Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8531632.3                      20 END     11          2       55                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8531632.3                      20 PI      83       2020     2324                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012767166 Xl3.1-xl341c22.5 - 418 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl341c22.5                                                     CGCCCCTCTACTTCGGGAAGCCGACAAGCAAGTTGGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAATTGTCTTGTATATGTATTGTCACCAAAATGATGAAGTAAAGGTTTTTGCTAGCAAAAAA
                                                  Xl3.1-CHK-1012685018                                                           TCTACTTCGGGAAGCCGACAAGCAAGTTGGxxAGxxGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAATTGTCTTGTATATGTATTGTCACCAAAATGATGAAGTAAAGGTTTTTGCTAGC
                                                      consensus depths                                                          3     7     4    10     5    15    10    27    23    58    42    78    64    95    82   101   100   120   114   135   110   159   116   167   117   170   125   174   151   175   160   180   164   180   165   180   162   180   167   182   168   182   154   182   168   182   167   182   161   181   166   181   165   182   166   182   167   184   152   174   160   174   169   174   167   175   166   177   166   179   172   179   174   179   168   179   170   179   171   180   171   177   163   177   166   176   162   176   170   178   166   176   163   174   152   171   159   168   153   168   154   169   140   167   154   167   147   166   133   165   139   162   130   155   127   148   103   134    97   128    93   118    78   107    69    95    63    92    61    88    45    79    45    74    41    70    40    66    36    65    30    58    26    55    26    53    23    52    23    50    23    49    25    48    26    47    26    45    20    45    20    44    20    41    24    43    24    42    25    43    24    41    24    41    21    41    25    41    24    40    25    40    24    39    27    39    27    41    29    41    30    42    30    40    29    39    29    39    31    40    29    41    28    42    31    42    29    45    38    47    35    49    40    53    41    54    42    56    44    57    48    62    53    61    48    62    54    62    56    64    57    67    59    68    60    69    61    71    60    74    59    74    58    75    66    77    61    76    61    76    60    79    66    81    62    81    61    81    60    83    60    81    53    82    55    82    60    91    55    92    55    99    55   107    54   113    54   122    50   121    92   127    83   124    90   129    95   126    97   125   106   129   103   134   107   133   110   132    97   132   104   133   111   136   113   138   116   145   136   158   141   164   145   164   142   164   145   165   143   163   146   163   141   161   143   160   142   159   138   159   126   155   101   123    56   111    59    83    44    77    31    35    23    31    22    25    22    24    23    27    25    27    25    27    25    27    25    27    25    26    23    26    24    27    24    27    24    27    22    27    22    26    18    26    18    26    17    26     8    13     7     9     6     7     6     7     4     6
                                                                   VAR                                                                             GAAGGCGCCAAG
                                                                   VAR                                                                                         TGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGC
                                                                   VAR                                                                                                                                                                             CTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGACGCAAATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGTTACAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGAAGTGACGTGATGGACTG
                                                                   SNP                                                                                                                                         --G-------G-
                                                                   SNP                                                                                                                                                                 -----A----C-
                                                                   SNP                                                                                                                                                                                                     --T---------
                                                                   SNP                                                                                                                                                                                                                             G-----C-----
                                                                   SNP                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                         A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                     ---C----A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                 --------AC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                             ---T----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                         -CG---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                     ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                     -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T--------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G--G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T--G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T--A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G--------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------AA--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                               BLH ATG     175    1576                                                     
                                               BLH MIN     175     275                                                     
                                               BLH OVR     172      57                                                     
                                               EST CLI      36      38                                                     
                                               ORF LNG     172       9                                                     
  5   1   2       bld Em10 5g                         IMAGE:7980013.5p CGCATTGTAAACTCCGCCCAATCCTTCCCGGAAGCAGCCGAACGCTTAAGAAAGCCCTGCCCCTCTACTTCCGGAAGGCGCCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGCGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACCTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCATTTGGGATCACAGAGGAGGCAATGATGGACTTCTTTATGCCCAGATGCGCCTTGGTGGATGAACCAGCACTGGAATCCTGACTGCTGTCAATCATCAGAAAAACTTGCCTTTGAGTTCTCTGTGTGAACACCAGCATGGTTTGAGGATATTTCAGCCGCTTAAATGACCCTTGATCGCTTCAGTGGTAAC
  5   1   2       bld Oo1  5g                         IMAGE:6640736.5p     GCATTGTAAACTCCGCCCAATCCTTCCCGGAAGCAGCCGAACGCTTAAGAAAGCCTTGCCCCTCTACTTCCGGAAGGCGCCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCCTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAACTTTGCCCTTTTTGGAGGTTCGGTTCTGGTGATGGAACAACACAGGCAATTGCCTTTTTGATGGGAATATTTTTTTCAGGGCCGGTCTCCTTAAAATTAGACGCCCTTCATGAATTACCAGGCCTTTACCAGGCCATGTCTGA
  5   1   2       bld Emb1 5g                         IMAGE:6632593.5p            CCGAATCATTTCCGGAAGCAGTTGAAATCTTAACAAGACCCCGCCCCTCTACTTCGGGAAGCCGACAAGCAAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGGCCGNCGACTCTATGTCGGAAATATTCCATTTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTTATGCTCAGATGCGACTTGGTGGGATTGACTCCAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCCAGGACAAAATTTTGGCTTTTTGGGAGTTTCGTTCTGGTGATGGAAACACACAGGGCATGGCCTTTTTGATGGGGATCATTTTTTCCAGGGGCCAGTCTCTTTAAATTTAGGGGCCCCTCATGGATTACCCAGCCGTTTTC
  5   1   2       bld DMZ  5g3  in                         xl340e23.5p                          CCTTCCCGGAAGCAGCCGAACGCTTAAGAAAGCCCTGCCCCTCTACTTCCGGAAGGCGCCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTC
  5   1   2       bld Gas5      in                    IMAGE:3748405.5p                                GGAATTCCCTTAACAAGACCCCGCCCCTCTACTTCGGGAAGCCGACAAGCAAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAAAGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTANATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTTCAGCTGCAGCTCTTTCTTCCACCATGACTTCAGATGGTCTGCCAGTACTCCTACTCCAGTGCCCTGTGGTGGGCGTCAGATGACGAGGCAAGGCCCGTCGACTTTTT
  5   1   2       bld Tbd7 5g3  in                         XL062n14.5p                                    AGGGCCGAACGCTTAAGAAAGCCTTGCCCCTCTACTTCCGGTAAGGCGCCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCANCTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAA
  5   1   2       chi Kid                             IMAGE:4031001.5p                                         GTTTGCGCACCCCGCCCCTCTACTTCGGGAAGCCGACAAGCAAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGGATATTCCAGCCTCCTGGTTTTGAGCATATCACCGCCTCTGGCAGTATAAAGCCCAATGGCAAGCTGCGGGGGACACATTCCGGGCTACAGCGTCCTTGCTTCCAAACCATGACCTCCAAAATGGGGCTGGGCAGGTCAACTCCCCTAACTCCCAggggggctcggattggggggggcagtacccgcaatggagcgcaggggccgggggggCGCGGCCCGAGAATTTCCTTATAGCGCCCGGGGACAGATTTAATGTTCCCCAATATTTTCGGGGAACATTCCACCTCGGGAGAGGGCACGGCGACGAATTTGCAACTGCGGGGGCCCTCCTCTCCCTTATGTANAATGGGGCGTTCTATGCGAAGTCGGACCCGCAACCTTCTGCGCGGAGGGGAAAATGTGGTATACCTCTCCAAACTTACCACACCCCTGGAGAACAAAATTACCGCTGCGGACAATTCTGAGGGGTCTTAGGCTCCCCCAAGCATGATAGTGATTTGAGAGGGGAACGCAACAAAAAATCTTATGTCGGTGCCACCACTATTATTTAGCCAAAAGATATACGCCAACAGTGTGCGGCTGCGTCGAAAGGTGTAAAAACACCCCCCTCACACGTGGAGGTCACATAGTGGTGACATTTTGTCTGTCAACGGGCGGGCAAACGCGCCCTACTTTGTATCCAAggggggggCCGCAGTGATAGACTCTGCCACAGACAAATTCCAGAGCAGGCATGCCGCTCCCCCACGGAGGT
  5   1   2       bld Ga12 5g3  out                        XL164e11.5p                                                         GCTCTACTTCGGGAAGCCGACAAGCAAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTTCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGGCCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTG
  5   1   2       bld Oo1  5g                         IMAGE:5085367.5p                                                               CACGCGTCCGCGGACGCGTGGGCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTNGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCCTTTTTGGAGTTTCGTTCCTGTTGATGAAACAACACAGGCAATGGCCCTTTGATGGGATAATTTTTTCAGGGGNCAGTCTCTTAAAATTAGACGCCCCTCATGATTACCCAGCCTTTACCCAGGCATGTTCTGAAAAACCCCATCCCGTTTATGGTAACCCCAGGGGGTGGTTTTTCCAACAGGTTGGTTC
  5   1   2       bld Int2 5g                         IMAGE:8822214.5p                                                                 TTAAATTTATTGCAATTTTTTCAAATATATTTCTAATTCGTCCCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTAGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAATCAATCAAGACAAAACTTTGCCTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGCATGGCTTTTGATGGGATATTTTTCAGCAGTCTCTAAATTAGACGCCCCTCATGATACAGCTTACAGCATGTTCTGAAACCATCGTTATGTTACCAAGTTGTTTCAGTTGTCTGGACCTGCACTAGCCTTTCATGAAGTACACTATTGATGAGACTGTTAACCTGAGTCTTAGCATGGATTA
  5   1   2       bld Emb4 5g                         IMAGE:4724704.5p                                                                   TCTACTTCCGGAAGGCGCCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCCATGGCTTTTGATGGGATAATTTTTTCAGGCCAGTCTCTTTAAAATTAGACGCCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGTAAACCCCTCCCGTTTATNTACCAGGGGTTGGTTTCCCCAGTTTGTCCCTGAACTCTGCACCCAAGCTTTTTTCATTGGAGGGGTACCCCAA
  5   1   2       bld Ov1  5g                         IMAGE:5073343.5p                                                                    CCACGCGTCCGAGCAAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAAAGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCG
  5   1   2       bld Egg3 5g                         IMAGE:6324331.5p                                                                          CCCGGGAGCAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGNGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTNGAGAGGCAATGATGGACTTCTTTATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGGTCAAATCATTCAAGACAAAAATTTTGCCTTTTTTGGAGGTTCCGTCCTGTTGATGAAACCCCCCCAGGCATGGGCTTTTTGATGGGGATCATTTTTTCAAGGCCCAGTCCTCTTTAAAATTAGGGCGCCCCTCATGAATTACAGGCCTTTTACCAGGCCATGTCTTGAAAAACCCCTTCTGGGGATTGGCACCCAgggggggggTTTTCCCAAGTTGGGCCCCCCGGAAT
  5   1   2       bld Ga15 5g3  in                       XL516l11ex.5p                                                                          CCGGAAGGCGCCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGNAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTG
  5   1   2       bld Ga18 5g                           xlk114c01ex.5p                                                                           CGACAAGCAAGTTGGTGAGCGTGTTGNGGNNCNNCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGNTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGNCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACNNNNNNATCCAAGGATCGGAGGCNANNNNNNNACNAAGAAATGAGAAGNAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGNTTTGAGCNTATCACGCCT
  5   1   2       chi Oo1                             IMAGE:6637792.5p                                                                               TTGAAAAAGAGGCTGGTACGGTCCGGAATCCTTCCAGAACTGCGTCCTCCTCCCCCGCTCGTCCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGAGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCATCAAGACCAAAAATTTTGCCTTTTTGGAGTTTCGCTCTGTTGAAGGAACCACCCCGGCAATGGCCTTTTGATGGGTATCTTTTCTCAGGGCCAATTCTCTTAAAAATAAGGCGCCCCCCTGATTTACCACCCCTTTACCCCGCAATGTCCTGAAAAACCCCTCTCGGTGTATGGTTACCCGGCGGCGGGCTTCCCCACAGGTTCGACCCCTGGAATTTTCGCGAACCCAAACCATTCGCAGTTTGGGAAGAGTCTAACCCCAAAATTTTTGTGCGCCCCGCATTGATcccccggncccccccTGGTGAAGGGCCCTTCAAC
  5   1   2       bld DMZ  5g                              xl227p21.5p                                                                                GCAAGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATC
  5   1   2       bld DMZ  5g3  in                         xl314b11.5p                                                                                  GNCAAGCTAGTTGTTAAGCGTGGTGCGGCTGCGATTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCNACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGANNGGGACAAGGAAAATCGGCATANAAAACGCAGTCGTAGCCGCTCTAANAGCAAAGAACGGAAGCGTCGAAGCCGTATCAAANAAAGACGAGCTANAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAANATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCANATTCCAGCTACTGCTCTCCTTCCNACAATGACACCANATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCC
  5   1   2       bld Ga12 5g3  in                         XL203m20.5p                                                                                   AGTTGGTGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTTCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGGCCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTG
  5   1   2       bld Em10                            IMAGE:8319891.5p                                                                                       TGAGCGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGACTCTCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCTCTACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGGAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTGGATGAAACACACAGGCCATGGCTTTTGATGGAATATTTTTTCAGGC
  5   1   2       bld DMZ  5g3  in                         xl300l15.5p                                                                                       GCTAGTTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTAGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTC
  5   1   2       bld Egg3 5g                         IMAGE:6868145.5p                                                                                        GATTCCCGGGTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAAGGGGTGGGTTTCCACAGTTTGTCCCTTGAATCTGCACACAAAGCTAATTCATTGGGAGGTTTTACCCCACACTATCTTGAA
  5   1   2       bld Ov1  5g                         IMAGE:8331677.5p                                                                                        GCTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTGTCAATCAATCAAGAA
  5   1   2       bld Ga18 5g3  in                      xlk127a10ex.5p                                                                                        CNNNAGTTGTTAAGCGTGGNGNGGNTCNNTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGNGCTTGAACACGGCCTGCCNCCNCCNTCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGNTCGAGCGGNNACTGAATGAAAATAAGCA
  5   1   2       bld Em10 5g                         IMAGE:7980136.5p                                                                                         CTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTAATGCCCAGATGCGCCTTGGTGGGATGACTCAAGCACCTGGAAATCTGTACTGGCTGTTCAATCAATCAGACAAAACTTGCTTTTTGAGTTCGTCTGTGAAGAACACACAGCATGGCTTTGATGGAAATTTTAAGGCCGCTCTTAATAGAGCCTCAGATTACACCTTCGGCAGCTGAACCCTCTTTATCCAGGGGTTCCATTTCCGACTGAAACTTTTGAGTTACATTTAAGA
  5   1   2       bld Em10      in                    IMAGE:7981241.5p                                                                                         CTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCATCAAGACAAAACTTTTGCTTTTTGGAGTTTCGTCTGTGATGAACACACNAGCATGGCCTTGATGGGATATTTTCAAGGCATCTCTAAAATAACGCCTCTGATACAGCTTTACAGC
  5   1   2       bld DMZ  5g3  in                         xl242o22.5p                                                                                         CTAGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTANAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAANCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAA
  5   1   2       bld Emb4 5g                         IMAGE:5571852.5p                                                                                          CCACGCGTCCGCCCACGCGTCCGGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCCTTGGTGGGATGACTCAAGCACCTGNAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCCTTTTTTGGAGTTTTCGTNTCTGTTGAATGAACAACACAGGCAATGGNTTTTTGATGGGGATATTTTTTCAAGGCCCAGTCTCTTAAAATTTAGACCGCCCTCATGGATACCCAGCCCTTTACCAGGCATGGTCTGGAAAACCCCAATCCGTTTTATGTAACCCCGGGGGTGGGTTTTCCCACAAGGGGGTCCCCTGGACCCTCTGCACCAACAAAGCCTTTTTTTCATTGGGGGAGGGGG
  5   1   2       bld Ooc3 5g                         IMAGE:3472599.5p                                                                                           AGTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATATTTTTTTAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTATCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTATCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGACCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCCTCC
  5   1   2       bld Ga12 5g3  in                         XL147d06.5p                                                                                           GGCTGCAGGNAATTCGGCACGAGGGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGG
  5   1   2       bld Emb1 5g                         IMAGE:5155995.5p                                                                                           TGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGCGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGGAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCCTTTTTGGAGTTTCGTTCCTGTTGATGAAACAACACAGGCAATGGGCTTTTGATGGGGATAANTTTTTCAAGGGGCCAGTCTCCTTAAAAATTAGACGGCCCCTCATGGATTACCAAGCCTTTTACCAGGGCATGGTCTGGAAAACCCCATCCCGTTTATGGTTACCCCAAGGGGGT
  5   1   2       bld Ga18 5g3  in                        xlk6p05ex.5p                                                                                           TAGTTGTTAAGCGTGGTGNGGNNNNNTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGC
  5   1   2       bld Ga18 5g   ?                        xlk64j08ex.5p                                                                                           TAGTTGTTAAGCGTGGTGNGGNTNNTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGA
  5   1   2       bld Ga18 5g                           xlk166m13ex.5p                                                                                           TAGTTGTTAAGCGTGGTGNGGNTCNNTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCNA
  5   1   2       bld DMZ  5g3  in                         xl333a23.5p                                                                                           GTTGTTAAGCGTGGTGCGGCTGCGCTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCANTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATC
  5   1   2       bld Emb1 5g                         IMAGE:6636926.5p                                                                                            GGACGCGTGGGTGGTGCGGCTGCGTTGTCTTCTTCATTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGTAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCCAGCACCTGGAAATCCTGTACTGGCTGTTCCAATCAATCAAGACAAAACTTTGCCTTTTTGGAGTTCCGTTCTGGTGATGAAACAACACAGGCAATGGCTTTTGAAGGGATAAATTTTCAAAGGCCCGCCCTTTTAAAAATACAACCCCTTCTGATTTACCAGCCCTTTTAACAGGCATGGTCTGAAAAACCCACTCCGCTTTACTATACCCCCGGGGTGGC
  5   1   2       bld Ga18 5g3  in                      xlk163m13ex.5p                                                                                            AGTTGTTAAGCGTGGTGNGGNNNNNTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCG
  5   1   2       bld DMZ  5g3  in                         xl333m15.5p                                                                                            GTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTG
  5   1   2       bld DMZ  5g3  in                         xl291l21.5p                                                                                            GTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAA
  5   1   2       bld DMZ  5g3  in                         xl226f12.5p                                                                                            GTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTC
  5   1   2       bld DMZ  5g3  in                         xl327a01.5p                                                                                            GTTGTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATG
  5   1   2       bld Em10 5g                         IMAGE:7980255.5p                                                                                             CGTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACGGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCATTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCATGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCATTGCCTGTTGTGGGCAGTCAGATGACGAGGCGGGCCCCTCGACTCTATGTCGGAAAATTCCATTTTGTATCACTGAACCGGCATGTTGGACTTCCTTAATGTCAGATGCGAATTGTGGATTGACTCAAGCCCTGGAAATCTGGTTCGGCTGTCAATCTTCAAGATAAAATTATGCCTTTTGGAGTTCTTCTGTGAGAACCTCCAAGCATGGCTTTATGGACTTTTCTAGCCTTTTTAATTAGGGCCACTGATCCACCTTACAGCATTGAATCCCTGTGTGACAGGAGTTCCATGCCCGACTAAAAGTTA
  5   1   2       bld Tbd2 5g                         IMAGE:3200182.5p                                                                                              GTGTTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAAGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGACGAAGCAATGATGGACTTCTGTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCAACCTGCAAATCCTGTACTGGCTGGTCAAATCAATCCAGACAAAAATGCTCCCTTTGTGGAGTGTCATTCGTGGGATGAACCCCCACAGGCCATGGC
  5   1   2       bld DMZ  5g3  in                         xl300b15.5p                                                                                              GTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTATGAACAAGAGCGCGAGAAGAGACGGCTGGNTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCANGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACNAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATG
  5   1   2       bld DMZ  5g                              xl288j20.5p                                                                                              TGTTNAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTATAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGNCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTANNAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACNAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGG
  5   1   2       bld Neu7 5g3  in                         XL048m24.5p                                                                                               CGGGCTGCAGGNAATTTTTNCACGAGGCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGTAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAA
  5   1   2       bld Emb1 5g                         IMAGE:6636108.5p                                                                                               CCACGCTCGGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGCGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCCAACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGAAAGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGGCTTTTGATGGGGATAATTTTTTCAGGGCAGGCCTCTTAAAATTAAAACGCCCCCATGATTTACCAGCCCTTTAACCAGCATGGTCGGAAAACCAATACCCCTTATGTACCAggggggggggTCCCCCAAGAGGTCCCCTTATTTTGGAAAAAA
  5   1   2       bld Ga12 5g3  in                         XL204a21.5p                                                                                               GTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGA
  5   1   2       bld Ga18 5g                           xlk133a09ex.5p                                                                                               TTGCGGNNNNNCGTCTTGTTCTTCTTCCTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGNTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGNCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACNNNNNNNTCCAAGGATCGGAGGCGANNNNNNNACNAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTNCAGNATAAAGNCATGCAAGCTGCGGGGANAGATTCCAGCTACAGCTCTTCTNCCAANCATGACTCCAGATGGNCTGGCANNNACTCCTACTCCAGNGCCTGTTGTGGNNNGTCAGATGACGAGGCANNCCCGNCGA
  5   1   2       bld DMZ  5g3  in                         xl324b08.5p                                                                                               GTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTTCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAAATCCTGTACTGGC
  5   1   2       bld DMZ  5g3  in                         xl291f19.5p                                                                                               GTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAA
  5   1   2       bld DMZ  5g3  in                         xl294h15.5p                                                                                               GTTAAGCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAA
  5   1   2       bld Ga18      in                      xlk165c08ex.5p                                                                                                TAGTTGTTAAGCGTGGTGNGGNTCNNTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCNANNNNNNNACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTGAGCATATCACGCCTCTGCAGNATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGNTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGNCCGTCGACTCTATGTTGGAAANATTCCATTTGGAATCACAGAGGAGNNAATGATGGACTTCTTTAATGCCCNGATGCGCCTNGGNGGATTGACTCAAGCACCTGGAAANCCTGTACTGGCTGTNCAAATCAATCAAGACAAAAANTTTNCCTTTTTGG
  5   1   2       bld Oo1  5g                         IMAGE:6639354.5p                                                                                                 TTGCGGCTGCGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTTGATGNGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCCATCTGTGTATGTACCAAGGGGTGGTTTTCCCACAGTTGTCCCCTGACTCTGCACACAAGCTATTTCATTTGGAAGGTTTACCCCCAACCTATCTGNAATGGGATGACCCAGGTCAAA
  5   1   2       bld Tbd7 5g3  in                         XL065k01.5p                                                                                                  ACGAGGGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTTAAATCAATCAAGACAAAAACTTTGCCTTTTTGG
  5   1   2       bld Tbd7 5g3  in                         XL109k14.5p                                                                                                  GGNCTGCAGGNAATTCGGCACGAGGCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGA
  5   1   2       bld Emb9 5g                         IMAGE:7976475.5p                                                                                                    GCGTGGTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAAGTTCGTTCTGTTGATGAAACAACACAGGCAATG
  5   1   2       bld Tbd7 5g3  in                         XL062j16.5p                                                                                                     GCACGAGGGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAA
  5   1   2       bld Neu7 5g                              XL041c01.5p                                                                                                      CGAGGGTCGTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAA
  5   1   2       bld Emb4 5g                         IMAGE:5571904.5p                                                                                                       CCACGCGTCCGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCNCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTTGGAGTTTTCGTTCCTGTTGATGAAACAACACAGGCAATGGGCTTTTGATGGGGATAATTTTTTCCAGGCCCAAGTCTCTTAAAAATTAGACGGCCCTCCATGATTAACCAGCCCTNTACCAGGGCATGGTCTGGAAAAACCCCATCCGTTTTATGTTACCCAAGGGGTGGGTTTTCCACCAGTTGGCCCCCTGGACTCCTGCCACACAAAGCTTTTTCCTTTGGAAGGTTTTACCCCCACCTATACCCGGAAT
  5   1   2       bld Ga12 5g3  in                         XL214m18.5p                                                                                                        CGAGGGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAA
  5   1   2       bld Tbd7 5g                              XL057b02.5p                                                                                                         GTGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGT
  5   1   2       bld Egg4 5g                         IMAGE:3745026.5p                                                                                                          TGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTATGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACATGCCCGTCGACTCTATGTTGGAAGTATT
