Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4930148.5                       9 END     2           0       22                (no blast hit)

 This cluster: approximate FL confidence score = 68%

 1012767143 Xl3.1-XL436m19ex.5 - 262 ESTs
                                                                       ......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL436m19ex.5                                                                                                                                                                                                                                                       GGCACAGGGTGAGGGGCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGAAAAAAAA
                                                  Xl3.1-CHK-1012685104                                                                                                                                                                                                                                                             GGGTGAGGGGCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                            3     4     5     6     8    11    11    18    40    51    61    76    71    90    82   101    85   104    86   105    94   108    96   109    96   109    97   110    98   110    98   110    97   108    96   108    97   111    96   111   100   116   101   120   100   121   107   126   120   141   126   148   128   153   128   160   149   168   157   175   150   178   158   177   154   180   160   185   163   188   179   200   175   203   171   206   185   206   185   206   179   208   188   217   202   221   204   222   205   224   207   225   210   225   211   223   207   226   216   227   213   226   205   223   207   221   208   223   206   221   209   222   202   215   195   215   197   212   190   206   188   205   186   198   173   189   157   169   151   164   146   162   130   155   137   153   136   154   137   154   135   152   135   151   135   151   129   148   131   146   128   143   127   142   123   140   120   139   117   139   112   137   110   135   106   130    95   121    54    74    29    41    28    34    10    19     4    10
                                                                   VAR                                                                                                                                                                                                                                                                                                       TCTCCTCACTGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                               BLH MIN      36      50                                                                                                                                                                                                                                                       
                                               BLH OVR      63      83                                                                                                                                                                                                                                                       
                                               EST CLI      36      62                                                                                                                                                                                                                                                       
                                               ORF LNG      63       3                                                                                                                                                                                                                                                       
                                                                                                                                                  PROTEIN --- Ci ---- 8e-025     NP_001122330.1 HMG transcription factor SoxB1 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 1e-024     NP_989664.1 SRY (sex determining region Y)-box 1 [Gallus gallus] ---------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 7e-025     NP_510439.1 SOX (mammalian SRY box) related (sox-3) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 6e-025     XP_001918814.1 PREDICTED: hypothetical protein [Danio rerio] ==========================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 5e-025     NP_648694.1 CG7345-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PREDICTED - Cf ---- 4e-027     XP_546592.2 PREDICTED: similar to Zinc finger and BTB domain containing protein 4 (KAISO-like zinc finger protein 1) (KAISO-L1) [Canis familiaris] ====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED - Bt ---- 4e-027     XP_582242.1 PREDICTED: similar to SRY-box 15 [Bos taurus] ----------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Sp ---- 2e-027     NP_999639.1 transcription factor SoxB1 [Strongylocentrotus purpuratus] ------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 6e-028     NP_033261.1 SRY-box 15 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 3e-028     NP_008873.1 SRY (sex determining region Y)-box 15; SRY (sex-determining region Y)-box 15;SRY (sex determining region Y)-box 20 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Xt ---- 2e-079     NP_001120046.1 hypothetical protein LOC100145022 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 6e-116     NP_001081201.1 Sox-D protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL436m19ex.5                                                                                                                                                                                                                                                                TGA------------------------------------------TGA------ATG------------------------------------------------------------ATG---------ATG---------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---------------------------------TGA------------------------------------TGA------------------------------------------TAATAG------------------------------------------------------------------ATG------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TAGATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       chi Eye1                            IMAGE:6946836.5p                                                                                                                                                         CTGGTCCGGTCCGGAATTTTCAGAATGGTTTAGGAGCAGCAGAGCTTTGCTTGGCCccggggcggcggaggaggagggggaggggagagtgaggggcacagggtgaggggCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggagctcgcgagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCATCAGCAACAGCATCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGGCGCCCCGGAGTCCTTCCTACCCGTCTGTCAAGTGACCATGTCTCTGCCCCTTTTATGAACTTTTTGGACTTGGAATGAATTACcgggggagttaccagggggggcttccaggcatccagggggcCGAGATACCTAAACCCCTCTGTAAATTTGGGTAGAGGGAACCCCTCTTTTCCCTTCAGGTACCCTTTTTAGACATCCCCGGGTGCACCTTTAAATGGGGACACCACTTTCCCGTAAGGGTGCCTTCCCNGCTTCCTTACTTCGACTTTTGCAGATACTTAAGAGGGGCTAATCCCCCTCTCCTGAGGCCACAGCCCGTTCCCTTGGTAATAGGCGTAATGGGACCCCTTGACAGACGTACTGCTCTCTATCGCCCAGTGCTGCTCCCGCGCGTAAGTA
  3  -1   2       chi Ga11                            IMAGE:3475151.3p                                                                                                                                                                                                                   CTGGAGCTAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGGCTTCTCCTCACTGACTCCTCATGTATCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAACAGACTTCGGGCTGAAGGCGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGGTTTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACNCAGAGCTTTTTGGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCCGTCTGTCA
  5   1   2       bld Ov1  5x3                        IMAGE:8330398.5p                                                                                                                                                                                                                          cggaggaggagggggaggggagagtgaggggcacagggtgaggggCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGNATACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCCTGACCCTGTGACTGAATGGGACATTCCGAGGGTCTCCACTCTTATGACTTATAATCTAGGG
  5   1   2       bld Neu7 5g3  in                         XL019i07.5p                                                                                                                                                                                                                                            CACGAGGGAGGGGCACAGGGTGAGGGGCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGG
  5   1   2       bld Ga12 5g3  in                         XL188g19.5p                                                                                                                                                                                                                                                           GAGGGTGAGGGGCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCACCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTG
  5   1   2       bld Ga12 5g3  in                         XL186n19.5p                                                                                                                                                                                                                                                             GGGTGAGGGGCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGT
  5   1   2       bld Ga15 5g                            XL454h02ex.5p                                                                                                                                                                                                                                                                     GGCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCA
  5   1   2      seed Ga15 5g3  in                       XL477k06ex.5p                                                                                                                                                                                                                                                                      GCTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGA
  5   1   2       bld Te2N 5x3                        IMAGE:7203781.5p                                                                                                                                                                                                                                                                       CTGCCGGACTGATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGANCCCGCCTTCACTGAAACCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACAAGTGGCCTTATTGTGAAGGCTCCTCCCCCTGGCGGCAGCTATGGGCATTTCAATTATCCGTTTCCTGGAAAAGATTTTGGGGGCGTCGGAAT
  3  -1   2       bld Ga11                            IMAGE:3474871.3p                                                                                                                                                                                                                                                                             GAAGCTCAGAATAAACGCTCAACTTTGGCAGTTCTGCCTTCCCCGGGCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTAC
  5   1   2       bld Ga18      in                      xlk157b15ex.5p                                                                                                                                                                                                                                                                              TGCCGATNATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGAATCCCCCGNANNNAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGNNNCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCNNNNNGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGNCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGNTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGNCTCCGCTCTACTGACTTGAGNATCTAGGGGNNCCCACTGTGAGGGGNGCATGATGGGNTGGANCTGANCCCGCCTTCACTGAAACCCCAGGACCTTANTAGAGGNGTGGNCCTAGNNG
