTACTGGCTAAATGGGAAATGCTCTGGCAAAAATCAAAAANAATCGCCCTTTCAGGGGAATGTGGTTTTGAAGCCTGG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057927.5p                                                                                                                                                                                                                                                                                                                                               GACGCGTGGGCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAANCGCCGCCCGTGAGAGGGANCGGAAATCACGCCGCTGTATANCCGTGTCAGAACGAGCNTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATNCAGACACTGATGTTATATTAATGTGCCTTTTCATTGATTGCCCTGACAGTTTAGAAAACATACCTGAGAAATTGGACCCC
  5   1   2       bld Egg3 5x3                        IMAGE:6324129.5p                                                                                                                                                                                                                                                                                                                                               GATTCCCCGGGGTGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCCGTATTGCACACACACAACCCTATTCCCATACTCCTCTGGGGCACTGGGGAGTGCAGCAAGGGGTGAAGCCCACGGCAAAACGTACAGTCCCAGGAAAAAAATCT
  5   1   2       bld Neu7 5g3  in                         XL027i13.5p                                                                                                                                                                                                                                                                                                                                                 CCTATATTGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTNCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTAT
  5   1   2       bld DMZ  5g3  in                         xl243p14.5p                                                                                                                                                                                                                                                                                                                                                      CCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTG
  5   1   2       bld DMZ  5g3  in                         xl323f05.5p                                                                                                                                                                                                                                                                                                                                                      CCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAG
  5   1   2       bld DMZ  5g3  in                         xl302k19.5p                                                                                                                                                                                                                                                                                                                                                      CCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCA
  5   1   2       bld DMZ  5g3  in                         xl291j12.5p                                                                                                                                                                                                                                                                                                                                                      CCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCC
  5   1   2       bld DMZ  5g3  in                         xl245a05.5p                                                                                                                                                                                                                                                                                                                                                      CCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGC
  5   1   2       bld Egg1 5g                            PBX0064G10.5p                                                                                                                                                                                                                                                                                                                                                       ACGAGGCTGGCTGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174488.5p                                                                                                                                                                                                                                                                                                                                                       CCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGAC
  5   1   2       bld DMZ  5g                              xl222o22.5p                                                                                                                                                                                                                                                                                                                                                       CCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTANGCG
  5   1   2       bld DMZ  5g                              xl299j07.5p                                                                                                                                                                                                                                                                                                                                                       CCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTANAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAANAANGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCA
  5   1   2       bld Oo1  5g3  in                    IMAGE:5077999.5p                                                                                                                                                                                                                                                                                                                                                        CGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTT
  5   1   2       bld FaB  5g                         IMAGE:8074055.5p                                                                                                                                                                                                                                                                                                                                                        CGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACAAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCCTGCAGCTAGGCGTGGCAAGAAGA
  5   1   2       bld Te2  5g3  in                    IMAGE:7391607.5p                                                                                                                                                                                                                                                                                                                                                         GAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAA
  5   1   2       bld Emb4 5g                         IMAGE:5569914.5p                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTTGAGGGGAAGTGGTTTGAAGCTGGCTACACGGGGCAGCCCCTGCAAAGCCAGGCGGTGGGaaaaaaagaaaaaCCCGGTGCCCTTCCTCATCTAACCTGGAAAAAACATGCCCCGAATTGGCGCCACCCCACCCAACCCTGTTTCCTCATTTggggggggATCCGGGAAACCCCACCCTTGGCAACCCAGGGGGTGGAAGACCCCCCC
  5   1   2       bld Tbd2 5g                         IMAGE:3201234.5p                                                                                                                                                                                                                                                                                                                                                            CTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAAGGAGCTCACCANAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGGCAACCGTATCTTCCGCTACCGCTACATGGAATGCTCTGCAAAAACGA
  5   1   2       bld Spl  5g                         IMAGE:8464151.5p                                                                                                                                                                                                                                                                                                                                                            CTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACG
  5   1   2       bld Neu5 5x3                         Neu5-105F21B.5p                                                                                                                                                                                                                                                                                                                                                             TTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACCGGGCAGCCCTGCAAGCTAAGGCCGTGGCAAGGAAGAAAACCCACGTTGCCTTTTCATTAACAGAAAACATGCCCGTATTGCACACACCACAACCTATTCCCATACTTCCTTGGGGGGCACTTGGGAAGTGGCCAACAGGGTGAAACCCCCCCGGGCAAAAAACCGTACAAGTCCCaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl312h17.5p                                                                                                                                                                                                                                                                                                                                                             CCGAGCTTGAGCCGGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCC
  5   1   2       bld Ga18 5x   ?                        xlk60k01ex.5p                                                                                                                                                                                                                                                                                                                                                               CTTGAGNCGGGNGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGANCTAATAACCACCGCCGCCCGTGNNGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGNNANNNNNGTCTCTACAAGAATCTTAAAGCGGCTCANCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGNNNACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGNGNGAANNATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCNTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGNCGTGACATGGCAAACCGTATCTCCGCCTACNNTACATGGAATGCTCTNNAAAAACGAAAGATGGCGTGAGGGAAGNGTTTGAGCTGGCTACACGGGCAGCCCTNNAAGCTAGGCG
  5   1   2       bld Te1  5g                         IMAGE:6930271.5p                                                                                                                                                                                                                                                                                                                                                                 GGGGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAAGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAAGTCGTGACATGGCAAACCGTATCTCCCGCCCTACGCTACATGGGAATGCTCTGCAAAAACCAAAAATGGCNTGGAGGGAAGTGT
  5   1   2       bld Ga16 5g                              DN828615.5p                                                                                                                                                                                                                                                                                                                                                                 GCTTGAGCCGGGCGGNTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAGNGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTNAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATNCCTGGAGAAAATGGACCCCAGANGTGAAACATTT
  5   1   2       bld Emb1 5x3                        IMAGE:6636548.5p                                                                                                                                                                                                                                                                                                                                                                  TGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGCTTGAGCTGGCTACACGGGCAGCCCTGCCAGCTAGGCGTGGCAAGAAGAAAAACACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACGCCACACCCTATTCCCATACTCCCTCTGGGGGCACTGGGNAGTTGCAGCCAAGGGTTGAAAGCCCCCCGGCCAAGAACCGTACCAGGCCCCCAGAAAACAAAAATCCTGGGAGAAGTGC
  5   1   2       bld Brn1 5g                         IMAGE:6953959.5p                                                                                                                                                                                                                                                                                                                                                                  CCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTNGGCAGAAACATANNGAAGTGGAAAATGGCN
  5   1   2       bld Ga12 5g                              XL198i05.5p                                                                                                                                                                                                                                                                                                                                                                  GGCTTCTCTCCGCCTCGCCTACGTTGTGCACGCGCACGCATCCTTGCCGTGCCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATAAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAA
  5   1   2       chi Emb9                            IMAGE:7974411.5p                                                                                                                                                                                                                                                                                                                                                                  TCGGTCCGGATTCCCGGGATCGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCATACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAATACATACCTGATAAATGGACCTCATATGTGAAACATTTTTGCCCCAATGTTCCTATTATTTTAATTGGGAATAAGAAGGATCTGCTTTATGATTAACACTCTCTCAGGGAGCTCACCTTAATGAAACATGAGCCTTGTGAGCCTTGATAACGTCTTGACATGGCAATCCTTATCTCACCCTATGGCTACATTGTAATGCTCTTCTAAAATGATAGATTGGCTGAGGGAGTTGTATAACTGGCTACTGGTTTCCCTGTATCTAGGATGGTaaaaaaaaaTCTTTGCTCTGTTCTACTGAGAAATGCA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4964595.5p                                                                                                                                                                                                                                                                                                                                                                   CGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAACAAGAAAG
  5   1   2       bld Ga18      in                       xlk78i09ex.5p                                                                                                                                                                                                                                                                                                                                                                     CGGNNNNNCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGGCANCNNGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGNNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGNGAANNATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGNTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACNNTACATGGAATGCTCTNCAAAAACGAAAGANGGCGTGAGGGAAGNGTTTGAGCTGNCTACACGGGCAGNCCTNNAAGCTAGGCNNGGNAAGAAGAAAACCACGTGCCTTCTCATCTANNAGAGAANNAT