  5   1   2       bld Ga15 5g                            XL442n05ex.5p                                                                                                          TGCGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCNGTCACATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATNCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCCATGGCTTTTGATGGGATAATTTTTCAAGGCCCAGTCTCTTAAAATTANCACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAA
  5   1   2       bld Emb9 5g                         IMAGE:7976828.5p                                                                                                            CTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGCGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCCAGTCTCTTTAAAATTAGACGCCCTCATGATTAACCAGCCCT
  5   1   2       bld DMZ  5g3  in                         xl308p07.5p                                                                                                            CGGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTC
  5   1   2       bld Neu7 5g3  out                        XL006m01.5p                                                                                                             GTCTTGTTCTTCTTTCTCCTCCCCCGCTCGTTCCTCAGAGNAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGGCCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGA
  5   1   2       bld Neu7 5g3  in                         XL012a08.5p                                                                                                             NCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGNAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATC
  5   1   2       bld Tbd7 5g3  in                         XL108l21.5p                                                                                                             GGCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAAT
  5   1   2       bld Tbd7 5g3  in                         XL096h18.5p                                                                                                              GCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGG
  5   1   2       bld Tbd7 5g                              XL096o11.5p                                                                                                              GCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAG
  5   1   2       bld Ga12 5g3  in                         XL166h07.5p                                                                                                              GCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGAT
  5   1   2       bld Ga18 5g                             xlk3d08ex.5p                                                                                                              GTCTTGTTCTTCTTCCTCCTCCCCCGCTCGTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGNTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGNCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACNNNNNNATCCAAGGATCGGAGGC
  5   1   2       bld DMZ  5g3  in                         xl283e11.5p                                                                                                              GCTGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGA
  5   1   2       bld Emb1 5g                         IMAGE:3402459.5p                                                                                                               CTGCGTGGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGNAGGCGACGCAGNCCCTCACCAAGACATGAGAAGAAAAAGAAGATGCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATGAAGCACTGCGAGCTGCGGGTCAGATTCCAGCTACTT
  5   1   2       bld Neu7 5g3  in                         XL034b13.5p                                                                                                                GGCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAA
  5   1   2       bld DMZ  5g3  in                         xl226j14.5p                                                                                                                 GCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTT
  5   1   2       bld DMZ  5g3  in                         xl328l15.5p                                                                                                                 GCGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAAT
  5   1   2       bld Neu7 5g3  in                         XL004c21.5p                                                                                                                  GGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTG
  5   1   2       bld Ga18 5g3  in                       xlk73d08ex.5p                                                                                                                  CNNTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGNTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGC
  5   1   2       bld Neu7 5g3  in                         XL043d06.5p                                                                                                                   GTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCC
  5   1   2       bld Ga12 5g3  in                         XL210p18.5p                                                                                                                   GTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGNTCAAATCAATCAAG
  5   1   2       bld DMZ  5g3  in                         xl322a03.5p                                                                                                                    TTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGNAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTNCGTTCTGTTGATGAA
  5   1   2       bld DMZ  5g3  in                         xl320c11.5p                                                                                                                    TTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGA
  5   1   2      seed DMZ  5g3  in                         xl341c22.5p                                                                                                                    TTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCANGGCCAGTCTCTTAAATTA
  5   1   2       bld Ga12 5g3  in                         XL216k04.5p                                                                                                                     TGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTTGGAGTTTCGTTCTGTTGATGAA
  5   1   2       bld DMZ  5g3  in                         xl294a02.5p                                                                                                                      GTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCANTCAAGACAAAAACTTTGCCTTTTTG
  5   1   2       bld Ga18                               xlk80e11ex.5p                                                                                                                       CGTTGTCTTCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGNTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACNNNNNNTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCnnnnnnnnnACNAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTGCAGNATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCNACAATGACACCAGATGGNTTGGCAGNTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATNCCATTTGGAATCACAGAGGAGGNAATGATGGACTTCTNTAATGCCCNGATGCGCCTNGGTGGATTGACTCAAGCACCTGGAAANCCTGTACTGGCTGTTCNAATCAATCAAGANAAAAANTTTTGCCTTTTTNG
  5   1   2       bld Neu7 5g                              XL050g21.5p                                                                                                                        GCTTCTTTCTCCGCCTCCTTCCTCTTAGNAACAAGAGCGCGAGAAGAGTACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCT
  5   1   2       bld Egg3 5g                         IMAGE:6327194.5p                                                                                                                          GGATCGAAATTCCCCGGGCGTTCCTCAGAGATCCGAGCGCGAGAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCCGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAGGGGGTGGTTTCCACAGGTTGTCCCCTGACTCTGCACACAAAGCTAATTCATTGGGAGGTTTTACCCCAACCTATCTGGAATGGATGAACCCGGGGTAAACCAATGGGAGGTCCATTTAAAGCCCCTAATGGGGGTCAAAAGGAATTTGCCTTTA
  5   1   2       bld Ga12 5g3  in                         XL163i21.5p                                                                                                                          GCTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACT
  5   1   2       bld Neu7 5g3  in                         XL014c11.5p                                                                                                                           CTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAA
  5   1   2       bld Tbd7 5g                              XL096p20.5p                                                                                                                           CTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTG
  5   1   2       bld Ga12 5g3  in                         XL161i03.5p                                                                                                                           CTTCTTTCTCCGCCTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAA
  5   1   2       bld Brn3 5g                         IMAGE:8540488.5p                                                                                                                           ATAGNNNCCCATAAGCGNNGGGGTGCTCGATTCGATTCGTCCCGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTAGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAACAACACAGGCAATGGCTTTTGATGGGATAATTTTCAAGGCAGTCTCTTAAAATAGACGCCTCATGATACCAGCCTTTACAGCATGTCTGAAACCATCGTTAGTACAGGGTGGTTCCCAGTGTCCTGATCGCCCAGCTTTCATGAGTACCACTACGATGAGACAGTAGACGTCTCTTTGGCTAAACTTTATGAAGAGGCCAGCTCAAGTGCTTGATTGATAGC
  5   1   2       bld Emb3 5x3  out                   IMAGE:3398764.5p                                                                                                                                 TcccccgccccacccccTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACANGACANGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGTATCACAGAGGAGGCAGTGATGGACTTTCTTAATGCCCAGATGCGCCTTGGTGGATCGACTCAAGCACCTTGGAATCCTGTACTGGCTGGTCACATCAATCACGACA
  5   1   2       bld Ga12 5g3  in                         XL184l22.5p                                                                                                                                    GGCCGCCTCCTTCCTCTTANAACAAGAGCGCGAGAAGAGACCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGG
  5   1   2       bld DMZ  5g                              xl341e10.5p                                                                                                                                     CGCTCGTTTCCTCAGAGAACAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTT
  5   1   2       bld Oo1  5g                         IMAGE:6642946.5p                                                                                                                                        CGCTCGTTCCTCGAGAACAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCCAGGGGTGGTTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCCAGGTAACCATGGAGGTCATTAAGCCTATG
  5   1   2       bld DMZ  5g3  in                         xl254a12.5p                                                                                                                                        CTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTA
  5   1   2       bld DMZ  5g3  in                         xl273j10.5p                                                                                                                                        CTCCTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAA
  5   1   2       bld Emb9 5g                         IMAGE:7977909.5p                                                                                                                                           CTTCCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATG
  5   1   2       bld DMZ  5g                              xl298l23.5p                                                                                                                                             GAGAGAGAGAGCAAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCANGGCCAGTCTCT
  5   1   2       chi Emb4                            IMAGE:5542260.5p                                                                                                                                              ACACTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGGAATCCCGAAGGAAGGCAATGATGGGACTTCCTTTATAGCGCCCCAAAATCCCCCCTgggggggggATTTAACCCCCAACACACCGTCNGGGAAAACTCCGCCCGGGGGGCGTGGCCATACCCCCCCAAAACACACAAATTCCTCCCCCTTTTTGAGGGGCTCTTTCTCCTCGGGGCGGAAAAACCCcccacacggcccccttcgtttctccttggggtcccccaatctttttttccccgggccccctggtgccccccctaccctaacaaaacgcgcccccGGCTTCGCTCACTCGTAGCGCGCTTATCCCTCCCTCTCTATTCCCCACCGCGCCCACCCAGTATCCCTATATTTCCCGCACAAACATCAGCTAGTCCTCCGTTTTTATTTCGCACCTCGCCCCATAGCAGCCTGNTCCCTTCCGACTACCCACCCCCCG
  5   1   2       bld Ga18 5g3  in                        xlk6c03ex.5p                                                                                                                                              CCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCNA
  5   1   2       bld Ga18 5g3  in                       xlk54h02ex.5p                                                                                                                                              CCTCTTAGAACAAGAGCNCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGC
  5   1   2       bld Ga18 5g3  in                      xlk125o15ex.5p                                                                                                                                              CCTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTAGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCNA
  5   1   2       bld DMZ  5g3  in                         xl330j07.5p                                                                                                                                               CTCTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTANCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAA
  5   1   2       bld Ga12 5g                              XL206g20.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGTTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTG
  5   1   2       bld Emb9 5g                         IMAGE:7977294.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAACCCATCGATTTATGTACCAGGGTGGTTTCCACAGTGTCCCTGACTCTGCACACAGGCTTTCATGGAGGTTTACCACCTATCTGATGAATGACCAGGGTAACCATG
  5   1   2       bld DMZ  5g3  in                         xl316n06.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAANCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCANGGCCAGTCTCTTAAAAT
  5   1   2       bld DMZ  5g3  in                         xl306n01.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCANGGCCAGTCTCT
  5   1   2       bld DMZ  5g3  in                         xl292h10.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGNCAGTCTCTTAA
  5   1   2       bld DMZ  5g3  in                         xl304c15.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCNATGGCTTTTGATGGGATAATTTTTCANGGCCAGTCTCTTA