  5   1   2       bld Ga12 5g3  in                         XL169d11.5p                                                                                                                                                                                                                                                                                 GCTGATNGTTGGACCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCC
  5   1   2       bld Gas5 5g                         IMAGE:3749751.5p                                                                                                                                                                                                                                                                                  ATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTACCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTNTATGGCTTTGGACTGTACGATTACGGNGAGCACAAGGGGGTTCAGCAACAGGTCCAGTACCAAACC
  5   1   2       bld Gas5 5x3                        IMAGE:3748889.5p                                                                                                                                                                                                                                                                                  ATCAGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTNCCCTACCCCCCGCGCACGGAGTACTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTCATGGCTTCGGACTGTACGATTACAGGGAGCACCAGGGGGTTCAATAACAAGTCCAGTACCAAACCCTGGTAGTGGGAGGGAACCTTTTCACTGACCTC
  5   1   2       bld Tbd7 5g3  in                         XL095h20.5p                                                                                                                                                                                                                                                                                     GGTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGA
  5   1   2       bld Tbd7 5g3  in                         XL105b03.5p                                                                                                                                                                                                                                                                                       GTTGGACCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGATGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCAGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGA
  5   1   2       bld Ga18      in                       xlk57l04ex.5p                                                                                                                                                                                                                                                                                           TTNNNNNAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGAATCCCCCGNANNGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGNCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCNNNNGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACGCTGGNAGTGGAGGGAANCTCTTTTCACNGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGNCTCCGCTCTACTGACNTGAGAATCTAGGGGNNCCCACTGTGAGGGGNNCATGATGGGNNNGANNNACCCCG
  5   1   2       bld DMZ  5g3  in                         xl265d11.5p                                                                                                                                                                                                                                                                                           CCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGATGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAANANGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCANAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCNGNANCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCANTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACNGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAAT
  5   1   2       bld DMZ  5g3  in                         xl244e10.5p                                                                                                                                                                                                                                                                                            CCCAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCC
  5   1   2       bld Ga15 5g3  in                       XL446l04ex.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTA
  5   1   2       bld Ga15      in                       XL485c02ex.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCANGGACCTTAATANAGGTGTGGCCCTANTGG
  5   1   2       bld Ga15 5g3  in                       XL488m16ex.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCANCAACAGNAGCCCCAGTACAGNGGATACCANGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAG
  5   1   2       bld DMZ  5x3                             xl223m15.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCA
  5   1   2       bld DMZ  5g3  in                         xl293p02.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCC
  5   1   2       bld DMZ  5g3  in                         xl293p09.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCG
  5   1   2       bld DMZ  5g3  in                         xl294n07.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGAT
  5   1   2       bld DMZ  5g3  in                         xl294p02.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCC
  5   1   2       bld DMZ  5g3  in                         xl224k03.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCG
  5   1   2       bld DMZ  5g3  in                         xl251c17.5p                                                                                                                                                                                                                                                                                              CAGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCG
  5   1   2       bld Emb1 5x3                        IMAGE:6863408.5p                                                                                                                                                                                                                                                                                               AGGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAAGTGTGGCCCCTAGTGGGCGGGACCCAGTGGCCTTATTTGTGGAGGCTCCCTTCCCCCTGCCCGGCAGCTATGGGGCATTTCATTATTCCCGTTACTGGAAAAAGATTTTT
  5   1   2       bld DMZ  5g3  in                         xl303d08.5p                                                                                                                                                                                                                                                                                                GGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGAACCTGACC
  5   1   2       bld DMZ  5g3  in                         xl238n03.5p                                                                                                                                                                                                                                                                                                GGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCC
  5   1   2       bld DMZ  5g3  in                         xl264n21.5p                                                                                                                                                                                                                                                                                                GGCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGA
  5   1   2       bld Ov1  5x3               IMAGE:6316186-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                 GCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATG
  5   1   2       bld Ga15 5g3  in                       XL451f21ex.5p                                                                                                                                                                                                                                                                                                 GCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTANTG
  5   1   2       bld Ga15 5g3  in                       XL519d08ex.5p                                                                                                                                                                                                                                                                                                 GCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGG
  5   1   2       bld Ga15 5g3  in                       XL488a14ex.5p                                                                                                                                                                                                                                                                                                 GCTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGA
  5   1   2       bld Ga15 5g3  in                       XL412i17ex.5p                                                                                                                                                                                                                                                                                                  CTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTANTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGC
  5   1   2       bld Ga15 5g3  in                       XL439g22ex.5p                                                                                                                                                                                                                                                                                                  CTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGA
  5   1   2       bld Ga18 5g3  in                      xlk163c16ex.5p                                                                                                                                                                                                                                                                                                  AGGNTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGAATCCCCNNNNNNGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGNCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCNNNNGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAANCTCTTTCACGGANCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCNCTGTGAGGGGNGNATGATNNNTGGNCCTGACCCCGNCTTCACTGAAA
  5   1   2       bld DMZ  5g3  in                         xl289m14.5p                                                                                                                                                                                                                                                                                                  CTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGA
  5   1   2       bld DMZ  5g3  in                         xl288m14.5p                                                                                                                                                                                                                                                                                                  CTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGANCCCG
  5   1   2       bld DMZ  5g3  in                         xl239n06.5p                                                                                                                                                                                                                                                                                                  CTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCANGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGNTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATNCCACTGTGAGGGGTGCATGATGGGATG
  5   1   2       bld DMZ  5g3  in                         xl258i24.5p                                                                                                                                                                                                                                                                                                  CTTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGNTCTCTCCCCCCACCGACCCACAANTGCNNCAGCAACANCAGCCCCNGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACNGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGA
  5   1   2       bld DMZ  5g3  in                         xl257n23.5p                                                                                                                                                                                                                                                                                                   TCGATTCGCTGACTCCTCATGTCTCCGACCCACGTATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCC
  5   1   2       bld Ov1  5x3                        IMAGE:6316186.5p                                                                                                                                                                                                                                                                                                     CTCCTCGCTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGGAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTcccctacccccccgcgccccGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCCCGGGACCTCTGAACCCTGTGACTGAATGGGACATTCCGAGGGGTTCCGCTCTATTGACTTGAGAATCTAGGGGATCCCCCTGGGAGGGGTGCCTGATGGGAATGGACCTGGACCCCGCCTTCCCTTGAACCCCCGGGAACTTTAATAGAggggggggccctagggggggggCAACCAAGGGGGCCCTTCATGGTGGGAGAGCTCCTTCCCCCCCTGGCCGGGAGCCTAAGTGGGCAATTTTCTTTGTATTCCCGGTACCCTGGGAAAAAGAATTTTGGGGGGGCGGTCGCGCGACCCTTGGGTGTAAGAAAATTAAA
  5   1   2       bld Ga18      in                       xlk57j12ex.5p                                                                                                                                                                                                                                                                                                      TTCTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGAATCCCCCNANNNGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCNNNNNGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGNACAGGGGGGTTCAGCAACAGGNCCAGTACCAAANCCTGGAAGNNNNNNNACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACANTCCGAGGG
  5   1   2       bld Ga12 5g3  in                         XL214j05.5p                                                                                                                                                                                                                                                                                                       CGAGGCTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAA
  5   1   2       bld Ga18      in                       xlk65a02ex.5p                                                                                                                                                                                                                                                                                                       TTCTCCTCACTGACTCCTCATGTCTCCGANCCACGATCCCCCCGGAATCCCCNGNNNNGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGNCNCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCNNNNNGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGANGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAANCTCTTTCACGGANCTCTGACCCCTGTGANTGAATGGGANATTNCGAGGGTCTCCNNTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGANNGNCCTGACCCCGCCTNCACTGAAA
  5   1   2       bld DMZ  5g3  in                         xl223k14.5p                                                                                                                                                                                                                                                                                                       CCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCC
  5   1   2       bld DMZ  5g3  in                         xl261h20.5p                                                                                                                                                                                                                                                                                                       CCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCG
  5   1   2       bld Ga12 5x3                             XL211j13.5p                                                                                                                                                                                                                                                                                                        GAGGCTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACAT
  5   1   2       bld Ga15 5g3  in                       XL477e18ex.5p                                                                                                                                                                                                                                                                                                        CTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATANAGGTGTGGCCCTA
  5   1   2       bld DMZ  5g3  in                         xl243m21.5p                                                                                                                                                                                                                                                                                                        CTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCANAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCANAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCC
  5   1   2       bld DMZ  5g3  in                         xl248p02.5p                                                                                                                                                                                                                                                                                                        CTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTT
  5   1   2       bld DMZ  5g3  in                         xl263o11.5p                                                                                                                                                                                                                                                                                                        CTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGG
  5   1   2       bld DMZ  5g3  in                         xl234o10.5p                                                                                                                                                                                                                                                                                                        CACTGACTCCTCATGTCTCCGACCCACGAATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGATGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCANGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCNCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGANGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCNACTGTGAGGGGTGCATGATGGGATGGACCT
  5   1   2       bld Ga18      in                      xlk125c21ex.5p                                                                                                                                                                                                                                                                                                         CTCCTCACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGAATCCCCNNNAGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGNCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCNNNNNGAAACGCAAAGACAAggggggggAGCTCNCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGNAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGNACAGGGGGGTTCAGCAACAGGTCCAGTANCAAACCCTGGAAGTGGAGGGAANCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGANNTTNCGAGGGTCTCCNNTCTACTGACTTGAGNANCTAGGGGATCCCACTGTGAGGGGNG
  5   1   2       chi DMZ       out                        xl323h07.5p                                                                                                                                                                                                                                                                                                         CACTGAACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGTCTTCAGCAGAGAAGGTAATCCAAAGGAGTTAATATCAGACAATATCAGACGATGGACCACAGTTTGTCTCATCGGAGTTTGAATCCTTTCTGAGAGAGAGGAATATTGTGCCTGGAAATCTTCAGTGTATTACCCACAAGCAAATGGAGAAATCGAGCGATTCAACAGAAGTCTGAAAGAAACACTACAGGCAGCAAATCTTACTGGGAAAGTATTTACAACAGAGTTCCTACATAACTACAGAGCAACGTGCCATGCAACAACCCAATCATCTCCAGC
  5   1   2       chi DMZ       out                        xl246l08.5p                                                                                                                                                                                                                                                                                                          CACTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGTCTTCAGCAGAGAAGGTAATCCAAAGGAGTTAATATCAGACAATATCAGACGATGGACCACAGTTTGTCTCATCGGAGTTTGAATCCTTTCTGAGAGAGAGGAATATTGTGCCTGGAAATCTTCAGTGTATTACCCACAAGCAAATGGAGAAATCGAGCGATTCAACAGAAGTCTGAAAGAAACACTACAGGCAGCAAATCTTACTGGGAAAGTATTTACAACAGAGTTCCTACATAACTACAGAGCAACGTGCCATGCAACAACCCAATCATCTCCAGCAGAATTATTACAT
  5   1   2       bld Neu7 5g3  in                         XL034a24.5p                                                                                                                                                                                                                                                                                                            CTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCC
  5   1   2       bld Ga15 5g3  in                       XL516b23ex.5p                                                                                                                                                                                                                                                                                                            CTGACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATANAGGTGTGGCCCTA
  5   1   2       bld DMZ  5g3  in                         xl237d24.5p                                                                                                                                                                                                                                                                                                            CTGACTCCTCATGTCTCCGACCCNCGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGNGCGGCCTCGGGGAGGAGGATCGGANACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCANGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCANAACTGCAGCAGCAACAGCAGCCCNAGTACAGCGGATACNAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAAT
  5   1   2       bld Ga15 5g3  in                       XL452i05ex.5p                                                                                                                                                                                                                                                                                                               ACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTG
  5   1   2       bld Ga15 5g3  in                       XL518p06ex.5p                                                                                                                                                                                                                                                                                                               ACTCCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATANAGGTGTGGCCCTAGTGGGCGGTACCAA
  5   1   2       bld Ga10      in                    IMAGE:3558131.5p                                                                                                                                                                                                                                                                                                                 CTTCAGtcccccgncccacnatccccccgggnaatcccccNGAGGNAAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCCAGTGCCGTGTCTGCGCTTTA
  5   1   2       bld Ga12 5g3  in                         XL161d24.5p                                                                                                                                                                                                                                                                                                                 GCTCATGTCTCCGACCCACGATCCCCCCGGGNAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCAC
  5   1   2       bld Ga12 5g3  in                         XL144l16.5p                                                                                                                                                                                                                                                                                                                  GCTCATGTCTCCGACCCATGATCCCCCCGGGNAATCCCCCGAAGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTC
  5   1   2       bld Ga12 5g3  in                         XL199e18.5p                                                                                                                                                                                                                                                                                                                  GCTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCANGA
  5   1   2       bld Ga12 5g3  in                         XL180i06.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATC
  5   1   2       bld Ga12 5g3  in                         XL182j22.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCA
  5   1   2       bld Ga12 5g3  in                         XL199c09.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACT
  5   1   2       bld Ga15 5g3  in                       XL435h24ex.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCCAGGAACCTTAATAGAGGT
  5   1   2       bld Ga15 5g3  in                       XL515i13ex.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGG
  5   1   2       bld DMZ  5g3  in                         xl294d22.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACC
  5   1   2       bld DMZ  5g3  in                         xl327e03.5p                                                                                                                                                                                                                                                                                                                   CTCATGTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGANGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGA
  5   1   2       bld Ga12 5g3  in                         XL169m24.5p                                                                                                                                                                                                                                                                                                                    GCTATGTCTCCGACCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACA
  5   1   2       bld Gas5                            IMAGE:3749201.5p                                                                                                                                                                                                                                                                                                                        GTCTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGTGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggagctcgcgagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTACCCTACCCTCCGCGCGCGGAGTCCTTCCTACCGTCTGTCAGTGACGTGTCTGCGCTATATGGCTATGGACTGTACGATTACAGGGAGCACAAGGGGGTTCAGCAACAAGTTCAGTACCCAACCCTGGTAGTG
  5   1   2       bld Ga15      in                       XL499d13ex.5p                                                                                                                                                                                                                                                                                                                        CTCCGACCCACGATCCCCCCGGGAAATCCCCCGAAGGAGAGCGGCCTAGCTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCNAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCNGGAAGAGGCGAANAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCNCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACNGA
  5   1   2       bld Egg3                            IMAGE:6324993.5p                                                                                                                                                                                                                                                                                                                         GAATTCCCCGGGCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGAGAGCTCGCGAGCAACAGACACGCGCCgacccctcctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAACAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACGCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGGAAAGATTTGGGGGCGTCGGATCTTGTTAGatttaaaggtttttggtttttagggaaaacttggggacgtttttttGTCGCACACACTGTGAACCCCCT
  5   1   2       bld Ga18      in                      xlk166p23ex.5p                                                                                                                                                                                                                                                                                                                         CATGTCTCCGACCCACGATCCCCCCGGAATCCCCNGNAGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGNCNCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCNNNNNGAAACGCAAAGACAAggggggggagctcgcgagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGNACAGGGGGGNNCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTNCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGG
  5   1   2       bld Ga15      in                       XL446g24ex.5p                                                                                                                                                                                                                                                                                                                          CTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCTAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAA
  5   1   2       bld Ga15      in                       XL454m15ex.5p                                                                                                                                                                                                                                                                                                                          CTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCA
  5   1   2       bld DMZ       in                         xl284m11.5p                                                                                                                                                                                                                                                                                                                          CTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCT
  5   1   2       bld DMZ       in                         xl285m11.5p                                                                                                                                                                                                                                                                                                                          CTCCGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCC
  5   1   2       bld Ga15      in                       XL401l14ex.5p                                                                                                                                                                                                                                                                                                                             CGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGANAATC
  5   1   2       bld Ga15      in                       XL458i14ex.5p                                                                                                                                                                                                                                                                                                                             CGACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCC
  5   1   2       bld Te2       in                    IMAGE:7207385.5p                                                                                                                                                                                                                                                                                                                              GACCCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGAGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCCTGTGAGGGGTGATGATGGGATGGACTGACCCGCCTTCACTGAACCCAGGACTTATAGAGTGTGGCCTAGTGGCGTACAGTGGGCTATGTGAGCTCTCCCCTGCGACTATGCATCATATCGTACTGAAGATGGGTCGACTGTAGATAGGTTGTTTTAGACTGAGTTGCCC
  3   1   2       bld Ga18      in                      xlk157b15ex.3p                                                                                                                                                                                                                                                                                                                              CGNCCCACGNNNCCCCGGGAATNCCCCGANGNAGAGCNGCCTAGTGNNGCNGCCAATGANNNCCTTTATNNNTTGNTCGAGNGGCGAGAGGAAGNNCATGTCNNCCCTNNACCCCAAGATGCACAACTCCGAGATNAGTCGCCGACTCGGGGAGATCTGGCGCGNCNTCGGGGAGGAGGATCGNAGACCTTTCNGGGAAGAGNCGAAGAGACTTCGGGCTCAACACGCGATAGNCTTCCCGGGATACAAGTACNCNCCCCGCAAGAAACGCAAAGACAAGGGGGGNGAGCTCGCGANCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCANCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGANCCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGNTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGNGNCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGNCCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTNNNNNNCTAGTGA
  5   1   2       bld Ga12      in                         XL162o02.5p                                                                                                                                                                                                                                                                                                                               CACGATNCCCCCCGGGAATCCCCCGAAGGTAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCAGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCG
  5   1   2       bld DMZ       in                         xl291b04.5p                                                                                                                                                                                                                                                                                                                                CCACGAATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTT
  5   1   2       bld DMZ       in                         xl241l18.5p                                                                                                                                                                                                                                                                                                                                 CCACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCC
  5   1   2       chi Emb1                            IMAGE:6634561.5p                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGGGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGGCTCCGCTCTACTGACTTGGAAATCTAGGGGGATCCCCTTGGTGAGGGGTGGCTGATGGGGATGGGACCTTGACCCCGGCTTTCCTTGGAAACCCCCGGGAACCTTTATAAAAAggggggggggccccatagggggggcgcggcccccaggggggccctttattggggggggggTTTTTCCCCGCCTTGGTGGGGGGAAGGATGTGGGGGGATTTTTTCCTTTATTCCCCCCGGTCGCGGGaaaaaaaaaTTTTGTGGGGGCGCGCCGCATTCTCTTTGTGTTTAAAAATTAATAAGGGGGGGCCTTTGTGCCCCCATCAT
  5   1   2       bld Ga12      in                         XL183n13.5p                                                                                                                                                                                                                                                                                                                                  CACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggagctcgcgagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCC
  5   1   2       bld Ga12      in                         XL204h12.5p                                                                                                                                                                                                                                                                                                                                  CACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggagctcgcgagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGG
  5   1   2       bld Ga15      in                       XL452o17ex.5p                                                                                                                                                                                                                                                                                                                                  CACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAAT
  5   1   2       bld Gas5      in                    IMAGE:3751273.5p                                                                                                                                                                                                                                                                                                                                   ACGATCCCCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTGCCCTACCCCCCGCGCCCGGAGGTCTTCCTCCCGTCTGTCAGC
  5   1   2       bld DMZ       in                         xl233c08.5p                                                                                                                                                                                                                                                                                                                                     GATCCNCCCGGGAATCCCNCGAAGGANAGCGGNCTAGTGAANCGGCCAATGAACGNCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCNNAGATGCACAACTCCNA
  5   1   2       bld Ga15      in                       XL407n06ex.5p                                                                                                                                                                                                                                                                                                                                       TCCCCCCGGGAATNCCCCGAAGGAGAGCGGNCTAGTGAAGCGGNCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAANCGNATGTCCGCCCTGCACCCCAAGATGCACAANT
  5   1   2       bld Ga15      in                       XL407h02ex.5p                                                                                                                                                                                                                                                                                                                                         CCCCGGGAATCCCCCGAAGGAGAGCGGCCTAGCTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGNGAGCAANATACNCTCNCCGACCCCTCNTGCTGCTCCCCGACCCCCANNNCTCTCTCCCCCCACCGACNCAC
  5   1   2       bld Ga18      in                      xlk122o06ex.5p                                                                                                                                                                                                                                                                                                                                           ATCCCCCCGAATCCCCNNNAGNGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGNCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCNNNNNGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGNGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGNCCAGTACCAAANCCTGGAAGTGGAGGGANNCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGANNNTCCGAGGGTCTCCNCTCTACTGACTTGAGNATCTAGGGGNTCCCACTNNNAGGGGNNC
  5   1   2       bld Neu2      in                    IMAGE:2942748.5p                                                                                                                                                                                                                                                                                                                                            CCGGGAATCCCCCGAAGGAGAGCTGCTTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTGCGCGACCCCCAGCGCTGTGTCCCGCCACCGACCCACAGACTGCGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGTACCTGCCGTACCCGCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTATGGACTGTACGATTACAGAGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGAGAACCTCTGTCACAGACCTGTGACCCCTGTGACTGAATGGAACATTTCGAGGGTCTGCGCTCTACTGACTGGAGAGTCTAGGGATACCACTGTAGGGGTGCATGGATGGATGGACCTGACCGGCCTTGACGTGACCGCCAGGACCTAGTAGAGGTGGGCCGTAATGGCGG
  5   1   2       bld Ga10      in                    IMAGE:3558268.5p                                                                                                                                                                                                                                                                                                                                                  ATCCCCCGAAGAGAGCGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCtttttttttAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATT
  5   1   2       bld Ga15      in                       XL401k13ex.5p                                                                                                                                                                                                                                                                                                                                                       CCGAAGGAGAGCGGCCTANTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggagctcgccagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccACCNANCCANAACTGC
  5   1   2       bld Ga12      in                         XL205k15.5p                                                                                                                                                                                                                                                                                                                                                           GGGATCGTGGCCTAGTGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAAT
  5   1   2       bld Neu7      in                         XL045f21.5p                                                                                                                                                                                                                                                                                                                                                                     TGCAGGNAATTCGGCACGAGGCGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACC
  3   1   2       bld Ga18      in                       xlk65a02ex.3p                                                                                                                                                                                                                                                                                                                                                                        ANGCGGCNNNTNNNNNCCTTTATGGTTTGNNCNNNNGNNGAGAGGNAAGCGCATGTCCNNNCCTNCACCCCCAANNTGCACAACTCCGAGNTTANTCGCCGACTCGGGNAGNTCTGNNGNGGCNTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGNCTCAACACGCGATAGNCTNCCCCGGGATACAAGTACNNNCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGnGCTCTCTCCCCCCACCGACCCACAACTGCAGCANCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGNCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTNCTAGTGATNTTNNTAANA
  5   1   2       bld Ga15      in                       XL406h02ex.5p                                                                                                                                                                                                                                                                                                                                                                          TGAAGCGGCCAATGAACGCCTTTATGGTTTGGTCGAGCGGAGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCNAGATTAGTCNCCGACTCNGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACTAGTACNCGCCCCGC
  5   1   2       bld Ga15      in                       XL479c17ex.5p                                                                                                                                                                                                                                                                                                                                                                                        AACGCCTTTATGGTTTGGTCGAGCGGCGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggagctcgcgagcaacagacacacgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAA
  5   1   2       bld Ga15      in                       XL431l20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGAGGAAGCGCATGTCCGCCCTGCACCCCAAGATGCACAACTCCGAGATTAGTCGCCGACTCGGGGAGATCTGGCGCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAAGATTTGGGGCGTCGGATCTTGTTANAAT
  3   1   2       chi Ga18      in                       xlk57j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNAGTCGCCGNCTCGGNNNNTCTGnnnnnnnnnGGGNNNGAGGATNGNGACTTTCNGGNANNAGNNGAAGAGNCTTNGGGCTCANNACGCNANANNCTTNCCGGGATANAAGTACNNNNCCNCAAGAAANGCAAAGACAAGGGGGGGGGAnCTCGCGAGCAACAGACACACGCCGnCCCCTCnTGCTGCTCCCCGACCCCCAGnGCTCTCTCCCCCCACCGACCCACAACTGCAGCANNAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTNCCTCCCCTNCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGNTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGNNNNCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATG
  3   1   2       bld Ga18 5g3  in                      xlk163c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCNNCGACTNNGNNNGNTCTGNNNNNNNCGNGGAGNNGGATNGNAGACCTTTCCGGGAAGAGNNNNNGAGACTTCGGNCTCAACNCNCGANAGNCTTCCCGGNATANAAGTACNNNCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAnCAACAGACACACGCCGACCCCTCCTnCTGCTCCCCGACCCCCAnnGCTCTCTCCCCCCACCGACCCACAACTNNAGCANNAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTNCCTCCCCTNCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGNTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTNCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGNNNNNTAGTGAT
  3   1   2       chi Ga15      in                       XL485c02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGAGATTNTGGNNNGGCNTNGGGGAGGAGGATNNNGANNCCNNTTTCNGGGAAGAGGGNGAAGANANTTNGGGNTNAACANGNGATANNNTTCCCGGGATACAAGTACGNNCCCCGCAAGAAANGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGNTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTT
  5   1   2       bld DMZ       in                         xl322l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTANGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTA
  5   1   2       bld DMZ       in                         xl282a10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTANGG
  5   1   2       bld DMZ       in                         xl262m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGGCCTCGGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGG
  3   1   2       chi Ga18      in                       xlk57l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNGGGNNNGAGGATNGNAGACCTTTNCNGGGNAGAGNNGANNAGNCTTNGGGCNCANCNCNNNATAGNCTTCCCGGGANNNAAGTNNNNNCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAANAGACANACGCCGACCCCTCCTGCTGCTCCCCGNCCCCCAGNGCTCTCTCCCCCCACCGACCCACAACTGCAGCANNAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTNCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACGCTGGAAGTGGAGGGANCCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGNTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGNGNNCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGNCCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGNTTCTAGTGATNTTT
  3   1   2       bld DMZ  5g3  in                         xl223k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCGGGAGGAGGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGAGTT
  3   1   2       chi Ga18      in                      xlk166p23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGNNNNGATNGNAGACCTTTNNGGAAGAGnnnnnnnnCTTNGGGCTCAACNNNNNANNGNCTTCCNGGGATNNNAAGTACNNNCCCCNCANNAAACGCAAAGNNAAGGGGGGGGAGCTCnnGAGCAACAGACACACGCCGACCCCTCCTGCTnCTCCCCGACCCCCAGnGCTCTCTCCCCCCACCGACCCACAACTGCAGCANNAACAGCAGNCCCAGTACAGCGGATACCAGGAGCTCTATGGGTNCCTCCCCTNCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTNCCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGNCCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGNTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGNGNCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGNCCCCCATTCTTTTTATAGCAAAGNCTTTACTGAAACTNGAGTTTGTNNNNNNCTAGTG
  3   1   2       bld Ga18      in                      xlk125c21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATCGNNGACCTTNNCGGGAAGAGNCGAAGAGACTTCGGGCTCAACACGCGATAGNCTTCCCGGNATACAAGTACNNGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAAnAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGnGCTCTCTCCCCCCACCGACCCACAACTGCAGCANNAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTNCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGNCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGNCCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGNNTTCTAGTG
  5   1   2       bld DMZ       in                         xl322l09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTT
  3   1   2       bld DMZ  5g3  in                         xl303d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATCGGAGANCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ       in                         xl282a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGGAGACCTTTCCGGGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Ga15 5g3  in                       XL515i13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAAGAGGGNGAAGANANTTNGGGNTCAACACGNGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAANGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTT
  3   1   2       bld DMZ  5g3  in                         xl294d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAGAGGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTC
  3   1   2       bld DMZ  5g3  in                         xl293p09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ  5g3  in                         xl224k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTCTAGTGAT
  3   1   2       bld DMZ  5g3  in                         xl251c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGT
  3   1   2       bld DMZ       in                         xl291b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGAGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld DMZ  5g3  in                         xl293p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Ga18      in                      xlk122o06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNCTTCGGGCNCAANNCNNNATAGNCTTCCCGGGATANAAGTNCNNNCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGNNCCCTCCTGCTGCTCCCCGANCCCCAGNGCTCTCTCCCCCCACCGACCCACAACTGCAGCANNAACAGCAGCCCCAGTACAGNGGATACCAGGAGCTCTATGGGTNCCTCCCCTNCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGNCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld DMZ       in                         xl322l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTT
  3   1   2       bld DMZ  5g3  in                         xl289m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ  5g3  in                         xl265d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCATGnTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACAGCTGTGACCCCCATTCTTTTTATAGCAAAGACTTTATCTGAAACTGGAGTTT
  5   1   2       bld Ga12      in                         XL179d06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGNTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGA
  3   1   2       bld Ga15 5g3  in                       XL518p06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTNGGNNTCAACACGNGATAGANTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGNGAGCAACAGACACACGCCGACCCCTCCTGNTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGT
  3   1   2       bld DMZ       in                         xl284m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTCTAGTGAT
  3   1   2       bld DMZ  5g3  in                         xl258i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld DMZ  5g3  in                         xl261h20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCNGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld DMZ  5g3  in                         xl288m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCTCAACACGCGATAGACTTCCCCGGGATACAAGTACGCGCCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTNT
  3   1   2       bld DMZ  5g3  in                         xl327e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ  5g3  in                         xl263o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld DMZ  5g3  in                         xl294p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ       in                         xl322l09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Ga12 5g3  in                         XL199e18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAACACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTC
  3   1   2       bld DMZ  5g3  in                         xl239n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACGCGATAGACTTNCCCGGGATACAAGTACGCGCCCCGCCAAGAAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ  5g3  in                         xl264n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCGATAGACTTNCCCGGGGATACAAGTACGCGNCCCGCAAGAAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTCTAGTGATG
  3   1   2       bld DMZ  5g3  in                         xl244e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTCTAGTGA
  3   1   2       bld DMZ  5g3  in                         xl294n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAATCTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTC
  3   1   2       bld Ga12 5g3  in                         XL182j22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGNGAGCAACAGACACACGCCGACCCNTCNTGNTGCTCCCCGACCCCCAGCGNTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCNTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGT
  5   1   2       bld Ga15      in                       XL472b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGATAGACTTCCCGGGATACAAGTACGCGCCCCGCAAGAAANGCAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACA
  3   1   2       bld DMZ                                 rxl320p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTTCCCGGGATACAAGTACGCGCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTANTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACNTTAATAGAGGTGTGGCCNTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCNCCTGCCGGCAGCTAT
  3   1   2       bld Ga15 5g3  in                       XL439g22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNCNGGGATACAAGTNCGNGCNCNGCAAGAAANGCAAAGACAAGGGGGGGGAGnTnGCCAGCAACAGACACACGCnGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ       in                         xl285m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCGGGATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATA
  3   1   2       bld Ga12 5g3  in                         XL214j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNGGNATACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGnTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Ga15 5g3  in                       XL488m16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGNATACAANNNNGNNCNNNNCAANAAANNCAAAGNCAAGGGGGGGGAGNTNGNGAGCAACAGACACANGCNGACCCCTCNTGNTGCTCCCNGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATG
  3   1   2       bld Ga12      in                         XL183n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATACAAGTACGNGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGNGAGCAACAGACACACGCCGACCCNTCNTGNTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATA
  3   1   2       bld Ga15 5g3  in                       XL516b23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATACAAGTACGCGCCCCGCAAGAAANGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAANCTGGAGTTTGT
  3   1   2       bld Te2       in                    IMAGE:7207385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGAGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCCTAAGTG
  3   1   2       bld Tbd7 5g3  in                         XL105b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGTACGCGCCCCGCAAGAAACGCAAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCAGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTNATGTTTTTAATACTATAA
  3   1   2       bld Ga12 5g3  in                         XL144l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTAAACTGAGTTTGTTTTTTTCTAG
  5  -1   2       chi Bla2      in                    IMAGE:7297011.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAACAGTTGACTGATAGCAGCTCGAATACCCTCATNAAGGACAAAGCTGAGTCCACGCGGTGGCGCCGCTCTAGACTAGTGATCCCCCGGCTGCAGGATTCCCTccccccccGACCCACAANGCAGCAGAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTTTGACCCCTGTGACTGAATGGGACATTCCGAGGGTTTCCGCTTTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCTATGATGTGGG
  3   1   2       bld DMZ  5g3  in                         xl248p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTACGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Ga15 5g3  in                       XL412i17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCGCCCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTT
  3   1   2       bld Ga12                                 XL187d21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGNGAGCAACAGACACACGCCGACCCNTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGACACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld DMZ  5g3  in                         xl237d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGCAAGAAACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGNTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACNTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAA
  3   1   2       bld Ga15      in                       XL431l20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCAAGAAACGCAAANACAAGGGGGGGGAGCTCGCGAGCAACAGACACACGCCGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Ga15      in                       XL406h02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CNGCAAGAAANGCAANGACAAGGGGGGGGAGnTnGnGAGCAACAGACACACGCCGACCCCTCnTGnTGnTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  5  -1   2       bld Bla2                            IMAGE:7300289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGCGCCCGCAAGAACGCAAAGACAGGGGGGGAGCTCGGAGCACAGACACACGCCGACCCTCCTGTGCTCCCCGACCCCCAGCGTTTCTTCCCCCCACGACCCAACAANTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTAACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCGCCCTAGATACGG
  3   1   2       bld Ga12      in                         XL204h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGAAACGCAAAGACAAGGGGGGGGAGCTnGnGAGCAACAGACACACGCnGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAA
  5  -1   2       chi Bla2                            IMAGE:7297150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACAGATAGCAAGTGAATTACCTCATAAGGGACAAAGTGGAGTCCACGCGGTGCGCCGTCTAGACTAGGGATCCCCGGCTGCAGGAATCCCCCCCACCGACCCACAATGCAGCAGAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTAAGATGG
  3   1   2       chi Ga15      in                       XL452o17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANNNNNAANNNCAANNGGNGGGAGNTNNNGANNANCAGACACANNNNGNCCCNTCNTGNTGNTCCCNGACCCCCAGCGCTNTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGAT
  3   1   2       bld DMZ       in                         xl241l18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGCAAAGACAAGGGGGGGGAGCTCGCCAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  5   1   2       bld Emb1                            IMAGE:6866296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCgggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTTGTTTTTCCAAGGGATGGTTTTAATTACTAATAAAAGTTCTAGATGaaaaaaaaaataaaaaaaGGGGGGCCGGTTCTAGAAGTAACCCCTTCGAGGGGCCCCAAACTTTACCCGTTACCCACAACTTTTCTTGGAAAAAAGATGGGTCCCCCAAAGGTGGAGGCCCGAATTTATAAGGCTAGGGCACCG
  5  -1   2       bld Bla2                            IMAGE:7298628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCCGGATCAGTCGGCCCGCAGAAGCAAGACAGGGGGGAGTCGGAGCACAGCACACGCGACCCTCTGTGTCCCCGACCCCAGGCTTCTCCCCCACCGACCACAATGCAGCAGCAACGCAGCCCCATACAGCGGTACCAGGAGCTTATGGGTACCTCCCCTACCCCCCGGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGAGaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCGCCCAAGATA
  3   1   2       bld Ga15 5g3  in                       XL477e18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNAAAGACAANGGGGGGGGAGTNNNGAGCAACAGACACACNCNGACCCNTCNTNNTGCTCCCNGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  5   1   2       bld Ga15      in                       XL436m19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGACAAggggggggAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTANATGAATTCTGaaaaaaaaaa
  3   1   2       bld Neu7 5g3  in                         XL034a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGACAAGGGGGGGNAGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGNGATGTTTTTAATACTATAAAGTTCTAGA
  3   1   2       bld Ga15 5g3  in                       XL451f21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGGGGGGGAGNTNNNGAGCAACAGACACACGCNGACCCNTCNTGNTGNTCCCNGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld DMZ  5g3  in                         xl238n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTG
  3   1   2       bld Neu7      in                         XL045f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTCGCGAGCAACAGACACACGCCGACCCCTCCTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGNAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTGCATTTTATAGCAAAGACTTTACTGA
  3   1   2       bld Ga12 5g3  in                         XL169d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNGNGANNANCAGNNNCNNNNNGNCNCNTCNTGNTGNTCNNNGACCCCCAGCGNTNTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  5   1   2       bld Ga15      in                       XL504c16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAcgccgacccctcctgctgctccccgacccccagcgctctctccccccaccgacccACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGNNNAGGGGGGTTCAGCAACNG
  3   1   2       bld Neu2                            IMAGE:2942096.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGCGACCCCTCTGCTGCTTCAAGATCCTCCAGTGCTCTCTCCCCCAACCGACCAACAATTGCAGCAGCAACAGGAGCCTAGTACAGCGGATATAGGAGNTCTATGGGTACTCCCCTACCCTCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAAT
  3   1   2       bld Ga15      in                       XL436m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGACCCCTCnTGCTGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld Ga15      in                       XL458i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCTCCTGNTGTCCCNGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Ga12 5g3  in                         XL199c09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTCCCCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGT
  3   1   2       bld Ga12 5g3  in                         XL188g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTCCCCGACCCCCAGCGNTNTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCNTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGT
  3   1   2       bld Ga15 5g3  in                       XL446l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGNTCNCNGNCCCCCAGNGNTNTNTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTNTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAANCTGGAGTTTGT
  3   1   2       bld DMZ       in                         xl233c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCCCCGACCCCCAGCGCTNTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATNCCAGGAGCTNTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGNGACGNGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCNTTCACGGACCTNTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTNTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCNTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACNGTGACCCCCATTCNTTTTATAGCAAAGACTTTACTGAAACT
  3   1   2       bld Ga12      in                         XL205k15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNNNGACCCCCAGCGNTCTNTCCCCCCNCCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAG
  3   1   2       bld DMZ  5g3  in                         xl243m21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTNTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTNTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGG
  3   1   2       bld Tbd7 5g3  in                         XL095h20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACCCCCAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTTGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTNCTAGTGATGTTTTTAATACTATAAAGTTNCTAGA
  3   1   2       bld Ga12 5g3  in                         XL161d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGNNNTNTNTNNNNCCNNNGANCCACANNTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTNTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGT
  5   1   2       bld Ga15      in                       XL435b23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTANTGATGTTTTTAATACTATAAAGTTCTANATGAATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL435b23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCGCTCTCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Neu2      in                    IMAGE:2942748.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGCTCTCTCCTCCTCCAGACCACTACTGCAGCAACAAATGTAGCCCTATGTCAGGGGATAGCAGGAGCTCTATGGGTCCTCCCCATACCCCCCGCGCCCGGAGTCCTTCCTTCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTATAAAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGAAAAA
  3   1   2       bld Ga15      in                       XL407n06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTNTCCCCCCACCGACCCACAANTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Ga15 5g3  in                       XL435h24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGNAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAAC
  3  -1   2       bld Bla2      in                    IMAGE:7297011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCCCCCCACCGACGCACAACTGCAGGAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACCGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGCTGTTTTTCTAGTGATGTCTTTATACTCTCAGTTCTAGATGAAGAGTAAGAAACAGATAAGAAAAACAACACTTCGGGTGAGCCGGTACATTCTCCCATAGTAGCGATACATCCTGACGGAGTATACTTGACAAGAACCTGGGTACCATTACGCTGACATCCATCGCGTGCTAAGAAAG
  3   1   2       bld Ga12 5g3  in                         XL169m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TnnnnnnnnnGNNNCNCANNTGCAGCAGCAACAGCAGCCNCAGTNCAGCGGATACCAGGAGNTNTATGGGTACCTCCCCTACCCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Ga15      in                       XL499d13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCCCCCNCCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTNTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTG
  3   1   2       bld Ga12                                 XL150k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGNNATGTTTTTAATACTATAAAGTTNCTAGA
  3   1   2       bld Ga15      in                       XL419f24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNCCCCCACCGACCCACAANTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACAACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Ga15                               XL471n11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCCCCACCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTNTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACAGCTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  5  -1   2       bld Bla2                            IMAGE:7297971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTCCCCGACCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTTTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTTTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACACACCGCCCATGATAAN
  5  -1   2       bld Bla2                            IMAGE:7299423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGAATTCCCACAACTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGAGaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCATCGCCTTATATTGGGN
  5  -1   1       add Neu7      out                        XL018d17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTACATTAAATGCACAGNAATTGCATTCGTTTCTCATATAACATCAGCGACAGTAATAACATTTCTGTCACAGTCTTCNNCAGAGAAGGTAATCCAAAGGAGTTAATATCAGACAACGGACCACAGTTTGTCTCATATGAGTTTGAATCCTTTCTGAAAGAGAGGAATATTGTGCATAGGNNNTCTTCAGTGTANNACCCACAAGCAAATGGAGAAATCGAGCGATTCAACAGAAGTCTGAAAGAAGC
  3   1   2       bld DMZ       in                         xl341i06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACCGACCCACAANTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGANTACNGGGAGCACAGGGGGGTTCAGCAACAGGTNCAGTACCAAACCNTGGAAGTGGAGGGAACCTCTTTCACG
  3   1   2       bld Ga15      in                       XL446g24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGACCCACAGCTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTGTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAANCTGGAGTTTGTTGTTTT
  5   1   2       add Ga15      in                       XL419f24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ANAANTGNANNANCNNNAGCAGCCCCAGTACAGCGGATACCANGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCNNTGACGTGTCTGCGCTTTATGGCTTTGNACTGNACGATTACTG
  3   1   2       bld Ga15      in                       XL407h02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANNTGCAGCAGCAACAGCAGCCCCAGTACAGCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGT
  3   1   2       bld DMZ                                 rxl283a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCAGCAACAGCANCCCCAGTACANCGGATACCAGGAGCTNTAAGGGTACCTCCCNTACCCCNCGCNCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACANGGGGGTTCAGCAACAGGTCCAGTACCAAACCCNGGAAGTGGAGGGAACCTCTTTCACGGACCTNTGACCCCT