  5   1   2       add Ga18      in                      xlk162d07ex.5p                                                                                                                                                                                                                                                                                                                                                                      TTGNGNNNGGNTCTTACGTTGGAAGGAGNTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGANGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCNACNCNGNTTATACCGGAATCTGAAAGCNG
  5   1   2       bld Te2  5x3                        IMAGE:7211039.5p                                                                                                                                                                                                                                                                                                                                                                        TCCCCGGGAATTNNCCCGGGATGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGGATCGGGGAGCCAGCGTGCAGCAAGGGGTGAAGCCCACGGGCGAAACGTACAGTCCCAGAAAAAAATCCTGGCAAGGGGATGTTTAATTAATCTTTTAAAAGGTGTTCTTTCCGGGGGCCtttttggtcctttttttctatttttt
  5   1   2       bld Te2  5x3                        IMAGE:7391918.5p                                                                                                                                                                                                                                                                                                                                                                         GTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACACGTGCCTTCTCATCNTACAGAGAAACATGCGTA
  5   1   2       bld Tbd7 5g3  in                         XL056d19.5p                                                                                                                                                                                                                                                                                                                                                                          GGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATT
  5   1   2       bld Te2N 5x3                        IMAGE:7205782.5p                                                                                                                                                                                                                                                                                                                                                                          GGGCGGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGACGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATAAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACACCTGTTCCTCTTGGGGGGATCGGGGACCCAGCGTGCAGCAGGGGTGAAGCCCAAGGCGGAACGTACAGTCACGAAAAAATCCCTGCAGGGAAGTTTTTTTAACCTTTAAAAGTG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203153.5p                                                                                                                                                                                                                                                                                                                                                                          TTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCCTATTCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGG
  5   1   2       bld Ga18      in                        xlk8n11ex.5p                                                                                                                                                                                                                                                                                                                                                                          GTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGGNNANNNNGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGNNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGNCGTGACATGNCAAACCGTATCTCCGCCTACGNTACATGGAATGCTCTNNNAAACGAAAGATGGCGTGAGGNAAGNGTTTNAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGNGGNAAGAAGAAANCACGTNCCTTCTCATCTAACAGAGAAACATGCCG
  5   1   2       chi Te1  5x                         IMAGE:6928579.5p                                                                                                                                                                                                                                                                                                                                                                           GGGGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGGTGAACTAATAACCACCGCCGTCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCTTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGAATGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGGCTTTTCCCTTGATAGCCCCCGACAGTTTAGAAAACATACCTGAAAAATGGCACCCGGAGGTGAAACATTTTTGGCCCAATGTGCCCATTATTTTAGTTGGAAGACAGAAGGATCTGCGTTAATGATGAACACACTCCGTAAGGGAGCCTCACCAAAAATGAACCAGGGAGCCCTGGTGAAACCCCaaaaaaaaGGGTCTTGAACCTTGGGCAAAACCCGGTTATCCTCCCGGCCTTACGGGGCTTAATTTTGGAAAAAGCGCTTCCTTGCCCAAAAAACACCACAAATGAAATGGGGCCCGCTTAAGGGGGGAAAAATTGGTTTTTTTGGAAACACCTTGGAGCCTCATACACTACCGGGGGCAGAAATACCCCCCTTCAG
  5   1   2       chi Te1                             IMAGE:6929415.5p                                                                                                                                                                                                                                                                                                                                                                            GGGACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCATCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAATTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGATAGACTGCGACCTCTGTCCTATCCAGACACTGATGCTATATTAATGTGCTTTTCCATTGAAAGCCCCGACCAGTTTAGCAAAACCTACCCTCGAAAAAATTTGAACCCTCCGGAGGGTGAAAACTATTTTTCTGCCCCCCAATTGTGTGCCCCATTTAATGTTTTACGTTTGGGGAGAACCCCATGCAAACCGGCATTCTCTACCGAGTAAATTGGTACTTCGAAAATCTACCAATCCTTCTGTCTACATTGTGGAGAGGCCTTTCCAACTCGTAATAAAGATTGAGACATAACTCATGGGAAAGACCCCCTTTGTTGTAAAAAGGTCCCCATATTaaaaaaaaaGGTGTACTGCATGGAACCATGTGGGGCCCAGACTAACACCGTATATATTCTTCCCCCGCCTGCTTAACGCGATGTCTTATCAACCTGGGTGAAAAATATCGTTTCCTGCACCAAGAAGTTACCTCCAGTAATAGAATTTTGCCCCTCTTTAAAGATGGTTAATAAAATATGGATTTTTGTGAAGCTTCCGTGGTACCCATACCATCCGTGAGTGCAACGCTCCCTGTTGTGCCTTANAAGCGCCTACCGAGTCGACGTTGTGGTCGCTTGCGCGAAAAGGACAAATAAAGCCC
  5   1   2       bld Ga18 5g3  in                      xlk150k04ex.5p                                                                                                                                                                                                                                                                                                                                                                            GAGNCGGNNGTTCTTACGTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCNACGCNGTTTATACCGGAATCTGAAAGCGGNNNGNGGCGAGNCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGANGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGNNTACAGCTGGNCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAANATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGNTACATNGGAATGCTCTNNAAAAACGAAAGATGGCGTGAGGGAAGNGTTTGAGCTGGCTACACGGGCAG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8076060.5p                                                                                                                                                                                                                                                                                                                                                                             TTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAACGAAAATGGCGTGAGGGAGTGTTTGAGCTGCTACACGGGCACCCTGCAGCTAGCGTGGCAGAAGAAACACGTGCCTCTCTCTACAAAGAACTGCGTATGCACCCACACTATCCAA
  5   1   2       bld Te2  5x3                        IMAGE:7211673.5p                                                                                                                                                                                                                                                                                                                                                                              GTCCCCGGGAATTNNCCCGGGATGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACNGGCAAACGTACAGTCACAGAAAAAATCCTGGAAGGAATGTTAATTATCTTTAAAAGTGTCTTACTGGCCttttgttccttttcatttttttcggttttgaatttttttaaaaaaaaaaN
  5   1   2       bld Brn1 5x3                        IMAGE:6950141.5p                                                                                                                                                                                                                                                                                                                                                                                GGTACCGGGTCCTGGAATTCCTCGGGATCTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGGCACTGGGGAGTGCCAGCAAGGGTGAAACCCCACGGCAAAACGTACAGTCACAGaaaaaaaaTCCTGGAAAGGATGTT
  5   1   2       bld Ga15 5g3  in                       XL494e17ex.5p                                                                                                                                                                                                                                                                                                                                                                                  CTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTT
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057701.5p                                                                                                                                                                                                                                                                                                                                                                                    CACGCGTCCGGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAAGGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTTCATTGGATAGCCTGACAGTTTAAAAAACATTACTGAAAAAGGGACCCCAAAGGTGAAACATTTTTGCCCCAATGGGCCG
  5   1   2       bld Egg3 5x3                        IMAGE:6324543.5p                                                                                                                                                                                                                                                                                                                                                                                    TCCCGGGGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGGAGGGATGTTTATTANNTCTTTAGAGTGTTCTTACTGGNCTTTTTNGTCTTTTTCATT
  5   1   2       bld Neu7 5g3  in                         XL049g13.5p                                                                                                                                                                                                                                                                                                                                                                                      GGTTGGAAGGAGCTGGAGTNAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGGAAGTGTTTGAGCTGGCT
  5   1   2       bld Kid  5x3                        IMAGE:7008143.5p                                                                                                                                                                                                                                                                                                                                                                                       AGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGNCAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGNCAAAACGAAAGATGGCGTGAGGGAAAGTGTTGAGCTGGCTACACGGGCAGCCCCTGCAGCTANGCGTGGGCAGAAGAAAACACGTGCCTTCTCATCTAACAGAAAACATGCCGTATGCACACACACAACCTATTCCATACTCTCTGGGGCATGGNAGTGCAGCAAGGTGAAGCCCACGCANACGTACAGTCACAGAAAAAATCTGGAAGGGATGTATNATCNTAGAGTGTCTACGGCCTTTNGCTTTTCATATCTGTATGAATTATaaaaaaaaGTCTCTGCACAGTATAAGGCACGTTTTCTGAATAAATTAAAGACTCTGTAACATGTCTGCCACTACGATN
  5   1   2       bld DMZ  5g3  in                         xl320b23.5p                                                                                                                                                                                                                                                                                                                                                                                       AGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAG
  5   1   2       bld DMZ  5g3  in                         xl316g14.5p                                                                                                                                                                                                                                                                                                                                                                                       AGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTG
  5   1   2       bld DMZ  5g3  in                         xl292l04.5p                                                                                                                                                                                                                                                                                                                                                                                       GTTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCANGCCA
  5   1   2       bld Te2  5g3  in                    IMAGE:7207341.5p                                                                                                                                                                                                                                                                                                                                                                                         TGGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCAGGCGTGGGAAGAAGAAAACACGTGCCTCTCATCTACTGAGAACATGCGTATGCGCACACCACACTGTCTCATGGGGGACGGAGCAGCTGCACAGGTG
  5   1   2       bld Em10 5g                         IMAGE:7979149.5p                                                                                                                                                                                                                                                                                                                                                                                         CGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGTCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACCGGGCAGCCCTGCAGCTAGGCGTGGCAGAAAGAAACACGTGCCTCTCTCTACAGAGAACATGCGTATGCACACACACACTATCCATATCTCTGGGCATGGAGTGCACAGTGAGCACGCAACTACGTCCGAAATCTGAGGAGTATATCTAATGTCTCGCTTT
  5   1   2       bld Int2 5x3                        IMAGE:8821957.5p                                                                                                                                                                                                                                                                                                                                                                                           GTGTGGAACCATTTACCTCAAGTATTTTCCTCCTATATTATTCGTCCCCGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAGGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAGGTTGAGCCTCACGGCGAATCGTACAGTCCACAGAAAAATTCCTGCAAGATGTTTATATCTAGAAGTGTTTCTTACTGGCCTTTTTTGCTCTTTCATTTATTCTGGTTATGGAGAAT