  5   1   2       bld DMZ  5g3  in                         xl295o15.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCNTCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGANTGAAAATAANCAAGAAAGGGACAAGGAAAATCGGCATANAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAANCCGTAGCAAAGAAAGACGANCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGG
  5   1   2       bld DMZ  5g3  in                         xl250p21.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCA
  5   1   2       bld DMZ  5g3  in                         xl337c02.5p                                                                                                                                                 CTTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTA
  5   1   2       bld Tbd7 5g3  in                         XL071k08.5p                                                                                                                                                  CGGGCTGCAGGNAATTCNGCACGAGGGCCGCACCGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTTGATGGGATAATTTT
  5   1   2       bld Emb1 5g                         IMAGE:6634877.5p                                                                                                                                                   TTAGAACAAGAGCGCGAGAAGAGACGGCTGGCTGGAGCTTGAAACGGACTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTGCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCCAAGCCGTAGCAAAGAAAGACGAGCTACAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGAATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGCGGGCAGTCAGATGACCAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGACACAACACAGGCAATGGCCCTTTGATGGGATAAGTTTTCAAGGCCCAGTACTCTTAAAATTAGCACGCCCCGCATGATTTACCCAGCCTTTACCAGGCCATGATCCTGAAAAACCCCATCGCCGATTTATGAAAACCCAGGGGGTTGGGATTTTCCAACAAGGATTAGACCCCCCTGGGACTTCTTGGCCACCAACAAGAACCttttttttAAATTTGGGCGAAGGGTT
  5   1   2       bld DMZ  5g3  in                         xl313c13.5p                                                                                                                                                    GAACAAGTAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCNATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTT
  5   1   2       bld Tbd7 5g                              XL060n06.5p                                                                                                                                                      GCAAGAGCGCGAGNAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAG
  5   1   2       bld Ga18 5x                            xlk70c06ex.5p                                                                                                                                                      AACAAGAGCNCGAGAAGAGANGGCTGGCTGGCGCTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTAGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCNANNNNNNNACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTGCAGNATAAAGCCATGCAAGCTGCGGGNCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGNNTGGCAGNTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTNTAATGCCCAGATGCGCCTTGGNNGATTGACTCAAGCACCTGGAAANCCTGTACTGGCTGTTCANATCAATCAAGACANAAACTTTGCC
  5   1   2       chi Emb1                            IMAGE:6637192.5p                                                                                                                                                       ACAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCNCTTCCACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGGCCCGTCGACTCTATGTTGGGAAATATTTCCATTTGGGAATCCCAGAGGAAGGCAATGAATGGACTTTCTTTTAATGCCCCAGATGGCGCCTTGGGGGGGAATTGGACTCCAAGCCACCTGGGAAAATCCCTGTAACTTGGCTGGTTCCCAAATCCAATTCCAGGAACCAAAAACCTTTTGCCCCTTTTTGGGGAAGGTTTCCCCTTTCCGGGTTGGGATGGAAACCCAACCCCCAAGCGCAAATGGGCCCCTTTGGGATGGGGGAAAAAAATTTTTTTCCAGGGGGCCCAGGTTCCCCCTTTAAAATATTTTGGACCC
  5   1   2       bld Sp1  5g                         IMAGE:5511136.5p                                                                                                                                                        CAAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTNCAGGCCAGTCTCTTANAATAGACGCCCTCATGATTACCAGCCNTTACAGGCATGTCTGAAAACCATCCGTTATGTACANGGGTGGTC
  5   1   2       bld Ga12 5g3  out                        XL200e18.5p                                                                                                                                                         AAGAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGGCCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAAC
  5   1   2       bld Te2N 5g                         IMAGE:7205133.5p                                                                                                                                                         AAGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCGAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCCGTTATGTACCANGGGGTGGTTNCNNACAGTGGTCCTGACTCTGCACACAGCTTTTTCATTTGGAGGGTTTACCCACCTATCTGAAATGATGGACCAGGTTAACCAATGGAAGTCCTTTTAGGCCCTTTGTGGGTTAAA
  5   1   2       bld Emb4 5g                         IMAGE:4680666.5p                                                                                                                                                          AGAGCGCGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGGTCAAATCAATCAAGACAAAACTTTGCCT
  5   1   2       bld Ga12 5g3  out                        XL158p19.5p                                                                                                                                                           GAGCGCGAGAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGGCCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCC
  5   1   2       bld Ga18      in                      xlk124g20ex.5p                                                                                                                                                           AACAAGAGCNCGAGAAGAGACGGCTGGNTGGNNNTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCNNNNTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCnnnnnnnnnACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTGCAGTATAAAGNCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGNTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGNAGTCAGATGACAAGACAGGNCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGNAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGNGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCANATCAATCAAGACANAAACTTTGCCTNTTTGGAGNNTCGNTCTGTTGATGAAACAACACA
  5   1   2       bld Neu7 5g                              XL030k04.5p                                                                                                                                                            GCGCGAGTAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGA
  5   1   2       bld Tbd7 5g3  in                         XL098g22.5p                                                                                                                                                            CGCGAGAAGAGCACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCTCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTT
  5   1   2       bld Neu7 5g3  out                        XL018b15.5p                                                                                                                                                             CGCGAGNAAAAGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGNTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGNGGGCAGNCAGATGACGAGGCAGGCCCGTCGACTCTAT
  5   1   2       bld Neu7 5g3  in                         XL024i10.5p                                                                                                                                                               CGAGAAGTAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCATTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTC
  5   1   2       bld Emb4 5g                         IMAGE:5514702.5p                                                                                                                                                                CGAGAAGAGACGGCCGGTTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGANACAACACAGGCAATGGCTTTTGATGGGATATTTTTCAGGGCAGTCTCTTAAAATAGACGCCTCATGATACCAGCTTTACAGGCTGTCTAAAACCATCCGTTATGTACAGGGTGGTTCACAGTGTCCTGATCTGCAACAGCTTTCATTA
  5   1   2       bld Emb9 5g                         IMAGE:7978387.5p                                                                                                                                                                CGAGAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGCAATGGCCTTTGATGGGATAATTTTTTAAGGCCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCCTTTACAAGGCA
  5   1   2       bld Neu7 5g3  in                         XL033o16.5p                                                                                                                                                                   AGNAGTACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAAT
  5   1   2       bld Neu7 5g3  in                         XL034p22.5p                                                                                                                                                                   GAAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTT
  5   1   2       bld Ga14 5g                            Ga14-p11d2.5p                                                                                                                                                                   GAAAAGACGCTGGACTGGATCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGNAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCC
  5   1   2       bld DMZ  5g3  in                         xl310i09.5p                                                                                                                                                                    AAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTT
  5   1   2       bld DMZ  5g3  in                         xl287a07.5p                                                                                                                                                                    AAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCAT
  5   1   2       bld DMZ  5g3  in                         xl330m04.5p                                                                                                                                                                    GAGAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGANTTCGACGAGTTCGAGCGGCNNCTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTANCAAAGAAAGACGAGCTANAGAGCANCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCNGTATAAAGCCATGCNAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCANCAATGACNCCANATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTG
  5   1   2       bld Tbd7 5g3  in                         XL092b04.5p                                                                                                                                                                     GNAGACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTT
  5   1   2       bld Tbd7 5g3  in                         XL070d06.5p                                                                                                                                                                      NAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTA
  5   1   2       bld FaBN 5g                         IMAGE:8078862.5p                                                                                                                                                                      GAGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAAATTTTCAGGCCAGTCTCTTAAATTAGACGCCTCATGATTACCAGCTTACCAGCTGTCTGAAAC
  5  -1   2       bld Gas8                            IMAGE:3517509.5p                                                                                                                                                                       AGACCGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAGAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACACCCGTTCTAGAAGCCGAGAAAGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCA
  5   1   2       bld Tbd7 5g3  in                         XL090k04.5p                                                                                                                                                                       GGACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAG
  5   1   2       bld Neu7 5g3  in                         XL044i03.5p                                                                                                                                                                        ACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGNAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGA
  5   1   2       bld Neu7 5g3  in                         XL047o15.5p                                                                                                                                                                        ACGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGNAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGNCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTNTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATG
  5   1   2       bld Tbd7 5g3  in                         XL082f10.5p                                                                                                                                                                         CGGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGNAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTATGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCA
  5   1   2       bld Tbd7 5g3  in                         XL105a02.5p                                                                                                                                                                         ACGGCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGAT
  5   1   2       bld Ga18      in                      xlk164p24ex.5p                                                                                                                                                                          AAGAGACGGCTGGNTGGNNNTTGAACACGGCCTGNNNNGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACNNNNNNTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGC
  5   1   2       chi Tbd5                            IMAGE:3580607.5p                                                                                                                                                                           CGCTGGACTGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAAAGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGTGAAAATTGTGGGGCTGAAATCCCTTCGTAGCANAATAAGTTTGCTACCATCGTGCAAGGAGGCAATGATGGACTTCT
  5   1   2       bld Neu7 5g3  in                         XL047p04.5p                                                                                                                                                                           GCTGGCTGGCGCTTGNACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGNATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTT
  5   1   2       bld Neu7 5g3  in                         XL014e23.5p                                                                                                                                                                           GGCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTT
  5   1   2       bld Tbd7 5g                              XL108m12.5p                                                                                                                                                                            GCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAA
  5   1   2       bld Tbd7 5g3  in                         XL101e06.5p                                                                                                                                                                            GCTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGG
  5   1   2       bld Tbd7 5g3  in                         XL087l16.5p                                                                                                                                                                            GCTGGCTGGCGCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAA
  5   1   2       bld Tbd7 5g3  in                         XL060g16.5p                                                                                                                                                                             CTGGCTGGCGCTTGAACACGGCCTGCTGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTNCTTCCAACAATGACACCAGATGGNTNGGNAGNTACTNCTACTNCTGTGCCTGNTGNGGGCA
  5   1   2       bld Ga18      in                      xlk164k02ex.5p                                                                                                                                                                             AGACGCTGGCTGGCGCTTGAACACGGCCTGCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGNNNNNTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCnnnnnnnnnACNAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTGCAGNATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGNTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGNCAGATGACAAGACAGGNCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGNAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGNNGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTNTTTGGAGNTTCNNNCTGTTGATGAAANAA
  5   1   2       add Ga18 5g3  out                      xlk60e09ex.5p                                                                                                                                                                                GGACTGGCTCTTGAGNANNNNNGCCGCCGCCATCGCTACAAGGGGGANCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGNCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACNNNNNNATCCAAGGATCGGAGGC
  5   1   2       bld Ga12 5g3  in                         XL184o23.5p                                                                                                                                                                                 CGAGGCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGGCCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAA
  5   1   2       bld Neu7 5g                              XL031p23.5p                                                                                                                                                                                  CTGGCTCTTGANCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGT
  5   1   2       bld Ga18      in                       xlk80e08ex.5p                                                                                                                                                                                   TGGNTGGNNNTTGAACACGGCCTNCCNCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGNCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCnnnnnnnnnACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGNTTGAGCATATCACGCCTCTNCAGNATAAAGCCATGCAAGCTGCGGGNCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGNTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGNCAGATGACAAGACAGGNCCGTCGACTCTATGTTGGAAATATTCCANTTGGAATCACAGAGGAGGCAATGATGGACTTCTNTAATGCCCAGATGCGCCTTGGNGGATTGACTCANGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACANAAANTTTGCCTNTTTNGAGNT
  5   1   2       bld Oo1  5g3  in                    IMAGE:3403545.5p                                                                                                                                                                                    GCGCTAGAACACGGCCTGCTGCCGTCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTTGACTCTATGTTGGGAATATTCCATTTGGCAATACAGATGGAGCAATGATGGACTTCTTTACTGCCCAGATGCGTCTTGGTGGATTGACTTCAGCG
  5   1   2       bld Ga12 5g3  out                        XL177m03.5p                                                                                                                                                                                     GCTCTTGAGCACCGCTTGCCGCCGCCATCGCTACAAGGGGGACCATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACA
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580830.5p                                                                                                                                                                                      GCTTGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATG
  5   1   2       bld Gas5 5g                         IMAGE:3749780.5p                                                                                                                                                                                         TGAACACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAAGAAGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGA
  5   1   2       bld DMZ  5g3  in                         xl271c20.5p                                                                                                                                                                                             CACGGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAA
  5   1   2       bld Emb1 5g                         IMAGE:6864979.5p                                                                                                                                                                                              ATTGCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTTGTTTTCCACAGTTGTCCCTGAACTCTGCCACACAAGCTTTTTCATTTGGAGGGTTTACCCCAACTATTCTTGAAATGATGACCCCGGGTTAAACCCTGGGAAGTTCTATTAAAGCCCTAATGGGGGTTTTAAAGGAAAACGGGCCTTAACACTCCtttttggggggcccctttttaaaaaaggcattttttaattttGA
  5   1   2       bld Emb4 5g                         IMAGE:4679859.5p                                                                                                                                                                                                GCCTGCCGCCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGTTATTTCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAAGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGACGCAATGATGGACTTCTTTAATGCCCAGATGCCCCCTGGGTGATTGACTCCAGCACCC
  5   1   2       bld DMZ  5x3  out                        xl268o20.5p                                                                                                                                                                                                       CGCCGCCATCACACTAAAGCGCAACCNTGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCATTCGCTCACCANGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCNACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTNTGTTGGAAATATTCCATTTGGAATCACNGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTNCTGGCTGTTCNAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTG
  5   1   2       bld Eye1 5g3  in                    IMAGE:4743618.5p                                                                                                                                                                                                         CCGCCATCACACTAAAGCGCAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAA
  5   1   2       bld Ga18      out                     xlk130d15ex.5p                                                                                                                                                                                                          CTTGNCGCCGCCATCGCTACAAGGGNNANNTCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGNCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACNNNNNNATCCAAGGATCGGAGGCNANNNNNNACNAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTNCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGNCTGGCAGNTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGNATCACTGAGGAGNNNATGATGGACTTCTTTAANGCTCAGATGCGANTTGGNGGANNGACTCAAGCACCTGNNAATCCTGTACTGNCTGTTC
  5   1   2       bld Tbd7 5g3  in                         XL080m08.5p                                                                                                                                                                                                              TCACACTAANNCGCAACCATGNATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGNA
  5   1   2       bld Ga15 5g3  in                       XL467m24ex.5p                                                                                                                                                                                                                  CGCTCCGGCGCAACCATGATGTCCGAATTCNACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACNAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCC
  5   1   2       bld Emb4 5g                         IMAGE:4683541.5p                                                                                                                                                                                                                                CATCATGTCCGACTTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGAGACAAGGAAAATCGCCATAAAAAACGCAGTCACAGCCGTTCTAGAAGCCGAGAACGGAAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACGAAGTGGATCCAAGGATCGGAGGCGACGCAGTCGCTCACCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAAATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCCCCCCTTTTACCAGGCATGGTCTGAAAAACCCATCTTGTGTATGTACCCAGAGACTGGCAGTTTCCAGCCCAGGGACTTTCCCGAGCCaaaaaaaagggcttaaaatgggaaatggggggttttggtttattttttttCCCCTTTCCCACAATATCCCATTCCCTTTTTCTTTTAACCggggggggtggggTTTTCCCACCAGGGTTGGGTCCCCCTTGAACATCCCTGCGCCCACCACAAGGGCttttttttttCTTTGTGGGGAGGGGTTTTTTCCC
  5   1   2       bld Ga18      in                      xlk103k06ex.5p                                                                                                                                                                                                                                GNAACCATGATGTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACNNNNNNTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCNANNNNNNNACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGNTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGNGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGNTCTGTTGATGAAANANCACAGGCAATGNNTTTTGATGNGATAANTTTTCAAGGNCAGTCTCTNANAANTAGACGCCCTCATGANTACNNGCCTTTACCAGGCATGTCTGANA
  5   1   2       bld DMZ                                  xl224e10.5p                                                                                                                                                                                                                                    ATGTCCGAATTCGACNAGTTCGAGCGGCNNCTGAATGAAAATAAGCAAGAANGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAANAGCANAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCANTCNCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACNCCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACNGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCANTCAAGACNAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTA
  5   1   2       bld Ga12      in                         XL149d24.5p                                                                                                                                                                                                                                     GGGCTGCAGGCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGC
  5   1   2       bld Gas6                            IMAGE:3473346.5p                                                                                                                                                                                                                                      GTCCGAATTCGACGAGTTCGAGCGGCAACTGAATGAAAATAAGCAAGAAAGGGACAAGGAAAATCGGCATATAAAACACAGTCTTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTAAAAGCCGT
  5   1   2       bld Neu7      in                         XL038m15.5p                                                                                                                                                                                                                                                                             AAGCACAGAAAGGGACANGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGNAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGNCGACTCTATGTTGGAAATATTNCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGG
  5   1   2       bld Neu7      in                         XL013g11.5p                                                                                                                                                                                                                                                                               GGCACGAGGGGGACAAGGAAAATCGGCATAGAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTCGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTT
  5   1   2       bld Tbd7      in                         XL074m01.5p                                                                                                                                                                                                                                                                                       GGGACACGGAAAATCGGCATAGCAAAACGCAGTCGTAGCCGCTCTAAAAGCAAAGAACGGAAGCGTNGAAGCCGTAGCAAAGAAAGACGAGCTAGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGNACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGNGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTNGGTGGATTGA
  5   1   2       bld Ga18                              xlk120a06ex.5p                                                                                                                                                                                                                                                                                                                                                         AAGCGACGAAGCCGTAGCAGAGAAAGACGAGCTAGAGAGCAACNNANGNATCCAAGGATCGGAGGCGnnnnnnnnCCAAGAAATGAGAAGAAAAAGAAGATCCGTAAATATTGGGATATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGNGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAANTTTGCCTTTTTGGAGNTTCGTTCTGTTGATGAAACCACACAGGCAATGNNTTTTGATGGGATCATTTTTCANGNNCNGTCTCTNAAAANTAGGCGNCCTCATGATTACCAGNCTTTACCAGGNATGTCTGAAANNCCATCTGTGTNTNTNCCNGGGGNGGNTTCCNCAGTNGNNCCTGANTCTGCNCNCNAGCTATTCATTGGNNG