  3   1   2       bld DMZ  5g3  in                         xl234o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CANCGGATACCAGGAGCTCTATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCNTCTGTCAGTGACGTGTNTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTNTACTGACNNGAGANTCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGNGGAGGCTCCTCCCCCNGCCGGCAGNTATGGGCATTTCATTATTCCGTTACTGGAAAANATTTGGGGCGTCGGATCTTGTTAGAATTAAAGNTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACATCAGCTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld Ga12      in                         XL162o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGAGNTATATGGGTACNTCCCNTACCCCCCCGCGCCNGGAGTCCTTCCTCCCGTNTGTCAGNGANGTGTCTGCGCTTTATGGCTTTGGACTGTANGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACNTCTTTCACGGACCTNTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTNTANTGACTTGAGAATNTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGNCCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Ooc1                              xlnoc003i17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTCTATGGGTACCCTATACCCCNCCGCGCCAGAAGTCCTTCTGCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATAAATAA
  5   1   2       bld Ga15      in                       XL452o23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCAGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL452o23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCAGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  5   1   2       bld Ga15      in                       XL450d07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL450d07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTCTAGTGATG
  5   1   2       bld Ga15      in                       XL452g02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL452g02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTG
  3   1   2       bld Ga15      in                       XL472b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACCTCCCCTACCCCCCGCGCCCGGAGTCCTTCCTCCNGTCTGTCAGTGANGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAA
  3   1   2       bld Ga15      in                       XL504c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACCTCCCCTACCCCCCGNGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTNTNNTTGANTGGGACATTCNGAGGGTNTCCGCTTTNTTGNNTTGAGAATCNNNNGGATCCCANTGTGAGGGGCCCANGATGGGATG
  3   1   2       bld Ga15                               XL419d24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCCCCTACCCCCCGNGCCCGGAGTCCTTCCTCCCGTCTGTCAGNGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTNGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTNTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAAACTGGAGTTTGT
  3   1   2       bld Ga15 5g3  in                       XL519d08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCCNTACCCCCCGCNCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTNTGCGCTTTATGNCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCGATTCTTTTTATAGC
  3   1   2       bld Ga10      in                    IMAGE:3558131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTATCCTCGCGGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGAAAATTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTNCTAGTGAGGTTTTTAATACTAAAAGTTNTAGAAAAATTTTGAAAAAAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL452i05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACCCCCCGNGCCCGGAGTCCTTCCTCCNGTNTGTCAGTGANGNGTCTGCGCTTTATGGCTNNAGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTNTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCNGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACGACACTGTG
  3   1   2       bld Gas5      in                    IMAGE:3751273.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCGGCGCCCGAAGTCTTTCTTCCCGTTGTCAAGTAAGGTGTCTGGGCTTAAGGGTTTTGGACTGTCGAATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAACCCCTGGAAGTGGAGGAAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAAAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACATCTGTGACCCCAATTTTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAAAAAAA
  3   1   2       bld Ga12 5g3  in                         XL186n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCGCCCGGAGTCCTTCCTCCCGTCNGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTNTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTNTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTNTAGTGA
  3   1   2       bld Ga10      in                    IMAGE:3558268.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCCCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTNCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGAAAAA
  3   1   2       bld Ga15      in                       XL454m15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGAGTCCTTCCTCCCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTG
  3   1   2       bld Ga12      in                         XL179d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCTCCCGTCNGTCAGTGACGTGTACTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Bla1                            IMAGE:3381086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTCCTCCCGTCTGTCAGTGACGAGTTGCGATCTATGGCTTTGTCCTGTCAGATTACGGGTAGCACAGAGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGGAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACTCCGCCTTCAATGAAACCACAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTG
  5   1   2       bld Ga14                               Ga14-p10c8.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGTCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGNGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAG
  3   1   2       bld Ga15      in                       XL401l14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGTCAGTGACGTGTCTGCGCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAAC
  3   1   2       bld Ga15                               XL448h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCAGTGACGTGTCTGCNCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACCTGAAACTGGAGTTTGT
  5   1   2       bld DMZ       in                         xl341i06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTTATGGCTTTGGACTGTACGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGANGNGTGCATGATGGGATGGACCTGACCCCGCCTTCANTGANACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGNGCGGTACCAAGTGGNCTTATTGTGGANGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAANAGATTTGGGGCGT
  3   1   2       bld Gas4                            IMAGE:3421349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACGATAACGGGAAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAG
  5   1   2       bld Bla1      in                    IMAGE:3380461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGA
  3   1   2       bld Ga15                               XL451o20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGATTACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTNTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAATCTTGGGACGTTTTTGTCGCACANCANCTGTGACCCCCATTCTTTTTATACGCAAAGGACTTTACTGAAANCTGGAGTT
  3   1   2       bld Bla1      in                    IMAGE:3380461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGGGGAGCACAGGGGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAAT
  3   1   2       bld Ga15 5g3  in                       XL488a14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGGGGAGCACAGGNGGGTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTNTGACCCCTGTGAGNGAATGGGACCATCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTNGTTAGAATTAAAGGTTTTTGTTTTTAGGGGAAANCTTGGGACGTTTTTGTCGCATCACACTGTGANCCCCCATTCTTTTTATATGCAAAGACTTTACCTGAAAGCTGGAGTTTGTTGTTTTTC
  3   1   2       bld Ga15      in                       XL479c17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCNCAGGGGGNTTCAGCAACAGGTCCAGTACCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGNTCTCCGCTCTATTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTACGGGAAAGCTTGGGACGTTTTTGTCGCANCATCACTGTGAGCCCCCATTCTTTTTATAGGCAAAGGATCTTTANCTGAANANCTGGAGTTTGTTGTTTTT
  3   1   2       bld Ga15      in                       XL401k13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNCAGGGGGGTTCAGCAACAGGTCCAGTNCCAAACCCTGGAAGTGGAGGGAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAAGCTTGGGACGTTTTTGTCGCANCAGCAGCTGTGACCCCCATTCTTTNNA
  5   1   2       bld Gas5      in                    IMAGE:3750572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACCTCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAA
  5   1   2       bld Ga14                              Ga14-p10e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAACTCTTTCCGGACCTCTGATCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGT
  3   1   2       bld Tbd7      in                         XL058o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTTCACGGACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGA
  5   1   2       bld Tbd7      in                         XL058o06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTCACGGNACCTCTGACCCCTGTGACTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGTGTaaaaaaaaaa
  3   1   2       bld Ga12                                 XL170m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACCCCTGNGANTGAATGGGACATTCCGAGGGTNTCCGCTCTANTGACTTGAGAATGTAGGGGATCCCGCTGTGAGGGGTGCATGATGGGATGGACCTGACACCGCCTTCACTGAANCCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGNCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTNCCGGCANCTATGGGCATTTCATTATTCCGNTACTGGAAAAGATTTGGGGCGTCGGATCTTGNTAGAANTAAAGGTNTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTANTGAAACTGGAGTTTGTT
  3   1   2       bld DMZ       in                         xl262m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGANTGAATGGGACATTCCGAGGGTCTCCGCTCTACTGACTTGAGAATCTAGGGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGCCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTAA
  3   1   2       bld Gas5      in                    IMAGE:3750572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCTCTACTGACTTGAGAATCTAGGGGATCCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCNCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGCCGGTACCAAGTGGCCTTATTGTGGAGGCTCCCTCCCCCCTGCCGGGCAGCTATTGGGGCATTTCCATTATTCCGGTTACCTGGAAAAAGATTTTGGGGGCGTCCGGNTTCTTTGTTAAGAATTTAAAGGGTTTTCTGTTTTTAAGGGGAAAACTTTGGGACGGTTTTT
  3   1   2       bld DMZ  5g3  in                         xl257n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGAGAATNTAGGGGATCCCANTNTGAGGGGTGCATGATGGGATGGACCTGACCCCNCCTTCACTGAAACCCCAGGACNTTNATAGAGGTGTGGCCCTAGTGGTCGGTACCAAGTGGCCNTATTGNGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGNTACTGGAAAAGATNTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTCTGTTTTTAGGGAAACNNGGGACGTTTTTGTCGCACACACTGTGACCCCCANTCTTTTNATAGCAAAGACTT
  5   1   2       bld Ga15      in                       XL482c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL482c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGA
  3   1   2       bld Neu7 5g3  in                         XL019i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCCACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTNCTAGTGATGTTTTTAATACTATAAAGT
  5   1   2       bld Gas7                   IMAGE:3750596-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTGTGAGGGGTGCATGATGGGATGGACCTGACCCCGCCTTCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGACaaaaaaaaaaaaaaa
  3   1   2       bld DMZ                                 rxl302d10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCCTTCNNTGAAACCCCAGGACCTTAATAGAGGTGTGCCCNTANNGGGCGGTACCAAGTGGCCAATATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCANTTCATTATTNCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACT
  3   1   2       bld Ga15 5g3  in                       XL477k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACTGAAACCCCAGGACCTTAATAGAGGTGTGGCCCTAGTGGGCGGTACCAAGTGGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGGAAACTTGGGACGTTTTTGTCGCACACATCTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAANCTGGAGTTTG
  5   1   2       bld Emb1                            IMAGE:5154936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCCTTATTGTGGAGGCTCCTCCCCCTGCCGGCAGCTATGGGCATTTCATTATTCCGTTACTGGAAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTTCTAGTGATGTTTTTAATACTATAAAGTTCTAGATGAATTCTGaaaaaaaaaaaaaaaGG
  3   1   2       bld Ga15                               XL411f11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGNCTTTACTGAAACTGGAGTTTG
  3   1   2       bld Ga12 5g3  in                         XL180i06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATTTGGGGCGTCGGATCTTGTTAGAATTAAAGGTTTTTGTTTTTAGGGAAACTTGGGACGTTTTTGTCGCACACACTGTGACCCCCATTCTTTTTATAGCAAAGACTTTACTGAAACTGGAGTTTGTTGTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)