  5   1   2       bld Eye1 5x3                        IMAGE:6945142.5p                                                                                                                                                                                                                                                                                                                                                                                            CTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGGCACTGGGGAGTGCAAGCAAGGGGTGGAAGCCCACGGG
  5   1   2       bld Ga15 5g3  in                       XL418b12ex.5p                                                                                                                                                                                                                                                                                                                                                                                            CTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCCTATTCCCATACTCCTCTGGGGC
  5   1   2       bld Te2N 5x3                        IMAGE:7767085.5p                                                                                                                                                                                                                                                                                                                                                                                            CTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGGCAGCTAGGCGTGGCAAGAAGAAAACACGTGCCTTCTCATCTACAGAGAACATGCCGTATGCACCACACACCTATTCCATACTCTCTG
  5   1   2       bld Ga18      in                      xlk115b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                            GAGCTGGAGTCAGTGTGANCTAATAACCACCGCCGCCCGTGNNGGGANGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCNNTGAGNNNNCNNNGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGNNCGNGACATGNCAAACCGTATCTNCGCCTACNNTACATGGAATGCTCTGCAAAAACGAAAGANGNNGTGAGGGAANNGTTTGAGCTGGCTACACNGGNCAGNCCTNCAAGCTAGNNNNGGNAAGAAGAAACNA
  5   1   2       bld DMZ  5g3  in                         xl321a03.5p                                                                                                                                                                                                                                                                                                                                                                                            CTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCT
  5   1   2       bld Ga12 5g3  in                         XL212k05.5p                                                                                                                                                                                                                                                                                                                                                                                             TGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTA
  5   1   2       bld FaBN 5x3                        IMAGE:8076000.5p                                                                                                                                                                                                                                                                                                                                                                                             TGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACNGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAACCACGTGCCTTCTCATCTAACAGAGAACATGCCGTATTGACACACACAACTATT
  5   1   2       bld Lmb1 5g                         IMAGE:8535849.5p                                                                                                                                                                                                                                                                                                                                                                                             TGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGNCAAACGAAAGATGGCGTGAGGGAAAGTGTTGAGCTGGCTCACNGGCAGCCTGCNAGCTAGGCGTGGCAGAAGAAACACGTGCCTCTCTCTACAGAGACATGCGTATGCACCCACACTATCCATATCTCTGGCATGGATGCACAGGTGAGCACGCAACTACGTCAGAAAATCTGAGAG
  5   1   2       bld DMZ  5g3  in                         xl305f23.5p                                                                                                                                                                                                                                                                                                                                                                                             CCTCGTGCCGAATCGGCACGAGGCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAA
  5   1   2       bld DMZ       in                         xl225j17.5p                                                                                                                                                                                                                                                                                                                                                                                             TGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAG
  5   1   2       bld DMZ  5g3  in                         xl338p05.5p                                                                                                                                                                                                                                                                                                                                                                                             CCTCGTGCCGAATCGGCACGAGGCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCANGCTAGGCGTGGCAAGAA
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580507.5p                                                                                                                                                                                                                                                                                                                                                                                              GGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCATAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTTGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAACACGT
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3579660.5p                                                                                                                                                                                                                                                                                                                                                                                              GGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAATGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCCAGCGTGGGAAGAAGAAAAACACGTGC
  5   1   2       bld Em10 5g3  in                    IMAGE:7983144.5p                                                                                                                                                                                                                                                                                                                                                                                              GGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACNGGCAGCCCTGNCAGCTAGGCGTGGCAAGAAGAAAAACACGTGCCTT
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3548928.5p                                                                                                                                                                                                                                                                                                                                                                                               GAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAATGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAACGAAAG
  5   1   2       bld Ga15 5g3  in                       XL427i15ex.5p                                                                                                                                                                                                                                                                                                                                                                                               GGAAGGAGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCNCACACA
  5   1   2       bld Ga18      in                      xlk116i01ex.5p                                                                                                                                                                                                                                                                                                                                                                                               TGGAGNCAGTGTGANCTAATAACCACCGCCGCCCGTGGNGGGANGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGGNANNNNNGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAANGGACCCCGGNNNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCNTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGNCGTGACATGGCAAACCGTATCTCCGCCTACGNTACATGGAATGCTCTGCNAAAACGAAAGANGGCGTGAGGGNAGNGTTTGAGCTGGCTACACGGGCAGCCCTGNAAGCNANGNGTGGCAAGANGAAAACNNGTGCCTNNNA
  5   1   2       bld Sp1  5x3                        IMAGE:5512301.5p                                                                                                                                                                                                                                                                                                                                                                                                AGCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCCTGCAGCCAGGCGTGGGAAGAAGAAAACACGTGCCTTCTCATCTACTGAGAACATGCGTATGCGCACCACACACTGTTCTCATGGGATCGGAGCAGCTGCACN
  5   1   2       bld Em10 5g                         IMAGE:8321412.5p                                                                                                                                                                                                                                                                                                                                                                                                 GTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAACCACGTGCCT
  5   1   2       bld Skin 5g                         IMAGE:8642418.5p                                                                                                                                                                                                                                                                                                                                                                                                 GCTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGNCAGCCAGGCGTGGGAAGAAAGAAAACACGTGCCTTCT
  5   1   2       bld Gas7 5g3  in                    IMAGE:4083667.5p                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGGAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAAAAAGTGGATGGCAAGCAGGGTGGAATTGGCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGGGCTTTTCCATTGATAGCCCCG
  5   1   2       bld Brn1 5x3                        IMAGE:6951839.5p                                                                                                                                                                                                                                                                                                                                                                                                  CCGGACGCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGGAAGTGTTTGAACCTGGCTACACGGGCAGCCCTTGCAAGCCAGGCGTGGGGAAGaaaaaaaaCACGTGGCCTTTCTCATCTTACTGGAAAAACATGGCCGTATTTGCGCACCACACACAACCTGTTTTCTCATTTGGGGGGAACCGGGGAAGCCCAGCCGTGGAAGGCAAAGGGGGGGAAAACCCCCACGCGGGGGAAAAAACGTTATACAGGTCTCCCCGGGAAAAATAAATCCCCTGGCCAACGGGGGGGAAGGGTTTTTCATATTTTA
  5   1   2       bld Brn1 5x3                        IMAGE:6955526.5p                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGGAGTGCAGCAAGG
  5   1   2       bld Ga15 5g3  in                       XL438j04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGG
  5   1   2       bld Ga15 5g3  in                       XL507l24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGG
  5   1   2       bld Te2  5x3  out                   IMAGE:7390892.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCNTGCAGCCCAGCGTGGGAAGAAGAAAACACGTGCCTTCTCATCTACTGAGAACATGCCGTATGCGCACACACACAACTGTCTCATTGGGGGATCGGGAGCAGCGTGCACAGGGTGAAGCCACGCGAAA
  5   1   2       bld Bone 5x3                        IMAGE:8739470.5p                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAATGTCGTGACATGGCAAACCGTATCTCCGCCTACGCTACATGGAATGCTCTGCAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGCGTGCAGAGAAAACCACGTGCCTTCTCATCTAACAGAGAACATGCCGTATTGCACACCCCACAACTATTCCCATACTCTCTGGGCACTGGGAGTGCAGCAGGTGAGCCACGCAAACGTACAGTCAAGAAAAATCTGGAAGATGTTATACCTAAGTTTCTTACTGCATTTTGTCTTTTTCAGTTATTCGTATAGAGAATTTTAT
  5   1   2       bld DMZ  5g3  in                         xl308g09.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTG
  5   1   2       bld DMZ  5g3  in                         xl284h17.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCG
  5   1   2       bld DMZ  5g3  in                         xl263o17.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTG
  5   1   2       bld DMZ  5g3  in                         xl328e17.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAG
  5   1   2       bld DMZ  5g3  in                         xl339f23.5p                                                                                                                                                                                                                                                                                                                                                                                                   TGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCANGCCAG
  5   1   2       bld Neu4 5g3  in                    IMAGE:3557333.5p                                                                                                                                                                                                                                                                                                                                                                                                    GGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCANGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAG
  5   1   2       bld Kid  5g                         IMAGE:7009774.5p                                                                                                                                                                                                                                                                                                                                                                                                     GAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAACACGTGCCT
  5   1   2       bld DMZ  5g3  in                         xl276a05.5p                                                                                                                                                                                                                                                                                                                                                                                                      AGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTG
  5   1   2       bld Ga15 5g3  in                       XL433c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                       CTGGAGTCAGTGTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGG
  5   1   2       bld Ga18      in                      xlk165k11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                        TGTGANCTAATAACCACCGCCGCCCGTGNNGGGANGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGNTGAGGNANNNNGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGTGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAANCGTATCTCCGCCTACGNTACATGGAATGCTCTNNAAAAACGAAAGATGGCGTGAGGGNAGTGTTTGAGCTGGCTACACGGGCAGNCCTNNAAGCTAGGCGTGGNNAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTNCACACACACAAC
  5   1   2       bld DMZ  5g3  in                         xl234f04.5p                                                                                                                                                                                                                                                                                                                                                                                                             GTGAACTAATAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGG
  5   1   2       bld Tbd7 5g3  in                         XL080e04.5p                                                                                                                                                                                                                                                                                                                                                                                                                 CTAATAACGCCGCCCGTGAGNAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCT
  5   1   2       bld Neu7 5g                              XL003l14.5p                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGGGCCGCCCGTGAGNAGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACAT
  5   1   2       bld Brn1 5x3                        IMAGE:6951752.5p                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGAGCTTGAGCCGGGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAAGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAAATGGCGTGAGGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAACTTGGGCGGGGCAAGAAGAAAAACCCGTGGCCTTTCTCATCTAACAGAAAAAACCTGCCCGTATTGCCACACACCCCACCCTATTTCCCATAACCCCCTCTGGGGCCACTCGGGGAATGGCCACCCAGGGGGTTGAAAGCCCCACGGGGCAAAAACGTTAACCGGTCCCCGGaaaaaaaaaaTCTCCTGGAAAGGGAATGGTTTATATTAAAACTCCTTTAGG
  5   1   2       bld Neu7 5g3  in                         XL049g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                      TAACGCCGCCCGTGAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCT
  5   1   2       bld Neu7 5g                              XL012i21.5p                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGCCCGTGGGNAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCC
  5   1   2       bld Tbd7 5g3  in                         XL081i02.5p                                                                                                                                                                                                                                                                                                                                                                                                                       CGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACAT
  3   1   2       bld Ga15 5g3  in                       XL449g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                        CGCCCGTGGGAGGGACGGAAAACACGAGNTATATNCCCGTGTGTAAGCGAGCCGGTGAGTGTGNTCGGNTGAGGCAACGCAGGTCTTTTACAAGAATNTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTNGTAAGAAGCTNGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTNTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTTCAT
  5   1   2       bld Emb9 5x3                        IMAGE:7978214.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGGTCAC
  5   1   2       bld Te2N 5x3                        IMAGE:7205373.5p                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGGCACTGGGAGTGCAGCAAGGGGTGAGCCCACGGCAAAACGTACAGTCACAGAAAAAATCCCTGGGAGGGATGGTANATTTATNCTTTAAAGTGGTTCTTACCTGGGCCtttttttgttcttttttCATTATATTTCTGT
  3   1   2       bld Ga15 5g3  in                       XL507l24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                             CGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTNTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTTCATAT
  5   1   2       bld Emb9 5g                         IMAGE:7975567.5p                                                                                                                                                                                                                                                                                                                                                                                                                               TCGGTCCGGATTCCCGGGATCCGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACATGAGCCTGTGAAGCCTGAAAAAGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGTATTGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACTCGGTCAGTCCTGCAATCCAGGCGTGGAAAGAAAATAACACTTGTCCTTCTCTCTTACTGAGAAATTTGCGTTTTGCGCATCCTATCACTTGTTCTCATTGGGGGA
  5   1   2       bld FaB  5x3                        IMAGE:8070516.5p                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCC
  5   1   2       bld Em10 5g                         IMAGE:8320340.5p                                                                                                                                                                                                                                                                                                                                                                                                                               GAACTAATAACCACCGCCGTCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAGCTAGGCGTGGCAGAAGAAAACACGTGCCTCTCTCTACAGAGAACTGCGTATGCCACACACACTATCCATATCTCTGGCCTGGATGCACAGGTGAGCCACGCAACGTCGTCAGAAAATCTGAAGATGTATACTTAAGTCTACGCTTTGCTTCTATCGTTGATTAAAAAAATCTGTCGATAACAGTTCTATA
  3   1   2       bld Ga18      in                      xlk142e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                               GNTGGNAGGGACGGNAANNNCGANCTATANNCCGNNNGTANNNNNNCNGNNGNGTGTGCTCGGCTGNGNCAACGCAGGTCTCTACAAGANTCTNAAANNGNCTCAGCNTGAGAAATGGCANCCATTCGTAAGAAGCTCGTAATTNTNGNAGATGGTGCATNCGGGAAANCCTNCCTTCTGATTGTGTTCAGTAAAGNCCANTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGANCTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGNCCTATGGGATACAGCNGGTCAAGAAGATTATGACAGNCTGCGNCCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCNTTGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACNTTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACNCTCGTAGGGAGCTCNCCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCNNNCTACGGCTACATGGAATCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGNANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACNNNNTGGNNNCNGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTAC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4969219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACTGGATGTC
  5   1   2       bld Emb1 5x3                        IMAGE:6631514.5p                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCAGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGGAGCCANGCGTGCAGCCAAGGGTGAAAGCCCACCGGCGAAAACGTACAGTTCACCAGAAAAATCCCTGCCAAGGGGATGGTTTATTTAATCCCTTTAGCAGTGGT
  5   1   2       bld Ga15 5g3  in                       XL433h13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCANCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAG
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGGACGGNAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGGAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAAGGACCTGTGAAAGCCAGAGAAAGTCGTGACATTGGCAACCGTATCTTCCCCTACGGT
  5   1   2       bld Neu7 5g3  in                         XL040e04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCA
  5   1   2       bld Tbd7 5g3  in                         XL098h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAA
  5  -1   2       bld Egg4                   IMAGE:3743490-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCCGGTGAGTGTGCTCGGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTAT
  5   1   2       bld Ga18      in                      xlk142e03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGGAGNNNNNAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCNNTNAGGNNCNNNGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACNNTACATGGAATGCTCTGCAAAAACGAAAGANGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGNCCTNNNAGCTAGNNGTNNNAAGAAGAAAANCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGNNACTGGGNNNNNNNAAGGGTNA
  5   1   2       bld DMZ  5g3  in                         xl258j18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCGGTTCTTACGCTGGAAGGAGCTGGAGTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTG
  5   1   2       bld Egg3 5x3                        IMAGE:6325392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGNGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGGTCTTACTGGCCCTTTTTGNNCTTTTCATTTATTCTGGTATGAGGATTTTATAAAAAAA
  5   1   2       bld Ga18      in                      xlk107n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGAGNNNNNAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCNNTGAGNNNCNNNGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGNTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGNNGGAAGNGTTTGAGCTGGCTACACNGGCAGCCCTGCAAGCTAGNNNNGGNAAGAAGAAAANNACGTGCCTTCTCATCTAACAGAGAAACATGCCNNATTGCACACACACAACCTANTCCNNTACTNCNCTGGGGNNNTNGGNNNNNNCAAGGGTGAAGCCCANGNAAAACGT
  5   1   2       bld Te2  5g3  in                    IMAGE:7208594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAACACGTGCCTTCTCATCTACTGAGAACATGCCTATTGCG
  5   1   2       bld DMZ  5g3  in                         xl314f20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACA
  5   1   2       bld DMZ  5g3  in                         xl313f20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTG
  5   1   2       bld Lmb1 5x3                        IMAGE:8534525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCCAGCTAGGCGTGGCATGAAAAAAACACGTGCCTTCTCATCTACAGAGAAACATGCGTATGCGCTACCCACAACCTATCCATACTCTCTGGGCACTGGGAGGAGGCAGGTGAGCCATCGCCAACTACGTCACGAAAAATCTGCAGGAGTTTT
  5   1   2       bld Emb9 5x3                        IMAGE:7978277.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGGTG
  5   1   2       bld Egg1 5g                            PBX0065B03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAA
  5   1   2       bld Ga15 5g3  in                       XL429m11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGAAATCACGCGCTGTATACCGTGTCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTA
  5   1   2       bld Ga12 5g                              XL145l20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAGGGNCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTC
  5   1   2       bld Eye1 5g3  in                    IMAGE:6948654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATCGAGCTTATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCA
  5   1   2       bld Ga15 5x3                           XL517j21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCCCGTGCCTTCTCATCTAACAGAAAA
  5   1   2       bld Ga18      in                      xlk139a24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCNNTNAGGNNCNNNGTCTCTACAAGAATCTTAAAGCGGCTCNCNNGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACNNTACATGGAATGCTCTGNAAAAACGAAAGATGGCGTGAGGNAAGTGTTTGAGCTGNCTACACGGGCAGCCCTNNAAGCTAGGNNNGNNAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGNCGTATTNNACACACACAACCTATTCCCATACTCCTCTGGGGCATTGGGAGTNNAGNAAGGGTGAAGCCNNNNNAAAACGTACAGTCNNNGAAAAAAATCCT
  5   1   2       bld DMZ  5g3  in                         xl323f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGG
  5   1   2       bld Neu7 5g3  in                         XL026f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGC
  5   1   2       bld Neu7 5g                              XL037o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCGCTGTATACCGTGTCAGNAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGC
  5   1   2       chi Te2N                            IMAGE:7206358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGAATATGACAGACTGCGACCTCTGTCCTATCCAGACACTGGATGTATTATAATGTGCTTTTTCATTGATAGCCCCGACAGTTTAAAAAACAATCCCTGAAAAAATGGACCCCGGAAGTGGAAAAATTTCTGCCCCCAATGGGGCCCCTTTATTTTTATTTGGaaaaaaaaaaGGGATTCTGCCTAATGGAGTAAAAACACCCTCTTTAGGGGAGCTCCCCCCCaaaaaataaaaaaaGGGGGCCCCTTTGTTAAAAACCCA
  5   1   2       bld FaBN 5x3                        IMAGE:8078589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCTATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACA
  5   1   2       bld Egg1 5g                            PBX0131C02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGAGGCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACAC
  3   1   2       bld Te2       out                   IMAGE:7390894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTAGCTTACATAACATGTCGATCGAGGATCGGATAAGCGCGAGAGAGATCAGGTATCGGTCGAGAGTGATAGCACGCAGTATCGATTTGAGCGCGAGGTGCGAGCTAGAATGCAGCATCGTAGAGCTGGATGTGGAGACGTGCAGCGGAAAACTGCTTCTGATGTGTCAGTAAGACCAGTTCCAGAAGGTATGTCCAACAGTTTCGAAAACTATGTGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTATTCTGTAGAGAANAAAAAAAGCG
  5   1   2       bld Ga18      in                       xlk51b15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATATACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCNNTNNGNNACNNNGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGNNNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCNCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTNNNNNNCATGGAATGCTCTGCNAAAAACGAAAGANGGCGTGAGGNAAGNGTTTGAGCTGGCTACACGGGCAGNCCTGCAAGCTAGGNGTGNNAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAA
  5   1   2       bld Tbd7 5g3  in                         XL065o04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACCGTGTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGA
  5   1   2       bld Te1  5g                         IMAGE:6929260.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATTGGACGCCAGGCAAAGACCGCCTCTCGCCTATCCCATTTCCTCCCCTTCAATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGGCAGCCCTGCAAGCCTAGGCGTTGGCAAAGAAAGAAAAACCACGTTGCCCTTTCTCATTCTAAACaaaaaaaaaaCCATGGCCGGTATTTGGCACACCAACCACCAACCCTTATTTCCCCCATACACTCCCCTCCTGGGGGGGCCACCTGGC
  5   1   2       bld Ga12 5g3  in                         XL141n07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGTAAGNCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAA
  5   1   2       bld DMZ  5g3  in                         xl259g01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCA
  5   1   2       bld Te2  5x3                        IMAGE:7210863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGC
  5   1   2       bld DMZ  5g3  in                         xl235g11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGTAAGCGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGG
  5   1   2       bld Lu1  5x3                        IMAGE:4056763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACTGCTACATGTAATGCTCTGCANAAACGAAAGATGGCGTGAGGGAAGTGTNTGAACTGGCTACACGGGCAGCCCTGCAAGCTTGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATC
  5   1   2       bld Ga18      in                       xlk54m10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTGTGANCTAATAACNACCGCCGCCCGTGNNGGGANGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGNGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGNCGTGACATGGCAAACCGTATCTCCGCCTACGNTACATGGAATGCTCTGNAAAAACGAAAGATGGCGTGAGGGAAGNGTTTGAGCTGNCTACACGGGCAGCCCTGCAAGCTAGNNGTGGNAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGNATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGNGT
  5   1   2       bld Ga18 5g3  in                      xlk121m22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTGTGANCTAATAACCACCGCCGCCCGTGNNGGGANGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGNGNGAAANATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGNCGTGACATGNCAAACCGTATCTCCGCCTACNNTACATGGAATGCTCTNCAAAAACGAAAGANGGCGTGAGGNAAGNGTTTGAGCTGNNTACACGGGCAGCCCTNNAAGCTAGGCNNGNNAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGNATTGCACACACAC
  5   1   2       bld Neu7 5g3  in                         XL031m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTGTGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGC
  5   1   2       bld Te2  5g3  in                    IMAGE:7391311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAACGAGCTTGACTGAGGCAACGCCAGTTTATACCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGGTCTC
  5   1   2       bld DMZ  5x3                             xl331i17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAACTAATAACCACCGCCGCCCGTGGGAGGGACGGAAAACACGAGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAG
  5   1   2       bld Oo1  5g                         IMAGE:5078457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGCCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAA
  5   1   2       bld Ga15 5g3  in                       XL402g22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGTGAGTGTGCTCGGCTGAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCNAAAACGTACAGT
  3   1   2       bld Te2  5g3  in                    IMAGE:7391311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCATTCCGAAGATCTTGCTTAGACATGACATTCTCGATCCGAGTGAAGGTGATGAGCACCCTTATCGATTGAAGGCGAGCGGGAGCTGAAAATGCGCATCGAAGAGCTTGATTGGAGCGGGCATGGGGAAACCTCTTCTGATTGTGTCAGAAAGACAGTTCCAGAGTGTAGTTCCACAGTTTTCGAAAACTATGGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATC
  5   1   2       bld DMZ  5g3  in                         xl223o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGATTCGAATTCGGACGAGGACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACA
  5   1   2       bld Ga14 5g                            Ga14-p18a7.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCGCCCGTGGGAAGGACGGAAAACACGACGCTATATACCGTGTGTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTC
  3   1   2       bld Ga18 5g3  in                      xlk159k13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTNCTCGGCTNAGNCANCGCAGGTCTCTACAAGANTCTNAAAGCGGCTCANCGTNNGAAATGGCANCCATTCGTAAGAAGCTCGTANNTNTNGNAGNTGGNGCATGCGGGAAANCCTNCCTTCTGATTGTGTTCAGTAAAGNCCANTTNCCAGAAGTGTATGTCCCAACAGTTTTTGAGANCTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGNCCCTATGGGATACANCTGGTCAAGAAGATTATGACAGNCTGCGNCCTCTGTCCTATCCAGANNCTGATGTTATATTAATGTGCTTTTCCATNGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACNTTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACNCTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCnnnnnnnnCTACGGCTACATGGANNNNNTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACNNNCTGGNNNCTGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGTTCTTACNNNCNT
  3   1   2       bld Ga15 5g3  in                       XL438j04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCCAGTTTATNCCCGGAATCTGAAAGCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTNGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGT
  5   1   2       bld Ga12 5g3  in                         XL176o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGCAACGCAGGTCTCTACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGC
  3   1   2       bld DMZ  5g3  in                         xl316g14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGCAACGCAGGTCTCTACAAGAATTTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203153.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGCTGAGCAACGCAGTCTCTACAGAAATCTAAAGCGGCTCAGCGTGAGAAAGGCAGCCATTCGTAAGAAGCTCGTAATGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTTCATTATACACAATTA
  5   1   2       bld Oo1  5x3                        IMAGE:6638839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTCGATAATATTTGGAAATGATATAATCACTTCGGGGTGAGATAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCNTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAAGGGATGTTTATTAATCTTTTAGAGTGTTCTTACTGGGCCTTTTTGGTCTTTTTTCATTTATTCTGGTTATGGAGATTTTATAA
  5   1   2       bld DMZ  5g3  in                         xl255j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTTCCTCCCCTTCAATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGG
  5   1   2       bld DMZ  5g3  in                         xl256j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTTCCTCCCCTTCAATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTG
  5   1   2       bld Neu5 5x3                          Neu5-86K12A.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTCCTCCCCTTCAATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAAGAAAACCACCGTGCCTTCTCATCTAACAAGAGAAACATGCCCGTATTTGCACACCACACAACCTATTCCCATACTCCTCTGGGGGCACTGGGGA
  5   1   2       bld Ga18 5x                             xlk1m12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTCCTCCCCTTCAATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGNCGTGACATGGCAAACCGTATCTCCGCCTNNNNNNCATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGNNGTGNNAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTNNNGCAAGGGTGAANNCCACGNNAAAACGTACAGTCACAGAAAAAAATCCTGGANGGGANGTTNTTNATCTTTAGA
  5   1   2       bld Ga18      in                      xlk153b16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNNGTCTCTACAAGAATCTTAAAGCGGCTCAGNGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGANNGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTNNNNTNCATGGAATGCTCTGNAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGNNGTGNNAAGAAGAAAACCACGTGCCTNCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTNCCATACTCCTCTGGGGCNNTGGGAGTNNNGCAAGGGTGAAGCCCANNNAAAACGTACAGTCNCAGAAAAAATCCT
  5   1   2       bld Oo1  5x3                        IMAGE:6860423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAAATGATATAATCACTTCGGGGTGAGATAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGGCCTTTTTGTCTTTTTCATTTATTCTGGTATGAGATTTTATaaaaaaaaaaaaaaGTCATCCTTGCTACCAAGTATTTAAAAAGTCCAACGtttttttccttttGATATATAAAGTATATAAGTATGGAAACC
  3   1   2       bld Ga18      in                      xlk141c08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCAATGTCGNNGANCNTTTCTTGAGAAAAGAAATGGCANCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAANNCTNNCTTCTGATTGTGTTCAGTAAAGNCCANTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGANCTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGNCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGNCTGCGNCCTCTGTCCTATCCAGACNCTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCNNNNCNNNCTACGGCTACATGGANNNNNTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACNNTCTGGGGCACTGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGTTCTTA
  3   1   2       bld DMZ  5g3  in                         xl323f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACAAGAATCTTAAAGCGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTT
  3   1   2       bld Ga15 5g3  in                       XL427i15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATNTGAAAGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCT
  5   1   2       bld Int2                            IMAGE:8820657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTACAAACATAATTATCAAAAACGATTCAAATTCGTCCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCACGTTTTTTCTTGAAATATTAAAATATTTATGTAACTTCACTGTAGCAGATTTGTCCATGCACAGACTACTCTGGACTTCACTTGTATACAGTCTGCCAACGAGGATTTCTGTAATACGAGAACTGGCCTTCTAT
  5   1   2       bld Lu1  5g3  in                    IMAGE:4058328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGCGCAGCGTGGCGAGGCCTGAGAAATGGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGANNCGGTGCATGCGGGAAAANCCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATA
  5   1   2       bld Tad2 5x3                        IMAGE:6874759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCANAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACAAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTTAGGGTGGCCAAGaaaaaaaaCCACGTGCCTTTCTCATCTAAAAAGAGGAAACCTGCCCGAATTGGCCCCCACCCCAACCCTATTTCCCATACCTCCCTCTGGGGGCACCTGGGGAATGGCACACCAAGGGGGGGAAAccccccccGGGCAAAAAACGTAACAGGGCCCC
  5   1   2       bld Ga18      in                      xlk141c08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATGTCGGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACNNNNCATGGAATGCTCTNNAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGNCCTGCAAGCTAGGNGTGNNAAGAAGAAAACCACGTGCCTNCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGNNNAGCAAGNTGAAGNCCANNNAAAACGTACAGTCACAGAAAAAAATCCTGGAAGNANNTTTNTTAATCTTTAG
  5   1   2       bld DMZ  5x3                             xl248a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACA
  5   1   2       bld Te2  5x3                        IMAGE:7393142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTNCCATACTCCTCTGGGGCACTGGGAGTGCAGNCAGGGTGAAGCCACGGCAAACGTACAGTCACAGAAAAAATCCTGGAAGGATGTTNATATCTTAGAGTGTCTACTGGCTTTTGTCTTTCATTATCTGTATGAGATTTaaaaaaaaaGTT
  5   1   2       bld Te2  5x3                        IMAGE:7393451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCACGGCAAACGTACAGTCACAGAAAAATCTGGAAGGATGTTANTATCTTAGAGTGTCTACTGGCCTTTGTCTTTCATTATCTGTAGAGATTATaaaaaaaaaaaaaaaaGCGCGCTATACTCAGATGTCTAGTGGTCATAACAGCTGCTCTTCACCGA
  3   1   2       bld DMZ  5g3  in                         xl255j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGT
  3   1   2       bld Eye1 5g3  in                    IMAGE:6948654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTTCAGCGTTGAGAAAAGTGGCAGCCATTCGTAAAGAAGCTTGTAAATTGTTGGAGATGGTGCATGCGGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTAAAAGTAGA
  5   1   2       bld Te2  5x3                        IMAGE:7209908.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGTTTCTTGAGAAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCCGGCAAAACGTCAGTCACAGAAAAATCCTGGAGGGATGTTATNNATCTTAAGTGTCTACTGGCCTTTGCTTTTCATTATCTGTATGAATTATaaaaaaaaaaaaaaaaGGCGCGCTATACTCAGA
  3   1   2       bld DMZ  5g3  in                         xl323f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAANCCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTT
  3   1   2       bld DMZ  5g3  in                         xl313f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTT
  3   1   2       bld DMZ  5g3  in                         xl302k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTT
  3   1   2       bld Ga18      in                      xlk165k11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CNNNGCGNGAGAAATGGCAGCCATTCGTNANAAGCTCGTANTTGTTGGAGANNGNGCATGCNGGGAAAACCTNCNTTCTGATTGTNTTCAGTAAANNCANTTNCCAGAAGTGTATGTCCCAACANTTTTTTGAGANCTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTNGGCCCTATGGGATACANCNGGTCAAGNAGATTATGACAGNCTGNGNNCTCTGTCCTATCCAGACNCTGATNNTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGTGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTANCNNNNACGGCTACATGGANNNNNTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNGNCNGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTNGAAGGGATGTTTATTAATCTTTAGANNNNNNTNC
  3   1   2       bld DMZ  5g3  in                         xl258j18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAAGCGAGCCGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCNTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGNTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCNCGTGCCTTCTCATCTAACAGAGAAACATNCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCNCTGGGAGTGCAGCAAAGGGTGAAGCCCTCGGCAAAA
  3   1   2       bld Ga18      in                      xlk116i01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTCAGCGTGAGAAATGGNANNNTTCGTAAGAAGCTCGTAATTNTTGNAGATGGTGCATGCGGNNANNCNTNCCTTCTGNNTGTGTTCAGTAAAGNCCANNTTCCAGAAGTNTATGTCCCAACAGTTTTTGAGANCTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGANTNNNCCTATGGGATACANCTGGTCAAGAAGATTATGACAGNCTGCGNCCTNTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCNTNNATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACNTTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCNCCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCNNNNNNNCTACGGCTACATGGAANNNCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGNANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACNNNNTGNNNNCNGGGAGTGCAGCAAGGGTGNANCCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGTTCTTACNNCCTT
  5   1   2       bld Ga12 5x3                             XL153j06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGTGAGATAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCA
  3   1   2       bld Ga18 5g3  in                      xlk121m22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANNCGANCNGAAATGGCANCCNTNNGTAAGAAGCTCGTAATTNTNGNAGATGGTGCATNNGGNAAANCCTGCCTTCTGATTGTGTTCAGTAAAGNCCANTTTCCAGAAGTGTATGTNCCAACAGNTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGNCAAGCAGGTTGANTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGNGNNCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATNGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAANCNTTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGNANCTNCTACGGCTACATGGANNNNNTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNNNCTGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGNTCTTNC
  3   1   2       bld DMZ  5g3  in                         xl314f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTT
  3   1   2       bld DMZ       out                        xl233c19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGCGTGAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTT
  3   1   2       bld DMZ  5g3  in                         xl236f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCCGGAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGT
  3   1   2       bld DMZ  5g3  in                         xl256j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGAAATGGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTT
  3   1   2       bld Ga12                                 XL220g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGAAATGGCAGCCATTNGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5047818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAATGGCTTCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATC
  3   1   2       chi Ga18                             rxlk112i15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATGGNANCNNTTCGTANNAGCTCGTANTNNNTNGAGATGGNNNANNNGGGAANNCNTNCCTNCTGATTGTGTTCAGTAAAGACCAGTTNNNGAAGTGTATGTCCCANCAGTTTTTNAGANCTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGNCTGNGNCCTNTGTCCTATCCAGACNCTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGNCCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACNCTCGTAGGGAGCTCNCCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTNCTACGGCTACATGGANNNNNTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACNCTCTGNNNNCNGGGAGTGCAGCAAGGGTGNNNNCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGTTCTTNC
  5   1   2       bld Oo1       out                   IMAGE:3403975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAGCCATTCGTAAGAAGCTTGTGATTGTGGGAGACGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCATAAGTGTATGTTGCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGAGCTTTTCCAGTGATAGCCCTGACAGTTTAGAAAACATTCCGGATAGATGGACCTCAGAGGTGATATATCTTTCGCCTGATGTGCCGAGTATGTCTAGTTGGTATAAGACAGATCATGCTAATGATGATCACACTCGA
  5   1   2       bld Sp1       in                    IMAGE:4174044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATTGAATTGGATGGCAAGCAGGTTGAGTTGGCCCTATTGGATACAGCTGGGCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTCTAGAAAACATACCTGAGAAATGGACCCGGAGGTGAAACTTTCTGCCCCATGTGCCCATT