  5   1   2       bld Ga15                               XL424d23ex.5p                                                                                                                                                                                                                                                                                                                                                                           AGACGAGCTANAGAGCANCGAAGTGGATCCANGGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTANATACTGGGACNTTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACATAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACA
  5   1   2       bld Neu7      in                         XL026o16.5p                                                                                                                                                                                                                                                                                                                                                                                    AGAGAGCAGCGAAGTGGATCCAGGGATCGTAGGCGNNGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTG
  5   1   2       bld Ga15                               XL429g04ex.5p                                                                                                                                                                                                                                                                                                                                                                                             CGAAGTGGATCCAGGGATCGTANGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGAATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCNAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGNTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATG
  5   1   2       bld Ga18                              xlk114c05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                    AGTGGATCCAAGGATCGGAGGCNNNNNNNCNNCCAAGAAATGAGAAGAAAAAGAAGATCCGTAAANNTTGGGATATTCCACCTCCTGGNTTTGAGCATATCACGCCTCTGCAGNATAAAGCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCAACCATGACTCCNNANGGTCTGGCAGTTACTCCTACTCCAGTGCCTNTNGTGNGCAGTCAGATGACGAGGCAGNCCCGTCGACTCTATGTCGNAAATATTCCATTTGGAATCACTNA
  5   1   2       bld Em10                            IMAGE:7982626.5p                                                                                                                                                                                                                                                                                                                                                                                                           GGATCGTAGGCGACGCAGTCGCTCACCAAGACATGAGAAGAAAAAGAAGATCCGTAAATACTGGGACATTCCGCCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCTTTAAAAGCATTTATTTGGTAAAGACAGTGCCACAGGCCTATCAAAAGTTATGCCTTTGTGATATGTGATATAATGTCACGATCAGCAATGCTGACTGATGGATGCACTGGTGACAAAGCTTTGTACGAG
  5   1   2       bld DMZ       in                         xl246c04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAAAAGAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACNATGACNCC
  5   1   2       bld Emb1                            IMAGE:5156850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGTAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTATTTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGGGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAAATGGATGCAACTGGGTGACAAAAAGCTTTTTGGTACCAAGGGCTAATGGTCCGGACCTAAGAAATGCCACACTGAACCCAATAAATCCGACTCCAGTGACCCCTCAAGTCCCTGGGACTATTGAGTTCTCCAGGGGCAAAAGGGGGGGCCTTCCAAACAGAAGGGTTGG
  5   1   2       bld Ga15      in                       XL502b07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGATCCGTAAATACTGGGACATTCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGGAATATGTGGAT
  5   1   2       bld DMZ       out                        xl274g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAATACTGGGACATTCCNCCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACNANATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGNNG
  5   1   2       bld Emb4                            IMAGE:5514570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCCGCCCCCTTTTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCCTGCAAGCTGCTGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACATGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTACACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAATCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGTATATTAATGTCATGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTCGTACTGAGGGCTAGTGTTTGAGCT
  5   1   2       bld Tbd7      in                         XL051d06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGACATTCCCCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATG
  5   1   2       bld Ga18      in                      xlk122m03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCACCTCCTGGTTTTGAGCATATCACGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGNNNTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTNCTGGNCTGAATGNAANNCAACTGGGTGANAAAAAGCTTTTGGNACAGAGGGCTAG
  5   1   2       bld Ga15                               XL441c16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGATCCGCGCCTCTGCAGTATAAAGCCATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGNTTATGTACCAGGGGTGGNTTCCACAGATTGTCCCTGANTCTGCACACAANC
  5   1   2       bld Emb9                            IMAGE:7975430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCATGCAAGCTGCGGGACAGATTCCAGCTACAGCTCTTCTTCCACCATGACTCCAGATGGTCTGGCAGTTACTCCTACTCCAGTGCCTGTTGTGGGCAGTCAGATGACGAGGCAGGCCCGTCGACTCTATGTCGGAAATATTCCATTTGGAATCACTGAGGAGGCAATGATGGACTTCTTTAATGCTCAGATGCGACTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCTTTAGCCTATGGGTCAAAGAATTGCTTACATCTTTTGGGCCTTTTAAAGCATTTAATTTGGTAAAGACAGTGCCCATGCCTTCCAAAGGTTAGCTTTTTGTGAATCTCGGACTTAATGTTACGATAGGGCCATGCTGGACTCTGGGATGCATGGGTGATAAAGCTTTTGTCTTAGGCGATTGTGTATTAAATGTACTTTATACATAAATTACCCATGTC
  5   1   2       bld DMZ       in                         xl290j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCAAGCTGCGGGTCAGATTCCAGCTACTGCTCTCCTTCCAACAATGACACCAGATGGTTTGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGA
  5   1   2       bld Neu7      in                         XL026m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTA
  5   1   2       bld Spl                             IMAGE:8463978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTTACTCCTACTCCTGTGCCTGTTGTGGGCAGTCAGATGACAAGACAGGCCCGTCGACTCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCCAGTCCCTGGACTTA
  5   1   2       bld Ga18      in                      xlk118k05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTATGTTGGAAATATTCCATTTGGAATCACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCCTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGNTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCANNNNNNATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGNTAGTGTCGNAGCTAAGAATGCAACACTGAGCACAATAAATCAGANTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATNGGNGGNCATCCNACAGANGTNNTGNNCCTNATGAANNNGGTGGTGCCGGANGNACTGATAGA
  5   1   2       bld Tbd7      in                         XL052o24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTATGTTGGAAATATTCCTTTGGAATACAGAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCA
  5   1   2       bld DMZ                                  xl246d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTGGAAATATTCCATTTGGAATCACANAGGAGGCAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAAT
  5   1   2       bld Ga18      in                       xlk59m14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATATTCCATTTGGAATCACAGAGGAGGNAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGNTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCANNNNNNATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTNGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGNCCCTGGACTTATGAGNTCTCAGGTGCAGATGGGTGGNCATCCAACAGAGGTNNTNTGCCTNATGANNAT
  5   1   2       bld Ga18      in                       xlk62c15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGNAATGATGGACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGNTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCANNNNNNATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTNNCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGANGTTAGGGNTGAGTNNGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCNAG
  5   1   2       bld Ga18      in                      xlk130i13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTCTTTAATGCCCAGATGCGCCTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCANNNNNNATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGNCTGATGAATATGGNGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGANGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAANTCCACGCCCAGNGNTGGAGNTGAA
  5   1   2       bld Tbd5                            IMAGE:3580886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAATTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACCACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTCAAAGAATTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAG
  5   1   2       bld Ga12                                 XL210p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGA
  5   1   2       bld Ga12                                 XL210p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTGGATTGACTCAAGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGAT
  5   1   2       bld DMZ       in                         xl260d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGACTCANGCACCTGGAAATCCTGTACTGGCTGTTCAAATCAATCAAGACAAAAACTTTGCCTTTTTGGAGTTTCGTTCTGTTGATGAAACAACACAGGCAATGGCTTTTGATGGGATAATTTTTCAAGGCCAGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGG
  5   1   2       bld Lmb1      out                   IMAGE:8531632.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACACAGGCAATGGCTTTTGATGGGATCATTTTTCAAGGCCAGTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTCAAAGAATTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCAG
  5   1   2       bld Neu7      in                         XL006g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAATTTTTCAAGGCCGTCTCTTAAAATTAGACGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGA
  5   1   2       bld Tbd7      out                        XL088o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTCAAAGAATTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTC
  5   1   2       bld Tbd7      out                        XL089o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTCTTAAAATTAGGCGCCCTCATGATTACCAGCCTTTACCAGGCATGTCTGAAAACCCATCTGTGTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTCAAAGAATTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCC
  5   1   2       bld Tbd2                            IMAGE:3200781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCCTTTACCAGGCATGTCTGAAATTCTATCCGTTTATGTACCAGGGGTGGTTTCCACAGTTGTCCCTGACTCTGCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATA
  5   1   2       chi Ga15                               XL472h02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGCTGGTTTATATACCTCTACACAGCCTGAAATTGGGTAATACNAGTGAGTGAACATTAATTACNAGTGAACTATATTTTTGTTTGTGATCTGAGTGAATATGTTTTGGTTACTGTAGTTAACAATTGGCAGTCCAGTTGGTACACGTTTGGCCTATTACTTTGACTACTAGACAATTGCCATTCGGGACTTGTTCATTTGTTACATATTAGTTTATCACTGCACAGTTGGTAAGATCTGTGCCTGCTTGACCAAATTTTATTTCCCTAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCA
  5   1   2       bld Brn1                            IMAGE:7018865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGTTGTCCCTGACTCTGCACACAAGCTATTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTCAAAGAATTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACGTGATGGACTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGGATATCAAAAGGACCCTCAtttttatgtttttttctttttgcaaggaggcttttttttttttttggttttttGGAATTGGGTTAAAATTTTCCAGGGCCCAAATGT
  5   1   2       bld Skin                            IMAGE:8643617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACACAAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAATACTGTGATCCTGATGGTACCACCGTCGTGATTCTGGTAGAATTAGTGACATGCGGGCTGGAAGAGATGACTAGATCAGAGCTGGGGATACAGAANGACTCATTATATTTTCTTCTTGCAGAGCtttttttttCTTTCGATGCATTTATGCATGTACTACCTCTGACTCGACCTCCATCTTTAGATATAACTCTGCTCCCAACAG
  5   1   2       bld Ga15      in                       XL447c03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCTTTTCATTGGAGGTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGC
  5   1   2       bld Ga15      in                       XL473g05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTACCCAACTATCTGAATGATGACCAGGTAACCATGGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAAGGACCTTCattttattattttttctttcttttGCNG
  3   1   2       bld Ga18      in                      xlk118k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNCCCAGGNACCATGNNNNCATTAAGCNNNTGGGTNAAAANNNCNGCTNNNTNTTTGGGNCCTTTNAAAGCNTTNATTTGGTAAAAGACAGTNNNNNAGGCCTATCAAAANGNTTATNCNTTTNGNGAATATGTGGANNTNAATGTNNCGGNTCANNNNATTGCTGGACTNNAATGGNATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTNTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGNNCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAANAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGANNATNTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGANNNNNNACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTNCTTTTTATTCTTAGTGTATGGANNNTNC
  5   1   2       bld Emb4                            IMAGE:5514566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCACGCGTCCGATCGAGTCATTAAGCCTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAAGACCTTCattttattattttttctttcttttgcaggaggcttnttttttttttctttttCTGATTGTCTATTTTTATG
  5   1   2       bld Ga18      in                      xlk120p08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATCTGAATGATGACCAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGNTGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGANGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGNTGGAAAGAGANGAGCTAAGANTCAGAGGCTGGGGGANNAG
  5   1   2       bld Ga18      in                      xlk117n09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTATGGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGANGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGNTGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGANTGCCAGAAAGCCATGCAAGGNCTCACTGGACGCAAANTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGNAGAATTAAGTGACATGCCGGGCTGGAAAGAGANGAGCTAAGANTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTATTNTTTTTTCTTCTTTNNANGAGGNttttttttttttttttCTTTTCTGNTNTCTATTTTTATGGC
  5   1   2       bld DMZ       in                         xl243b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGTTAAAGAACTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAGAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCANGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCANACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCANGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGC
  5   1   2       bld Ga15      out                      XL464a18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCGAAAGAATTGCTTACATCTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACGTGATGGACTGGAAGAGATGAGCGAGAGGATCCANAGGCTGGGGGAATATCAAAAGGACCTTCATTTTATTGttttttctttttgcaggaggctttttttttttt
  5   1   2       bld Ga15      in                       XL422k18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTGGGCCTTTAAAAGCATTTAATTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAANATTCANAGGCTGGGGGAATANCANAAGGACCTTCattttattattttttctttcttttgcangaggctttttttttttt