  5   1   2       bld Egg6      in                    IMAGE:4412792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTGTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCGCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCTGAGGGAGCTCACCAAAAAGAAACAGGAGCCTGTGAAGCCCCGAGAAGGG
  3   1   2       bld DMZ  5g3  in                         xl245a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTT
  5   1   2       bld DMZ       in                         xl266b01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGA
  3   1   2       bld DMZ       in                         xl266b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCATTCGTAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTT
  3   1   2       bld Te2  5g3  in                    IMAGE:7391607.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTCGCTGAGAATGCAGCATCGTAGAGCTGTATTGTGGAGATGTGCAGCGGAAACTGCCTTCTGATGTGTTCAGAAAGACCAGTTCCAGAAGTTATGTCCCAACAGTTTTTGAGAACTATGGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTTCTTTTTCATTATTCTGTAGAGATTAAAAAAAAAAAAGCTCA
  5   1   2       bld Ga15 5g3  in                       XL449g18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGAAGCTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGG
  3   1   2       add Ga18      in                      xlk153b16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNNGTAATNNNNNAGATGGNNCATNCGGNAAAACCTNCCNTCTGATNGNNTTCANTAAAGNCCAGTTTCCAGAAGTGTATGTCCCAACANTTTTTNGAGNNCTATGTGGCAGACATAGAAGTGGATGNNAAGCAGGTTGAGTNGGCCCTNTGGGATACAGCTGGTCAAGAAGATTATGACAGNCTNNGNNCTCTGTCCTATCCAGACNCTGATGNNATATTAATGTGCTTTTCCATNGATAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACNTTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGANGAACACNCTCGTAGGGAGCTCNCCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTANCNNNNANGGCTACATGGANNCNCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNNNCNGGGAGTGCAGCAAGGGTGANCNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTNGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTAC
  3   1   2       bld DMZ  5g3  in                         xl320b23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTT
  3   1   2       bld Ga15 5g3  in                       XL494e17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGT
  3   1   2       bld DMZ  5g3  in                         xl291j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTAATTGTTGGAGATGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTG
  3   1   2       bld Te2N                            IMAGE:7202549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATTGTGGGAGACGGTGCATGCGGGAAAACNTGCTTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTATTCTGTTGGAGATTAAAACATATCGTAAATACTTTTT
  5   1   2       bld Kid                             IMAGE:7010536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACGCGTCCGCGGTGCATGCGGGAAAACCTGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCT
  3   1   2       bld Ga18      in                      xlk107n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATGGNGCATNNGGNAAACCNTNCCTTCTGATTGTGTTCANNAAAGNCCANTTTCCAGAAGTGTATGTCCCAACANNTTTTGAGNNCTATGTGGCAGACATAGAAGTGGATGNCAAGCAGGTTGAGTNNNCCTATGGGANACAGCTGGTCNAGAAGATTATGACAGACTNNGNCCTNTGTCCTATCCAGACNCTGATGTTATATTAATGTGCTTTTCCATNGANAGCCCCGACAGTTTAGAAAACATNCCTGAGAAATGGACCCCGGAGGTGAAACNTTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCNCCAAAATGAAACAGGANCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTANCTNCTACGGCTACATGGAANNNNTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGNANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNNNCNGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGNTCTTNC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8076060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGCTGTATGTGAGATGTCAGCGGAAACTGCTTTGATGGTCAGTAAGACAGTTCAGAAGTGAGTCCAACAGTTTGAGACTATGTGCAGACATAGAGTGGATGCAGCAGGTTGAGTGGCCCTAGGGATACAGCTGTCAAGAAGATATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGAAGTAGCATTTTATAAAAAAAAAAAAAGTCATCTACCTACCAGTATTAAACGTCAGCGTGAGACTTTTTGTACATCATCTTT
  5   1   2       bld Lu1       in                    IMAGE:4633685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCTTCTGATTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGGaaaaaaaa
  3   1   2       bld Neu7 5g3  in                         XL031m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGTTCAGTAAAGACCAGTTTCCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGNGCCTTTTTGTCTTTTTCATTTATT
  3   1   2       bld Ga12 5g3  in                         XL212k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGTGTTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTT
  3   1   2       bld DMZ  5g3  in                         xl234f04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTCAGTAAAGACCAGTTTTCCAGAAGTGTATGTTCCAACAGTTTTCGAAAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATT
  3   1   2       bld DMZ  5g3  in                         xl243p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAGTAAAGACCAGTTTCCAGAAGTGTATGTCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTG
  3   1   2       bld DMZ       out                        xl270p06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCAACAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCNTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATNTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGT
  5   1   2       bld Ga15      in                       XL473o09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTTTTTGAGAACTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  3   1   2       bld Neu4 5g3  in                    IMAGE:3557333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCAAAACTATGCGCCAACCATAGAAGTGGATGCAAACAGCTGGAATTGGCCCTTGCGGATCCAGCTGGTCAACAAGATTATGACAGACTGCGCCCTCTGTCTTCATCCGGACACTGATGTTATATTAATGGGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTTTTTCTTTGATATATAAATATATAATATGTAACTTCCAAAAA
  3   1   2       bld Ga15 5g3  in                       XL402g22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGANCTATNGTTGCAGACATAGAAGTGGATGGCAAGCAGGTTGAGTTGGGCCNTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTNTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGA
  3   1   2       bld Te2N 5x3  out                   IMAGE:7764313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATGTGGCAGACATAGAAGTGGATGGCAAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTTTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAGTCATCTTGCTACCAGTAAAAAAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL418b12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATAGAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATNCAGNTGGTCAAGAAGATTATGNCAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTT
  5   1   2       bld Em10                            IMAGE:8320299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGTGGATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATAATAAATAATATGTAACTTCACTGTAGCAGATTTGTCATGCACAGACTACTCTGACATCACTGTATACAGTCTGCACAGGAATCTGATCGAACTGC
  3   1   2       bld Neu7 5g3  in                         XL026f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGGCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTNTTCATTTATTNCTGTT
  3   1   2       bld Tbd7 5g3  in                         XL081i02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAGCAGGTTGAGTTGGCCCTATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGT
  5   1   2       bld Ga18      in                       xlk55d02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAAGCAGGTGGAATTGGCCCTTTGNNTACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAANATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGTNCATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGNAGNAAGGGTGAAGNCCACNGNNNNACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGNCTTTTTGTCTTTTTCATTTATTCTGTTATGNGATTTTATaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttNCTTTGATATATAAATATATAA
  5   1   2       bld Oo1       in                    IMAGE:3405500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCAGGTGGAATTGGCCCTTTGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCTTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAG
  3   1   2       bld Tbd7                                 XL105p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGGCCTTTTTGTCTTTTTCATTTAT
  3   1   2       bld Ga12 5g3  in                         XL176o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGATACAGCTGGTCAAGAAGATTATGACAGACTGCGACNTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACNTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTAC
  3   1   2       bld Gas7 5g3  in                    IMAGE:4083667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAAAGCTGGTCAAGAAGATAATGACAGATTGCGACCTCTGTCCTATCCAGACACTGATGTTATATAAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAACCATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTAAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg6                            IMAGE:4433233.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCCAGCTGGTCAAGAAAATTATGACAGACTGCGACTTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCT
  5   1   2       bld Brn3                            IMAGE:8538642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAANTNCCATGGTGCTTGCNGGCCATCGATTGAAGGGGGTCCCTATCCGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGAATTCTGATACGAGACGGGCTCCTTTATTCTCCAAAGCTCCTAATGTCCCCTCCT
  3   1   2       bld Sp1       in                    IMAGE:4174044.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATCGACATCGGCATCGTATGTCATATCAGAACAATTATATAAACTAAAGATCTCTTCCATTGAATAGCCACGACAGTTAACAAAACATACTATAAAATTGGAACCGCATGGTAACACATTTCTACCCCAATGTGCCCTTAATTTTAGTTGGAACAATGAAGAATCTGGGTAATGATGAACACATTCGTAGGGAGCTCCCACATATGATACAGGAGCCTGTGAAGCCAGAATAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGTAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGTTAGGGGTGGCAAGAAAAAAACCACGTGCCTTTTCA
  3   1   2       bld Ga10 5g3  in                    IMAGE:3558141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAANCAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCGTTTTGTCTTTTTCATTTATTNTGTAATAAGATTTTATAAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5047818.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATGACAGACTGGGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTAT
  5   1   2       bld Brn2                             Brn2-za50c07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGACAGACTGCGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACC
  3   1   2       bld Egg5      in                    IMAGE:3431786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCGACTTCTGTCCTATCCAAACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGAAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACCTCTGTCCTATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTTTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTTTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAGGTCAAAAAAAAAAA
  3   1   2       bld Neu7 5g3  in                         XL027i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACCGGCCTTTTGTCTTTTTCATT
  3   1   2       bld Egg5      in                    IMAGE:3431772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATT
  5   1   2       bld Ga18      in                       xlk79p03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCAGACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCNNNNNGAAANATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTANNNNNCATGGAATGCTCTGNAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTNCAAGCTAGGCGTGNNAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTNCAGCAAGGGTGAAGNCCANNNNNAACGTACAGTCACAGAAAAAAATCCTGGAAGNATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  5   1   2       bld Te2       in                    IMAGE:7207752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACACTGATGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTGCCTCTGCCCTTTAATGTGTAAGTATACATGTTGCATTTTTGTCTTTCCCCTCCTCCGTGCCCCTTTGAACAGGAAAGCAAATTTTTGGTTTATCCTTTCATTAAAAAACCAC
  5   1   2       bld Neu7      in                         XL010l15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGATGTTATATTAATGTGCTTTTCCTTGATAGCCCTGACAGTTTAGAAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaG
  5   1   2       bld Egg5      in                    IMAGE:3431786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCAC
  5   1   2       bld Egg5      in                    IMAGE:3431772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTATATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTATTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTA
  3   1   2       bld Ga12 5g3  in                         XL141n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTAATGTGCTTTTCCATTGATAGCCCCGACAGTTTAGAAAACATACTTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATNCTTTAGAGTGTT
  5   1   2       bld Lmb1                            IMAGE:8532633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTAGAAAACATACCTGAGAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCCGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAGTCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAAATACCAGTCTGCACCAGGGAATTCTGATATGAGACTGGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATACATAGTAATTACATGGTGCAATTTTGTCTTCACCATCCCCGTGCTACATT
  3   1   2      shim Ga18      in                        xlk8n11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAANNNANNCCTNAGAAATGGNCCCCGGAGGTGAANCNTTTCTNCCCCAATGTGCCCATTATTTTANTTGGAAACAAGAAGGATCTNCGTAATGATGAACACNCTCGTAGGGAGCTCNCCAAAATGAAACAGGANCCTGTGAAGCCCGAAGAAGGTCGTGNCATGGCAANCNGTANCNNNCTACGGCTACATGGAATCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGNANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNNNCNGGGAGTGCAGCAAGGGTGNNNCCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGTTCTTNC
  5   1   2       bld Lu1       out                   IMAGE:4058151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAACATACCTGAGAAATGGACCCCAGAGGTGAAACATTTTTGCCCCAATGTGCCGATTTTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTNGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGGATTGCGCACACCCACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCATGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAANAATCCTGCAAGGGATGTTTATTAAT
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3580962.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAATGGACCCCGGAGGTGAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTAAAAAAAAAA
  3   1   2       bld Gas4                            IMAGE:3421400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAAAAATTTTCTGCCCCAATGTGCCCAATATTTTTATTTGGAAAACAAAAGGAATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTNACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTC
  3   1   2       bld Ooc2      in                    IMAGE:3747289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTAAACATTTCTGCCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCAACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTTTCATTTATTCTGTTATGAGATTTTATAAA
  5   1   2       bld Kid                             IMAGE:4032254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATTTTTGCCCCAATGTGCCGATTATTTTAGTTGGGAATAAGAAGGATCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTTAAAGGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATTAATATTAGAATGGCTGGTCTTT
  5   1   2       bld Tbd4                            IMAGE:4058851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCAATGTGCCCATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGAAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAATGTCGTGACATGGCAAACCGAATCTTCGTCTACGGCTACATGGAATGCTCTGCAAATACGAAAGATGGCGTGAGGGAAGAGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAATAAAACCACGTGCCTACTCATC
  3   1   2       bld Ga15                               XL472b22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTGCCCATTATTTTAGTTGGGAAACAAGAAGGATCTGCGTAATGNTGAACACACTNGTAGGGAGCTCNCCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATNTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTGTCTTTC
  5   1   2       bld DMZ       in                         xl247n03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTATTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGT
  3   1   2       bld Ga15 5g3  in                       XL433h13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTAGTTGGAAACAAGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTA
  5   1   2       bld Ga18      in                       xlk52g13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTATTTTAGTTGGGAATAAGAAGGANCTGCGTAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTNTNNNNCATGGAATGCTCTGNAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGNAAGGGTGAAGCCCACNNNNAACGTACAGTCACAGAAAAATCCTGCAAGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTNATACCAGTCTGCACCAGGGAANTCTGATACGAGACTGGNCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCNNCTGCCTTTAATGGNGTAGTACTATATGTTGCACTTTTGNTTTCACCATCACCTTNNTCATTT
  3   1   2       bld DMZ  5g3  in                         xl284h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGGAATAAGAAGGATTTGNGTAATGATGAACNCACTCGCAGGGAGCTCNCCAAAATGAAACNGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATTTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGANGGCGTGAGGGAAGTGTTTGAGCTGGNTACNCGGGCAGCCCTGCAAGCCNGGNGNGGGAAGAAGAAAAACNCGNGCCTTTTCATTTAANTGNGAAACNNGCCGTATTGNGCNCNCNCNCAACCTGTTNTCATTGGGGGATCGGGNGCCAGCGNGCAGCAAGGGNGAAGCCCCCGGNGAAACGTACNGTCNCNGAAAAATCCTGCAAGGGANGTTTATTAATNTTTAGNGNGTTTTTACTGGCCTTTTTGTCTTTTTCATTTATTNTGNTATGNGNTTTTATAAAAAAAAAGTCATnTTGCTACCnGTATTTAAAAGTCAACGTTTTTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTNTGNCATTCCACTGTAATACCNGTNTGCACCNGGGAATTNTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCNTACTACCAACTTATTAATNTTNGCTCCTNCCTTTAA
  3   1   2       bld Ga18      in                      xlk139a24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTNNTGGAAACAAGAAGNNNNTGCGNANTGATGAANNNNCNNGTAGGGANNNNNCNAAAATGAANNAGGAGCCNNTGAAGCCCGAAGAANGTCGTGACATGGCAANCCGTATNNNNNNACGGCTACATGGANNNNCTGCAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCCTGCAAGCTAGNNGTGGCAAGAAGAAAACCANNNNCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCATTGGGAGTGCAGCAAGGGTGNNNNCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTNNNTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTNCGNCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGACCTCCTGCTTCTTAATTAGATGACGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTANNCTCTNNTCTCTAAA
  3   1   2       bld Egg3                            IMAGE:3378814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAACAAGAAGGATCTGTGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCATACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTTTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCA
  3   1   2       bld Bla1      in                    IMAGE:3381681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGAAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCA
  5   1   2       bld Ga15                               XL451o21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGATCTGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  5   1   2       bld Tbd2                   IMAGE:3200273-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAA
  5   1   2       bld Tbd2      out                   IMAGE:3200273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGTAATGATGAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTATAGTGTGCTTACTGGCCTTTTTGCCTTTTTCATTTATTCTGTTATGAGATTGTATaaaaaaaaaaaaaGTCATCTTGCTACCAGTATGTAAAAGTCAACGTCTTTTCTTTGATATATAAATATATATGTGACTTCACTGTTAGCAGATTTGCCATGCACTAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATACTGATACGAGACTGACCTTCTTTATTTCTGCTAAGCCTTCGTGGTGTCCCCCTGTTAGTCATATTTGGCCCATGCGTTACATATG
  3   1   2       bld Sp1  5g3  in                    IMAGE:4969219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATGATGACCCCACTCGTAGGGAGCTCCCCAAAATGAACCAGGACCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGTTAGGCGTGGCAAGAAGAAAACCACGTCCCTTTTCATTTAACAGAGAAACATGCCGTATTGCCCCCCCCCACCCTATTCCCATACTCCTTTGGGGCACTGGGAGTGCACCAAGGGTGAAGCCCCCGGCAAAACGTCCAGTCCCAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAGTCAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ga18      in                      xlk149h19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAATGATGAACACACTCGCAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATNNNNCATGGAATGCTCTGNAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGNAAGGGTGAAGCCCANNNNNNNCGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGNCGTTCACCTTTAAGATAAATTTAGTATATATAATATAGAATGGCTGTCTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTGCTGATTCTTTTTCAGCTTGCAAATNGGGGTCACTGACCNNTCTAAAACTAATGCTCTCTAAGGNTACAAATGTANNNNNNNTACTTTTATNNTNNTTTNTAT
  5   1   2       bld Bla1      in                    IMAGE:3381681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACACACTCGTAGGGAGCTCACCAAAATGAAACAGGAGCCTGTGAAGCCAGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAA
  5   1   2       bld DMZ       in                         xl310m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAAATGAAACAGGAGCCTGTGAAGCCCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  5   1   2       bld Oo1       in                    IMAGE:3404964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGAAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAACACGT
  5   1   2       bld Tbd7      in                         XL051m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAACAGGAGCCTGTGAAGCCTGAAGAAGGTCGTGACATGGCAAACCGTATCTCAGCCTATGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttNTT
  5   1   2       bld Tbd6                   IMAGE:4436342-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGAAGAAGGTCGTGACATGGCAAACCGTATCTCCGCCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGGACAGCAATT
  5   1   2       bld Egg1                               PBX0074G01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTACGGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATTCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCGTACTGGCCTT
  5  -1   2       chi Egg3                            IMAGE:6326796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGGTCGCGATACCTCGTTATTGTAGTTTACATACAAATCATCCGCATGTGTATCAGACTATATATAATGATAATATCGCACAGATAGCGTTGTGATGCGCCGTATTGGGCAGGGCGTCGGCTACGCAGANTGGCACACGTTTAGCTTCTGTGTCAGTTCATTTNTATCTCTGTGTCATCCTTATACTCAATATCTGCATCTCGTGTGGTTCACACGCCTGTATTCAGATCATCTGATGTACTATCGTGTGGGNCCCCACCTCCTATATATCTTCGCTCTTATGCGTGTGGTTTCGATGTGATTTCTGTGATCACTGTATAGTCTCTAGAGTATATCGTGACATCGTCTTACAGGTCTTCATTACTATTCAATTGCAGTCGGTCGGGTGTGTGCTCTAGTATTCATGCACTCATATATATTTCAGTATTACAGCTCTTATCATATACACCCTCATCTATATTTAATGTTTCNGCNTTCCTGACATGTAGCTTCGCATCATACACATCATAATACACNTNTTTGAGGGGCGTGNTAGGATGCTTCCGGTTTGATTTGCGCTAATATNGTCATCTTACAATCGCGAGTGTGTAAGTAGTATGNGCTGACATCACAACATACATCATTCTATTGTGTTCCTCCTTCACTTTCAACATGGGCGGACGTGTATCAGACAATATGCTGTGTGAGACAAAATATACGCAGCTAGAAATAGTAGATGCGCCTGCAAGATATGTATCTATGACTTTATTGTACCAATTATTCTTCTGCACAATGCAGACGCTCATCCCTATATGTTATTCCTTATTTATTATCTTAATTCATCGATCTTGGATGTGCCGGTGGAGCCAAAGATGGCttttataaatttgtgattttttatttccttccacctttttattcattcTCATTCTGTTGGGGGCCCCTAACCTCTAAAGGCGGTCAAGCGCTCCCCATTTTATACTCCTTTATGTTGTTGCAGAACAAGGCATATGTAATTTATCTTTCCGTGATAATGACTACCTATTGAAAAGTCAGTCATTCTATTTTCTATATTCTAAATTTCTCTTAATAGGTGAACGACCCCCGTAATCTACATTGCAGGAGTGTTCTTAATGCCACAGGTCTCCttttaattttattttttttaaattgtttttCCTTCCCAGTGTACAGAGTTAAAAGCTGCTCTACTTAAACCGTATAAGCTTTCAAGAAGTCATTTATCCCACTGAGCCCCCTGCTCCCTAATTTGATGAACGCACTAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGGCAGCCGTTTTTATACAAGTCTTGAATATGGCGGCAGTGGTAAACGAGCTGATAAAATCCCTTTTTACNNNNNNCGCGANTCTTAGAAAT
  3   1   2       add Ga18      in                       xlk54m10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNNNGGCTACATGGAANCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGGNNNCNGGGAGTGCAGCAAGGGTGANNCCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTANTCTTTAGAGTGTTCTTNC
  3   1   2       add Ga18      in                       xlk51b15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTANGGCTACATGGAANCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGNANNCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNNNCNGGGAGTGCAGCAAGGGTGAANNCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGNNCTTTTTNTCNTNCNTTTNTCT
  5   1   2       bld Oo1                             IMAGE:3404843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTACATGGAATGCTCTGCAAAAACGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGGCTACACGGGCAGCCCTGCAAGCCAGGCGTGGGAAGAAGAAAAACACGTGCCTTCTCATCTAACTGAGAAACATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGNTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTC
  3   1   2       bld Ga18      in                       xlk78i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACATGGNNNNNCTGCAAAANCGAAAGATGGCGTGAGGGAAGTGTTTGAGCTGNCTACACGGGCAGCCCTGNAANCTAGNCGTGGCAAGAAGAAANCCNCGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGNACACACACANCCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGNNNNNNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTNNNTNCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGNCCTCCTGCTTCTTAATTAGATGACGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTNNNCTCTNNTCNCNNAA
  3   1   2       bld DMZ  5g3  in                         xl263o17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACGAAAGANGGCGTGAGGGAAGTGTTTGAGCNGGGTNCNCGGGCAGCCCTGCAANCCNGGNGNGGGAAGAAGAAAAACNCGNGCCTTTTCATTTAANTGNGAAACNNGCCGNATTGNGCNCNCNCNCAACCNGTTNTCANTGGGGGATCGGGNGCCAGNGNGCAGCNAGGGNGAAGCCCCCGGGGAAANGTACNGTCNCNGAAAAATCCNGCAAGGGNNGTTTATTAATnTTTAGnGnGTTTTTACTGGCCTTTTTGTnTTTTTCnTTTATTnTGnTATGnGnTTTTATAAAAAAAAAGTCATnTTGnTACCnGTATTTAAAAGTCAACGTTTTTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCNTGCACCAGACTAACTNTGNCATTCCNCTGTAATACCNGTNTGCACCNGGGAATTTTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGGGTAGTACTATATGTTGCACTTTTGTNTCACCAT
  5  -1   2       bld Sp1                             IMAGE:5505813.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAGCCCTGCAAGCTAGGCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCAGGGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAAAGGGGCTCCGTATGAAATGAGACAGCCGTTTCTACTCTAATCTCAACTTGTGCAAAGC
  3   1   2       bld Ga18      in                       xlk56a22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGCTAGNCGTGGCAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCTCTGNNNNCNGGGAGTGCAGCAAGGGTGANNCCNCGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGNCCTTTTTNTCTTNTCATTTANTCTNTTATGAGNNNNATNAANAA
  5   1   2       bld Ga15                               XL477n06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCTCCGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  5   1   2       bld Ga15                               XL407o13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  5   1   2       bld Ga18      in                       xlk56a22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGAAAACCACGTGCCTTCTCATCTAACAGAGAAACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGNCNGCAAGGGTGAAGCCCANGNNNAACGTACAGTCACAGAAAAAAATCCTGGAAGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaagtcatcttgctaccagtaaaaaaaaaa
  5   1   2       bld Eye1                            IMAGE:6945744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTGAGAAAATGCCGTATTGCGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGTAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCCACTTATTAATATTTGCTCCCTGCCTTTAATGGTGTAGTACTATAATGTTGCACTTTTTGTTTTTCACCCATCACCCTTGCCTCCATTTTGAACAGGACAACCAttttttaatttttaaaaggggggccgtttcccccctttttaaaaaataaaaatttttaggttttttttttaaattttttgggaaaatgggggccttggttccctttttttccaaaaattgggggggttgtgggcccacattttaaaaattttttttaaaaaaaaaaggggggttttttttttaaaaaaaaCCCCCCCGCGTATTTTT
  3   1   2       bld Ga12                                 XL185o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAGAGAAACATGCCGTATTGCACACACACAACNTATTCCCATACTCCTATGGGGCNNTGGGAGTGCAGCAAGGGNGAAGCCCACGGCTAAAACGTACAGTCACAAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTA
  5   1   2       bld Neu2                            IMAGE:2942535.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACATGCCGTATTGCACACACACAACCTATTCCCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTAG
  3   1   2       bld Ga15      in                       XL472l16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTATTGNGCACACACACAACCTGTTCTCATTGGGGGATCGGGAGCCAGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTA
  5   1   2       bld Egg3                            IMAGE:6867390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTCCCGGGCACCACCTATTCTCTACTCCTCTGGGGACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaagaaaaagaaaaaaaaCTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAATTGTTGCCTTTGAAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGGACGGTGGATTTATTCGACTGGAACAATACTGCTGGCAGTGTTTAA
  3   1   2       bld DMZ                                 rxl317i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNCAACCTATTCCCATACTCCTTTGGGGCNCTGGGNGNGCAGCAAGGGTGAAGCCCCCGGCAAAACGNACNGTCNCAGAAAAAAATCCNGGNAGGGNNGNTTATTAATNTTTAGNGGGTTNTTACNGGCCNTTTTGTCTTTTTCANTTATTCTGGTANGNGNTTTTATAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTT
  5   1   2       bld Egg1                               PBX0147C01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTT
  5   1   2       chi Emb1                            IMAGE:6633366.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATACTCCTCTGGGGCACTGGGAGTGCAGCAAGGGTGAAGCCCACGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGNTATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCCTCTATAATATTTGCTCCTGCCTTTAAATATGTAGAATTACATGTTGCACTTTTGTCTTTCCCATTCTCCGTGCTCATTGGACAGGACAGCAATTTTTGGTTCATCTTTCAGTTTAAAAGCAACATTGCCCGGAATAAAGGGTTAACCTCCCCCGGGCTCCCTTTAAAGTTTTTTCCCTTCCCCGGGGAACAAAGTTTAAAAGCTTGCCCTCATTAAAACCCGTTAAAATGGTTTCCGAGAAAGCTTTTTTcccccttgggcccccccgggttctcttaataaaaagaaaggtgtttatttgaaaaagggcccccccaaaaaaaagaggaaaacacccccTTTTTTTATTTTCCCAAAAGCCCTCTAAAAAAAAggggggggggaaaaattccccggggggggggtttaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Brn3                            IMAGE:8538020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAATNNNNCCATAAACTGGGGNGNNGATNCATGATTCAATTCGTCCCCGTACAGTCCAGAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaagaaaaagaaaaaaaaC
  5   1   2       bld Tbd7      in                         XL071i12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGAGGGAGCCGCGTGCAGCAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgtttttttttttNTTNGATNTATAAATATATAATANG
  5   1   2       bld Egg3                            IMAGE:6324526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGGGGGGTGAAGCCCTGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCttttagtttttttCCTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAAATGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCCGTTTTTATTACTCTAGGTCTCTAAATAATGGGGGCAGTATTTCGGCAGGGGCTAAANNNcaaaaacaacaaaaaaagggcccccccccGCGGGGGAACTCCCACTTTTTGGTCCCCTTAAGGAGGGGTTAAATTTCCAACTTTGGGGAAATTCAGGGGCCTTAACTTGGTTTCCCGGGGGGAGAAAATTGTATTCCCCTCTCCATTTCTCCCCCCAACTTTACGATCnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnCG
  5   1   2       bld Ga15      in                       XL472l16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGGGTGAAGCCCACGGCGAAACGTACAGTCACAGAAAAATCCTGCAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaagtcatcttaaaaagaaaaaaaaaa
  5   1   2       bld Ga15      ?                        XL445g11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGCAAAACGTACAGTCACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaa
  5   1   2      shim Thy                             IMAGE:8547875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAAAATAAGGCCAAGGCTTAAAAAATTCGAATTCGTCCATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATATTATAGAATGGCTGTCTCTAAGCAACTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTACTGACTCTCTTTCAGCTTGCAATTGGGGGTCACTGACCCCATCTAAAACTAATGCTCTCTAAGCTACAAATGTATTGTTATTGCTACTTTTTATTACTCCTTTTTCTATTCAGCCTCTCCTATTCATATTCAAGTATCTGTATCCATGTCAATGCATGGTTGCTAGGGTAATTTGGACCTTAGCAACCATAATGCTGAAATTCCAAACTGGAGAGCTGCTGAATAAAAGCTAAACACTGA
  3   1   2       bld DMZ       in                         xl310m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAAAAAATCCNGGAAGGGNTGNTTNTTAATNTTTAGNGGGTTNTTACTGGCCNTTTTGTCTTTTTCAATTATTCTGGTANGNGNTTTTATAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACCAGCCGTTT
  3   1   2       bld DMZ       out                        xl241d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGAAAAAAATCCTGGAAGGGATGTTTATTAATCTTTAGNGNGNTNTTACTGGCCTTTTTGTCTTTTTCANTTATTCTGTTATGNGATTTTATAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGAC
  5   1   2       bld Emb4                            IMAGE:5536568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGNGCTAAANAGaaaaaagaaaaaaaCTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTGAATCGCTGTCCTGGTGTGGTGTCCGTGACTACGTGGGACGGTGATATCGACTGTACATACTGCTGCATGTTAGAGGTAA
  5   1   2       bld Te2                             IMAGE:7209183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATAATATAGAATGGCTGTCTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTGCTGATTCTTTTTCAGCTTGCAAATGGGGGTCACTGACCCCATCTAAAACTAATGCTCTCTAAGGCTACAAATGTATTGTTATTGCTACTTTTTATTACTCCTTTTTCTATTCAGGCCTCTCCTATTCATATTCAAGTATCTGTATCCATGTCAATGCATGGTTGCTAGGGAAATTTGGACCTTAGCACCNATAATGCTGAAATTCCAACTGGAGAG
  5   1   2      shim Te2       in                    IMAGE:7390507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATGTTTATTAATCTTTAGAGTGTTCTTACTGGCCTTTTTGTCTTTTTCATTTATTCTGTTATGAGATTTTATaaaaaaaaagtcatcttgctaccagtatttaaaagtcaacgttttttttttctttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATAATATAGAATGGCTGTCTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTGCTGATTCTTTTTCAGCTTGCAAATGGGGGTCACTGACCCCATCTAAAACTAATGCTCTCTAAGGCTACAAATGTATTGTTATTGCTACTTTTTATTACTCCTTTTTCTATTCAGGCCTCTCCTATTCATATTCAAGTATCTGTATCCATGTCAATGCATGGTTGCTAGGGAAATTTGGACCTTAGCAACCATAATGCTGAAATTCCAAACTGGAGAGCTGCTGAATAAAAGCTAAAACACTGAAAACCCAAATAGAA
  3   1   2       chi DMZ       in                         xl225j17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNTTNTTAATNTTTAGNGGGNTTTTACTGGCCNTTTTGNNTTTTTCNNTTATTTTGGTNTGGGNNTTTANAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTT
  3   1   2       bld DMZ       in                         xl247n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATNTTTAGNGGGNTTTTANNGGCCCTTTTGTNTTTTTCNNTTATTNTGNTATGGGNNTTTANAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTT
  3   1   2       bld Te2       in                    IMAGE:7207752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCTAACTGGCCTTTTTGGTCTTTTTCATTTAATTCGTTTAGGAGATTTAATAAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATGTGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTAGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTATGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGAATGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGACTTGTTTTAATTTTTTGTGCCATTGGATAATAAAAAA
  3   1   2       bld DMZ       out                        xl311m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNTTTTANNGGCCCTTTTGTNTTTTTCNATTANTTTGGTANGNGNTTTTANAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTT
  3   1   2       bld DMZ       in                         xl226o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNTTTTANTGGCCCTTTTGNNTTTTTCNNTTNTTTTGNTNNGGGNNTTTANAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTT
  3   1   2       bld Tad1                            IMAGE:6880994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      NTTCTGTTATGGAGTATTTTTTTAAAAAAAAAAAAAAAGTGCTTCTTGNCTACCCAGTATTTAAAAGTCAACGTTTTTTTCTTGGATTTTTAAAATTTATAATATGTACCTTCACTGTTAGCAGATTTGTCCATGCACAGGACTAACTCGGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTTCTCNTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAATAGGGGTTAATTATCTTTGGGTACACGGACT
  3   1   2       bld Te2       in                    IMAGE:7391037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTGAGAGTATATTGAGTCTACGCTTGTTTTCATATCGTAGGATTAAAAAAAAAAGTATCTGTACAGTATGAAGTCACGTTCTCTTGATTATAATATTATAGTAACTCACTGTAGCAGATTGTCATGCACAGACTACTCTGACATCCACTGAATACAGTCTGCACCAGGGAANCTGATACGAGACTGGCCTCCTTTATTCTCGTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGACTTGTTTTAAGTT
  3   1   2       bld DMZ  5g3  in                         xl321a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTTATAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTT
  3   1   2       bld DMZ  5g3  in                         xl259g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GNNTTTNTAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTT
  3   1   2       bld DMZ  5g3  in                         xl235g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATAAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTNTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCNGACATTCCACTGTAATACCAGTCTGCNCCAGGGAATTNTGATNCGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTANTAATATTTGCTCCNGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTNTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTNTACGTCGCAGGGCTCCTNTTAGTTTTTTCCTTCCCNGTGTACAGAGTTAAAAGCTGCTCGACTNAAACCGTATAATGTNTCAAGAAGTCATTNATCCCANTGAGCCTCNTG
  3   1   2       bld DMZ  5g3  in                         xl237p09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTNTAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTT
  3   1   2       bld DMZ  5g3  in                         xl338p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTATAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTT
  3   1   2       bld DMZ  5g3  in                         xl305f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTATAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTT
  3   1   2       bld Tbd7 5g3  in                         XL065o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANAAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCNCTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCNTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAANTTGTATGCAAGTGTTCATGCAGACGGGC
  3   1   2       bld Ga12                                 XL161f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TANAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGAACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTT
  3   1   2       bld DMZ  5g3  in                         xl223o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTNNAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTT
  3   1   2       bld Ga15      out                      XL478k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TANAAAAAAAAAAAAAGTCATCTNGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCGATTTATCCCATTGAGCCTCCTGC
  3   1   2       bld Ga18      in                      xlk115b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TNNNAAAAAAAAAAAAAAGTCATCNTNCTACCAGTATTTAAAAGTCAACGTTTTTCTTTGATATATAAATATANANTATGTAACTTCACTGTTAGNAGATTTGTCCATGCNCCAGACTAACTCTGACATTCCACTGTNATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGNNCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTNNNNNNCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTNGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGANCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATNCTNNCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGNCTTGTTTTANNTT
  3   1   2       bld Ga18 5g3  in                       xlk55k02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANNTTTTANNAAANAAAANAAAAGNCNNCTNCTNCCAGNNNNNNAAGTNNACNTTTTTCTTNGATANATAAANANATATGNAACTTCACTGTNAGCAGnnnnnnnnATGCNCNAGNCTAACTCTGACNTTCCANNGTANNNNCAGNCTGCNCCAGGGAATTCTGATNCGAGNCTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTNTCCCCCTCTTATTAATATTTNCTCCTGCCTTNNNNTNTGTAGTATTACATGTTGCACTTNNNNNNCNCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTNTCAGTTAAGAGCAACATNGCAGGAGTAGTGTTTNCGNNGNAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAANCCGTATAATGTTTCAAGAAGTCATTTATCCCATTGANCCTCCTGCTTCTTAATTAGATGACGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATNCTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAAAAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGANNCTTNCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGNACACTGNCT
  3   1   2       bld Neu7 5g3  in                         XL039f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATA
  3   1   2       bld Tbd7 5g3  in                         XL098h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TANAAAAAAAAAAAAAGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGATATATAAATATATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAATATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTACATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTAGATGACGTGTTCATGCAGACGGGCTCCGTAGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATAT
  3   1   2       bld Ga18      in                       xlk79p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAAAAAAAAAAAGNNATCNTGCNACCAGTNTTTAAAANNNAACGTTTTTCTTGANANATAATATANATATGNANNTNACTGTTAGNAGATTNNTNCANGCNCNAGACTAACTCTGACATTCCNCTGNNNNNCNANTCTGCNCCNAGGGAATTCTGATACGAGACTGNNCTCCTTTNTTTCTCCTAANCTTCANANNNTCCCCNTCNTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGNACTTNNNNNTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGNNGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGANCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGNTNCTNNCAATGCATTTAAACCCTNNGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGNCTTNT
  5   1   2       bld Gas5      in                    IMAGE:3749445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         aaaaaaaaaGTCATCTTGCTACCAGTATTTAAAAGTCAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGGTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTNGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATG
  3  -1   2       bld Sp1       in                    IMAGE:4965735.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAATATAAATATATAATATGTAACTTCACTGGTAGCAGATTTGTCCATGCACCAAACTAACTCTGACATTCCACTGGAATACCAGTCTGCACCAGGGAATTCTGATACGAAACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGGGGCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCCCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAAAACAACATGGCAGGAGTAGTGTTTACGTCCCAGGGCTCCTTTTAATTTTTTCCTTCCCTGGGGACAGAGTTAAAAGCTGCTCGACTAAAACCGGATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGC
  3   1   2       bld Ga12                                 XL164i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATA
  3   1   2       bld Ga12      in                         XL192p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATG
  3   1   2       bld Ga12                                 XL194m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTACCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCT
  3   1   2       bld Ga12      in                         XL194n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACGTTTTTTCTTTGATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTACCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATG
  5   1   2       bld Ga12      in                         XL194n06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACGTTTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaaaaaa
  5   1   2       bld Ga12      in                         XL192p11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTCTTTGatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaaaaaa
  5   1   2       chi Emb1                            IMAGE:6636513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          tttttgatatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATAATATAGAATGGCTGTCTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTGCTGATTCTTTTTCAGCTTGCAAATGGGGGTCACTGACCCCATCTAAAGCTAATGCTCTCTAGGGCTACGGATGTATTGTTGTTGCTACTTTTTATTACTCCTTTTTCTGTTCAGGCCTCTCCTATTCATATTCAAGTATCTGTATCCATGTCAATGCATGGTTGCTAGGGAAATTTGGACCTTAGCAACCATAATGCTGAAATTCCAAACTGGAGAGCTGCTGAATaaaaagctaaaacaactgaaaaaccacaaatacaaaatgaaaGCCCATTGCCAATTCGTTTCAGAATATCACTCTCTACTCATACTAAGTTATCTCAAAGGTGGAACCACCCCTGTAATCCACATGGGCAGGAGTGGTGTTATATGTCCACAGGCGCCCCCTTTTTATTTTAACCCTCTTCTAAANTCGTTTCTTCCTTTCCCCACGGGGACCGGAGTTTAAAAGCCTGGCTCCTACTTTAAACCCGCAATAAAGCCTTTCCAAGGAACGCCATTTTATCCCCCC
  3   1   2       bld Ga15      in                       XL473o09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATATATAAATATATAATATGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCNGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATNCGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACANGTTGCACTTTTGTNTTCGCCATCTCCGTGCTCATNGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCANCATGGCAGGAGTAGTGTNTACGTNGCAGGGCTCCTNTTAGTTTTTTCCTTCCCTGTNTACAGAGTTAAAAGCTGC
  5  -1   2       bld Sp1       in                    IMAGE:4965735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             atatataaatatataatatGTAACTTCACTGTTAGCAGATTTGTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCCGGACGCGTGG
  3   1   2       bld Em10 5g3  in                    IMAGE:7983144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATATATATATGTACTTCACTGTTAGCAGATTTTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCNTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAAGAAAAAGAAAAAAAACTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGACTGTTTAATTTTGGGCANGGTATAATCAA
  5   1   2       chi Eye1                            IMAGE:6958524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATGTAACTTCACTGTTAGCAGATTTGTCCATTCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTACTTCTCCTAAGCTTCTATTTGTCTCCCCTTACTACCAACTTATTAATATTTGCTCCTGCCTTTAATGGTGTAGTACTATATGTTGCACTTTTGTTTTCACCATCACCTTGCTCATTTGACAGGACAGCAGTTTCAGTTAAAAGGGGTCGTTCACCTTTAAGATAAATTTAGTATATATAATATAGAATGGCTGTCTTTTCAATTGGTTGTCATTATTTTTATAGGTTTTAAACCGTATGCCTTCTTCTGCTGATTCTTTTTCAGCTTGCAAATGGGGGTCACTGACCCCATCTAAAACTAATGCTCTCTAAGGCTACAAATGTATTGTTATTGCTACTTTTTATTACTCCTTTTTTCAATTCAGGCCCTCTCCTTATTCATATTTCAAGTTATCTGGTATCCTTGGCAAATGGCATGGGGTGGCTTAGGGGAAAATTTTGGAACCTTTAGCCCACCCCCTAAATGGCTTgaaaatttcccaaaaactgggaaaaaactctccttaaaataaaaaaaagccttaaaaaacaaacctggaaaaaaaccccccccccaattttgaaaaaaaatggagaagagcccccaattgtttggcaaaaaaattttggttttttttcaaaaaaaaaaataattttgncccctctctcctcttaaaaaaaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL460e16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCATGCACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaagaaaaagaaaaaaaaCTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGACTTGTTTTAATTTTTTGTGGGCATTGGTTAATAAAAATTTCTAGAA
  5   1   2       bld Ga12                                 XL154e06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCACCAGNACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaagaaaaagaaaaaaaaCTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCA
  5   1   2       bld Ga15                               XL456a23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaagaaaaagaaaaaaaaCTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGTACACTGACTTGTTTTAATTTTTTGTGGCATTGGTTAATAAAAAATTTCTAGAACCAAA
  5   1   2       bld Ga15                               XL457a24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCAGACTAACTCTGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaagaaaaagaaaaaaaaCTTACCAATGGAGTAGTTTGGCAGTCAAGCACTACAGAAGTTGTTGCCTTTGAATCGCTGTCCTGGTGTGGTGTCACGTGACCTACGTGGGACGGTGATTATTCGACTGTAACAATACTGCTGCAGTGTTTAGAGGGTAAAACTTACTGTTGCTGGAATGGTCTGCAACAGATTGCTTTGCAATGCATTTAAACCCTTTTGTAGCAAAAGGGGTTAATTATCTTTGGGGTACACTGACTTGTTTTAATTTTTTGTGGCATTGGGTTAATAAAAAATTTCTAG
  3   1   2       bld Sp1  5g3  in                    IMAGE:4964595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGACATTCCACTGTAATACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTAAAAAA
  5   1   2       bld Ga15                               XL505m13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACCAGTCTGCACCAGGGAATTCTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAACATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTGTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATTTGATGAAGTGTTCATGCAGACGGGCTCCGTATGAAATGAGACAGCCGTTTTTATACTCTAAGTCTCTAAATATGGTGGCAGTAGTCGGCAGGGGCTaaaaaaaaaaaagaaaaaaaaaa
  3   1   2       bld Egg1                            IMAGE:3301952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCACCAGGGAATTTTGATACGAGACTGGCCTCCTTTATTTCTCCTAAGCTTCATAGTGTCCCCCTCTTATTAATATTTGCTCCTGCCTTTAAATATGTAGTATTACATGTTGCACTTTTGTCTTCGCCATCTCCGTGCTCATTGGACAGGACAGCAATTTTGGTTCATCTTTCAGTTAAGAGCAATGGCAGGAGTAGTGTTTACGTCGCAGGGCTCCTTTTAGTTTTTTCCTTCCCTGTGTACAGAGTTAAAAGCTGCTCGACTAAAACCGTATAATGTTTCAAGAAGTCATTTATCCCATTGAGCCTCCTGCTTCTTAATT