  5   1   2       bld Emb1                            IMAGE:6637403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCATTTAANTTTGGTAAAAGACAGTGCCACAGGCCTATCAAAAGGTTATGCCTTTTGTGAATACGTGGATATTAATGTTACAGATCAGGCAATTGCTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACGTGATGGACTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGAATATCAAAAGGACCTTCattttattgttttttctttttgcaggaggctttttttttttttttttgttttttGACTTGGTTATATTTTCATGGCCAAATGTTACTTTATCCCTCTCTGAAACATCCTGACCACCTCACTAATACTTTTTAAGGAATTAAAATTTGACCCACAATGGTAAAATAACCCCTGGAAccccccttgccccccgcccccccTGGACCAATCTCCACCGGGGCTTAATACTGGAAATAAAATGGCCTTTTTCCCTCCATTTTCCTTTTCCCGG
  5   1   2       bld Neu7      in                         XL038b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGCCACAGGCCTATCAAAGGTTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCC
  5   1   2       bld Ga18      in                      xlk129c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAAAAGGNTATGCCTTTTGTGAATATGTGGATATTAATGTCACGGATCAGGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGNTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGANATGNCGGGCTGGAAAGAGATGAGCTAAGANTCAGAGNNTGGGGGAATAGCAGAAGGACCTTcattttattattttttctttcttttgcaggaggnttttttctttttctttttctgattgtctatttttATNG
  3   1   2       chi Ga18      in                      xlk103k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNCGGNTCAGNNAATNGCNGGNCTGAATGGAANNNAACTGGGTGNNNAAAAGCNTTTGGTANNNNGGNCNAGTGTCGGAGCTAAGAATGCAACNCNGAGCACAATAAATCAGNCTCCAGTGNCCCTCCNANTCCCNGGACNTATGAGNTCTCAGGTGCANNTGGGTGNNCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGNNCTNATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGNAAATACGGCGCTGTGNANNNAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAANNCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGANNNNTC
  5   1   2       bld Te2N                            IMAGE:7766356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggctttttttttttttttttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACAT
  5   1   2       bld Tbd7      in                         XL074f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAATTGCTGGACTGAATGGAATGCAACTGGGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGTAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggctttttttctttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCA
  5   1   2       bld DMZ                                  xl317i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGACTCAATGGGATGCAACTGGGTGATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACGTGATGGACTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGAATATCAAAAGGACCTTCattttattgttttttctttttgcaggaggctttttttttttttgtttttGGAC
  3   1   2       bld Ga18      in                      xlk117n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAATGGAANGCANCTGGGTGACAAAAAGCTTTTGGTACANNGGGCTAGTGTCGGAGCTAAGAANGCAACACTGAGCNCAAATAAATCANNCTCCANTGNNCCTCCAANTCCCTGNNCTTATGAGNTNTCAGGNGNAGATGGGTGGTCATCCNNNAGAGGTGTTGTGCCTGATGAATATGGNGGTGNCGGNAGNACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGNAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCNAGATCTTNNTAGNATTTACATCCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCNCTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAANTGACATGCCGGGCTGGANAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGNCCNNCNNNNNANNATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTTTTTTTTCTTTNNCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGANNNNNNACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTNNTCTTAGTGTATGGA
  3   1   2       bld Ga18      in                      xlk165c08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNCAAAAANNCTTTNNGNANAGANGGCTANNNTNNGNNNCTNAAGNATGNAANNCTGAGNNNANNAANNCAGNCNCCAGNNGNCCCNCCAANNCCCNGGNCTTATGAGTNCTCAGNNGNAGATGGGTGGTCANCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGNACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTNAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCNCGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAANNCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCTGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGNNNNNNNCAA
  5   1   2       bld Ov1                             IMAGE:8329880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGACAAAAAGCTTTTGGTACAGAGGGCTAGTGTCGGAGCTAAGAATGCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggcttttttttttttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTC
  5   1   2       bld DMZ                                  xl223o07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATAAAAAGCTTTTGGTGCAGAGGGCGAGTGTTGGAGCTAAGAATGCAACTCTGAGCACAATAAACCAGACACCAGTGACCCTTCAAGTCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACGTGATGGACTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGAATATCAAAAGGACCTTCATTTTATTGttttttctttttgcaggaggctttttttttttttngttttt
  3   1   2       chi Ga18      in                      xlk164k02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGNATGCAACNCNNAGCANAATAAANCAGNCTCCANNNNCCCTCCAANNCCCNGGNCTNATGAGTTNNNAGNNGNAGATGGNTGNNCNNNNANNGAGGTGTTGTNCCTGATGAATATNNTGGTGCCGGAAGAACTGATAGATGATGATGAATATNNAGAGATAGTGGAGGATGTTAGGGATGAGTGTNGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTnTTTnTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTNCTTTTTATTCTTAGTGTATGGATT
  3  -1   2       chi Bla2                            IMAGE:7295763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAACACTGAGCACAATAAATCAGACTCCAGTGACCCTCCAAGTCCCTGGACTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGNCAATACGGCGCTNNGTGAATCATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGGCAGATCTTTGTAGAATTTACATCCGTTCTTGATTGCCAGAAAGGCCTGCCAGGACTCCCTGGACGCAATTTGCTAAAGAAGGGTGGGTACAAAAACTGGGACCCGGATGGTTACACCGCCCGGATTTCGGGAAAAATAAATGAATTGCCGGGCGGGAAAAGATGAACTTAAATTTCAAAGCGGGGGGGAAAACAAAAGGGCCCTCCCTTTAAAAAATTTTCCCTTCCTTTCGGAAGGGTTTTTTTTTTTTCCTTTTTCGAGAGCCTCATTTTTGGGGCAAATGTTTTTTTCCCCCCCGAAAAATAGTAACCCCCCCCATATCCTTTTAAAAAAAAAATT
  3   1   2       bld Ga18 5g3  in                      xlk163m13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGNACAATAATCNNNTCNANNGACCCNCCAANNCNNGGACTTATGAGTNTNANGTGCANATGGGNGGTCATCCAAAAGAGGTGTTNTNCCTGATGAATATGGTGGTGCCGGANGNACTGATAGATGATGATGNAATATGNAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCANTTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTnTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATNGATNNTTC
  3   1   2       bld Ga18      in                      xlk124g20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACTCCAGTGACCCTCCAAGTCCCTGNNCNTATGAGTTCTCAGNTGNAGATGGGTGGTCATCCAACAGAGGTGTTGTNCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTNGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGNTNNNTCAA
  3   1   2       bld Ga12 5g3  in                         XL184o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACCCTTCAAGTNCCCTGGTCTTATGAGTTCCCAGGTGCAGATGGGTGGTCATCCAACTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAGAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATAGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTNTGGTAGAATGGAAGTGACATGATGGGCTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGAATATCAAAAGGACCTTCATTTTATTCTTTTTTCTTNCTGCAGGAGGCTTTTTTTTTCTTTTTTTNGACTTGTTTATATTNTCATGGCCAAATGTTACTTTATCCCTCTCTGAAACATCATGNCCACCTCACTAATACTNTTTAAGGAANTCAAAT
  3   1   2       bld DMZ  5g3  in                         xl226f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTCCAAGTCCCTGGACTTATGAGTTCTCANGNGCAGATGGGTGGTCATCCNACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTNTGNNGTAT
  3   1   2       bld Ga18      in                      xlk129c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTNNGAGTTCTNAGGTNNAGATGGGNNGNCATCNNANAGAGNTNTTGTGCCTGATGAATATGGTGGTGCCGNNNGAACTGATAGATGATGATGAATATNNANNAGATAGTGGAGGATGTTANGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAANTGAAATTCCACGNCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTANAAAATACTGTGATCCTGATGGNTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTnTTTTTTTTGCAGGAGGnTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATNG
  3   1   2       bld DMZ  5g3  in                         xl310i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTATGAGTTNTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTNTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTNTGNNGTATT
  3   1   2       bld DMZ       in                         xl260d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTATGAGTTCTCAGGTGCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTNTGACCATCACCTCCCCACACACAATGTAAAATAAACCCGGCCCCTCCCCCGCCCCACCCCCTnATCCCCTnCCCCAGGACCTTGAAGCTATTTCAGTGGTGGTTATCCTGTAGTAAAAACTGTGGTCTTTTCTNCATNTNTNTCTGTGACCGTTTCACAT
  3   1   2       bld DMZ  5g3  in                         xl226j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GNGCAGATGGGTGGTCATCCAACAGAGGTGNTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACNTTT
  5   1   2       bld Emb1                            IMAGE:3401783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATTGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGTAATTCCACGCCCAGTGGATGGAACTGAAGAGCCAGGATGCGGCGCGATCTGTGTAGAATTTACATACGTATTTGATTGCCAGAATGCCATGCAAGGACTCACTGGACGCAAATGTGCTAACAGAGTGGTGGTTACAAAATACTGAGATCCTGATGGATACCACCGCTGTGATTTC
  5   1   2       bld Tbd2                            IMAGE:3200382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGATGGGTGGTCATCCAACAGAGGTGTTGTTCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCATCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggctctctttttttttCTTTATCTGATTGTCTATTGTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCC
  5   1   2       bld DMZ       in                         xl274b11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGGGTGGTCATCCAACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggcttttttttttttCCTTTTCCG
  3   1   2       bld Gas5      in                    IMAGE:3748405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACCAACTAAGGTGTTGTGCGTAATGATAATGGTACGCCAAAAAGTCCTGAAGAATGATGATGAGTATTAGGAGATAGTGAAGGATGTTAAAGACGAGTGTGGCAAACACGGCCTGTTCAAGTCACATGAAATTCACCGGCCAGTGGATGGAGTTTACGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCT
  3   1   2       bld DMZ  5g3  in                         xl287a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANAGAGGTGTTGTGCCTGANGAATATGGTGGTGCCGGAAGAANTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld DMZ  5g3  in                         xl328l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGAGGTGTTGTGCCTGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGATGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCNTGATGGTTACCACCGTCGTGATTTCNGGTAGAANTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATNTTATTATTTTTTCTTTCTTnTGCAGGAGGCTTTTTTnTCTTnTTCTTTTTGTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATGTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAANCCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATT
  5   1   2       bld Egg1                               PBX0110B09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAAGTGTTGTGCCTAATGAATATGGTGCTGCCAGAAGAACTGATAGATTATGATGAGTATGAGGAGATAGTGGAAGATGTTAAAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACGTGATGGACTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGAATATCAAAAGGACCTTCattttattgttttttctttttgcaggaggctttttttttttttt
  3   1   2       bld Ga18      in                       xlk80e08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNTNNCTGATGAATATGGTGGTNNCGGNNGAACTGATAGATGATGATGAATANNAAGAGATAGTGGANGATNTTAGGGATGAGTGTGGCAAATNCGGCGCTGTGAAATCAATTGAANTTCCCACGCCCAGTGGATGGAGTTGAAGTNCCNNGATNCGGCAAGATCTTNGTAGAATTTACATCCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGNTTNCCACCGTCGTGNTTTCTGGTAGAATTAAGTGACATNCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCNNTNNANNANNNNNTCTTTCTTTTGCAGGNNNTTTTTTTTTTTTTTTCTTTNNCNGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGNCCATCNCCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCnCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTNAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTANGGAT
  3   1   2       bld DMZ  5g3  in                         xl341c22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGATGAATATGGTGGTGCCGGAAGAANTGATAGATGATGANGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTNGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTT
  5   1   2       bld Lmb2                            IMAGE:8638315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTNCCCCATTCNNNGGGNCCCTCGATCGAATTCGTCCATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCAttttattattttttctttcttttgcaggaggcttttttttttttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGgcccctcccccgccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTTCTAGTGTATGGATTTTTTCAGCCATCTNCATTAAGAAATGTTTCATCTTNNaaaaaaaaaaaaaaaaaaaaaGGGCGCGCAAGGCTGATTCTCTAGACGCGCCGAGCTCTCGCCTATATGATCTATACTAGTCAGACTGATAGATCTGG
  3   1   2       bld DMZ  5g3  in                         xl320c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATGAATATGGTGGTGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTANTCTTAGTGT
  3   1   2       bld Ga12 5g3  in                         XL203m20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGAATATGGTGCTGCCAGAAGAACTGATAGATGATGATGAGTATGAGGAGATAGTGGAGGATGTTAGAGATGAGTGTGGCAAATACGGCGCTGTCAAGTCACTTGAAATTCCACGGCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACGTCGGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCACCGCCGTGATTTCTGGTAGAATGGAAGTGACATGATGGGCTGGAAGAGATGAGCGAGAGGATCCAGAGGCTGGGGGAATATCAAAAGGACCTTCATTTTATTCTTTTTTCTTTTTGCAGGAGGCTTTTTTTTTCTTTTTTTTGACTTGTTTATATTTTCATGGCCAAATGTTACTTTATCCCTNTATGAAACATCATGACCACCTCACTAATACTTTTTAAGGAATTCAAATTTGACACACAATGTAAAATAACCCTGGAACCTCCATTGCCCCTGCCCCCATGAACAATCTCAGCGGTGCTTATACTGTAGTAAAATGTCTTTTTCTTAATTTTCTTTCCGTGACCGTTTCATATTTGCAAAGGCAAAATTGCTCATTAAACA
  3   1   2       bld Ga18                             rxlk155g12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGCGTGGGGCCGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTNTAGAATTTACATCCGTCTTTGATTGCCAGAAANNCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAANACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTnTTTnTTTTGCAGGAGGCTTTTTTTTTTTTTTCTTTNNCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGAT
  3   1   2       bld Ga12 5g3  in                         XL166h07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTGCCGGAAGAANTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGNTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGNTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCANTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAAT
  3   1   2       bld DMZ  5g3  in                         xl322a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGAAGAACTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCNTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTNACT
  3   1   2       bld DMZ  5g3  in                         xl283e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATNTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGT
  3   1   2       bld DMZ  5g3  in                         xl324b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGATAGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTA
  3   1   2       bld Ga12 5g3  in                         XL161i03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATAGATGATGATGAATANGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATAAAGA
  3   1   2       bld Ga12 5g3  in                         XL204a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAGATGANGATGAATATGAAGAGATAGTGGAGGATGTTAGGGGATGAGTGTGGCAAATACGGCGCTGNGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATAAAGAAG
  3   1   2       bld Ga12 5g3  in                         XL214m18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGATGATGAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGGGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATAAAGAA
  3   1   2       bld DMZ  5g3  in                         xl316n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGATGATGAATATGAAGAGATAGTGGAGGANGTTAGGGATGAGTGTGGCAAATACGGNGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTNGTAGAATTTACATCNGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCNTGATGGTTACCACCGTCGTGATTTCNGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATNTTTTCTTTNTTNNGCAGGAGGCTTTTTTTCTTTTTCNTNTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTNTTAAGGAATTAAATTTGAGATNTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACNTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld DMZ  5g3  in                         xl292h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATGATGAAATATGAAGAGATAGTGGAGGATGTTAGGGATGAGTGNGGCAAATACGGCGCTGTGAAATCAATTGAAANTCCACGNCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTNGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGNTAACAGAGTGGTGGTTACAAAATANTGTGATCCTGATGGTTACCACCGTCGTGATTTNTGGTAGAATTAAGNGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTnTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTGTTCGnGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Ga12 5g3  in                         XL210p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGAGATAGGGGAGGATGTTAGGGATGAGTGTGGCAAATACGGGCGCGGGGAAATCAAATGGAAATTCCACGCCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTNTGTGGATTGCCAGAAAGCCATGCAAGGACTCANTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCNTGATGGTTACCACCGTCGTGATTTNTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATAAAGA
  5   1   2       chi Sp1                             IMAGE:5435317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGATGTTAGGGATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCAttttattattttttctttcttttgcaggaggctttttttttttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCAcctccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCCACAGTGTTTTTATGTTTCTAACTCCT
  3   1   2       bld Tbd7      in                         XL074f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGAGTGTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGTAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTGCTTAGTGNAGGATTTTTTCAAGCCATCTGCAACTAAAGAA
  5   1   2       bld Ga18      in                      xlk153o17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGAGTGTGGNAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggntttttttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGgcccctcccccgccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGNNNTTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGNGTATGGATTTTTTCAAGCCATCTCAATTAAAGAANGTTTTCATCTTTCCCGGGGNNNTTTTTACCTGCTTTGAC
  3   1   2       bld Tbd7 5g3  in                         XL071k08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGGCAAATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTAGGATTTTTTTCAAGCCATACTCAATTAAAGNA
  3   1   2       bld Ga12                                 XL148p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGTTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGAAT
  3   1   2       bld Neu7      in                         XL013g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAANAATGTTGTCTTTTCTTCATTTCNTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGNTGTATTTTACTTTTTATTACTTAGTGTATGGATTTTTTCAAGGCCATACTCAANNAAAGAA
  3   1   2       bld Neu7 5g3  in                         XL004c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACGGCGCTGTGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTANGATTTTTTCAAGCCATCTCAATTAAAGAAT
  3   1   2       bld Neu7                                 XL007l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATCAATTGAAATTCCACGCCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTATTNCTTAGTGTA
  5   1   2       bld DMZ       in                         xl299n19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCAttttattattttttctttcttttgcaggaggctttttttttttttCCTTTTNCGGATGGCCNATTTTNAGGGCCAAAG
  3   1   2       bld Tbd7 5g3  in                         XL080m08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       bld Ga12 5g3  in                         XL184l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTCAAGCCATCTCAATAAAGAAG
  3   1   2       bld Neu7      in                         XL006g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAATCAATTGAAATTCCACGCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACNTTTTGTTGTATTTTACTTTTTATTGCTTAGTGTATGGATTTTTTCAAGCCAT
  3   1   2       bld DMZ  5g3  in                         xl327a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCAGTGGATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTTTGNAGAATTTACATCNGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACNGTGATCCTGATGGTTACCACCGTCGTGATNTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCNGGGGGAATAGCAGAAGGACCTTCATTTTANTATTTTTTnTTTnTTnnGCAGGAGGCTTTTTTTCTTnTTCnTTTTnTGATTGTCTATTTTTATGGCCAAANGTTACTTTACCCTCCCTGAAACATCATGACCACCTCANTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCNNNGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTG
  3   1   2       bld DMZ  5g3  in                         xl308p07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGGAGTTGAAGTGCCAGGATGCGGCAAGATCTNNGTAGAATATACATCCGTCTGNGATTGCCAGAAAGCCATGCAAGGACTCACTGGANGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCNGATGGTTACCACCGTCGTGATTTTCTGGTAGANTTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGNTGGGGGAATAGCAGAAGGACCTTCANNGTATTATTNTTTTCNNTCTTGTGCAGGAGGCTNTNNTTNTTTTTCTTGTTNAAGATTGTCTATTNTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAANTAAANTNGAGATCTATTCTNNGACCATCACCTCCCCACACNCAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTA
  3   1   2       bld Neu7 5g3  in                         XL044i03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTGAAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATG
  5   1   2       bld DMZ                                  xl224o07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGTGCCAGGATGCGNCNAGATCTTTGTANAATTTACGTCNGTCTTTGATTGTCAGAAAGCCATGCAAGGACTCACTGGGCGCANATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCCGATGGTTACCNCCNCCGTGATT
  3   1   2       bld Tbd7 5g3  in                         XL090k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTGCCAGGATGCGGCAAGATCTTTGTAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTNCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTATTNCTAGTGTCAGGATTTTTNCAAGCC
  3   1   2       bld Ga18      ?                       xlk112m23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNCCAGGATGCNGCNAAGATCTTTGTAGAATTTACATNCGTCTTTGATTGCCAGAAANCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGNGGNNNCNAAATACTGTGATCCTGATGGTTNCNNCCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTNAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTNCCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTNCTTTTTATTCTTAGTGTATGG
  3   1   2       bld DMZ  5g3  in                         xl271c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTGCCAGGATGCGGCAAGATCTTTGTAGAATNTACATCCGTNTTTGATTGCCAGAAAGNCATGCAAGGANTCANTGGACGCAAATTTGNTAACAGAGTGGTGGTTACAAAATACTGTGATCNTGATGGTTACCACNGTCGNGATTTNTGGTAGAAGTAAGTGACATGCCGGGCTGGAAAGAGATGAGNTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACNTTCATTTTANTATTTTTTCTTTCTNNNGCAGGAGGCTTTNTTNTNTTTNTNNGATNGTNTATNNNNATGGCCAAANGTTNCTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTNNGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Tbd7                                 XL057n01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGA
  3   1   2       bld Neu7      in                         XL026o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGAATTTACATCCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCNTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATNAAACATTTTGT
  5   1   2       bld Ga15      in                       XL438j22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGTCTTTGATTGCCAGAAAGCCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggctttttttttttttNCTTTTNC
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3580830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATTGCCAAAAAACCAAGCAAGGGNCTCCNTGGACGCNNAATTTCTANACAGAGTGGTGGTTACNAAAAACTGTGATCCTGAATGGTTACCACCGTCGTATTTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAAAGATAAGTTAAGATTCAGAGGCTGGGGGAATAGCAGAGGGACCTTCATTTTAAAATTTTTTCTTTCTTTGGCAGGAGGCTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGACAAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTCAAGCCTTTCAATAAAGAATGTTTCTTTTTAAA
  3   1   2       bld Neu7      in                         XL038b23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATGCAAGGACTCACTGGACGCAAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAG
  3   1   2       bld Neu7 5g3  in                         XL014c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACTCACTGNACGCAAATTTGCTAACAGAGTGGTGGTTACAAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTATTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACNTGGCCCCTCCCCCGCCCCnCCCCCTTATCCCCTCCCCCAGGACCTTNAACTATTTCAGNGGTGGTTATACTGTAGTNAGAAATGTTGTCTTTTCTTCATTTCTTTCTGTCACCGTTTCACATCNGCGAAGACATTGCTCATGCGNACATTNTGTTGCATTTTACTNTTT
  5   1   2       bld Emb3                            IMAGE:3400687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACGCGTGGGATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggcttttttttttttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTAGAGATCTAT
  3   1   2       chi DMZ       out                        xl266d19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNTAAATGAAACATGAAATAAGGTCTAGAAATGCCTGGAGCGGATCATTATCTCCCTCATCACATGGGCTGGTTGACAGATCTGCATCCTGGTTCTGTAGGGTCACTATTTGCAGAGAAGAAATAAGTAAAAACAAATCAGAGGACACAGACAAGTATGAAGCTCTGTGTAAATAGCTGCTCCTTATCTCAAAGCCTAACAAAGGATTCAGCTTTGTATTTGTTCTCCCTTATCTCCCATTAAACAGATTACAGAGTGAGAGAGGGGCCACAAGAGAAAAACAACTTCATAAAGGCAAAAACCCTTGGAAAAATCCACGACCCCAATACCCCCAGCATTGGATACGCGTGGGGGTGGGGTGAATGAGACTAGGCCCTGCACTCGACCAACATCCCCGGCCCTGGGTGGAGAGTGCAGGGAAACAAGCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAAT
  5   1   2       bld Ga18      in                       xlk68i17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCTGATGGTTACCACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCGGGCTGGAAAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCattttattattttttctttcttttgcaggaggntttttttctttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGgcccctcccccgccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGANATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTT
  3   1   2       bld Ga18      in                       xlk68i17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANNTTTGCTAACAGAGTGGTGGTTACAAAATACTGTGATCCNGATGGTTACNACCGTCGTGATTTCTGGTAGAATTAAGTGACATGCCNGGCTGGANAGAGATGAGCTAAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTnTTnTTTTTTTTTTnTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGANNNNNNACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTNCTTTTTANTCTTAGTGTATGGAT
  3   1   2       bld Tbd7 5g3  in                         XL105a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGTTACCNCCGTNGTGATTTTTGGTAAAATTAANTGANANGCCGGGNTGGAAAAAAATTANNTAAAATTNAAAGGNTGGGGGAANANCAAAAGGACCTTCATTTTANTATTTTTTnTTTnTTTTGCAnnAGGCTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld Tbd7 5g3  in                         XL087l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTTACCNCCGTNGTGATTTTTGGTAAAATTAANTNANANGCCGGGNTGGAAAAAAATTAGNTAAAATTNAAAGGNTGGGGGAANANCAAAAGGACCTTCATTTTANTANTTTTTnTTTTTTTTGCAGGAGGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld Tbd7 5g3  in                         XL060g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTTTTGGNAAAATTAANTNANANGCCGGGNTGGAAAAAAATTANNTAAAATTNAAAGGNTGGGGGAAAAANAAAAGGACCTTCANTTTANTANTTTTTnTTTTTTTTGCAnnAGGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGCACATTGCTCATGAAACATTGTTGTTGTATTTTACTTTTTATTCCTTAGTGTAGGGATTTTTTCAAGCCATNCTCAATTAAAG
  3   1   2       bld DMZ                                 rxl339c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAATTAAGTGACATGCCCGGGCTGGAAAGAGANGAGNTAAGATTCAGAGGNTGGGGGAATAGCAGAAGGACCTTCATNTTATTATTTTTTCTTTCTTTnGGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATnGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTNTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGNGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGAGTATAAACNTAGAATGTGNG
  3   1   2       bld DMZ       in                         xl274b11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGGGGTGGAAAGNGATGAGGTAAGNTTCAGNGGNTGGGGGAANAGCAGAAGGNCCNTCANTTTANTANTTTTTCTTTCTTTTGCNGGNGGGTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Neu7 5g3  in                         XL024i10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGNTGGAAAAAAATTAGNTAAAATTNAAAGGNTGGGGGAAAAANAAAAGGACCTTCANTTTAANATTTTTTnTTTTTTTTGnAnGAGGnTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld Neu7 5g3  in                         XL048m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGNTNGAAAAAAATTAGNTAAAATTNAAAGGNTNGGGGAAAAANAAAANGACCTTCATTTTANTANTTTTTnTTTTTTTTGCAnGAGGnTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld Neu7 5g3  in                         XL043d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNTGGAAAAAAATTAnCTAAAATTnAAAGGnTGGGGGAAAAAnAAAAGGACCTTCATTTTAnTATTTTTTnTTTnTTTTGCAnGAGGnTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAATGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld Tbd7 5g3  in                         XL082f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGNTGGAAAAAAATTAGNTAAAATTNAAAGGNTGGGGGAAAAANAAAAGGACCTTCANTTTANTANTTTTTnTTTTTTTTGCAGGAGGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTANTCTTCATTTCTCTCTGTNACCGTT
  3   1   2       bld Tbd7 5g3  in                         XL065k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNTGGAAAAAAATTAGTTAAAATTnAAAGGnTGGGGGAAAAnnAAAAGGnCCTTCATTTTANTANTTTTTNTTTNTTTTGCAGGAGGNTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       bld DMZ  5g3  in                         xl254a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAAGNGNTGAGGTAAGATTCAGNGGGNGGGGGNANAGCNGAAGGNCCNTCNNTTTANTANTTTTTNTTTCTTTTGCNGGGGGGTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTNTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Ga12 5g3  in                         XL147d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAAAAATTAnnTAAAATTnAAAGGGTGGGGGAAAAAnAAAAGGACCTTCATTTTATTATTTTTTTTTTTTTTTGCAnnAGGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATNAAACATTTTGTTGATTTTACTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGAA
  3   1   2       bld DMZ  5g3  in                         xl291l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAGAGATGAGNTAAGATTCAGAGGCGGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTGTTTnGCAGGAGGCTTTTTTTnGTTTTCNNNTTCNGATAGTGTATTNTTATGGCCAAAGGNTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCNTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Tbd7 5g3  in                         XL062j16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATTCAGAGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAANCATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTTATTCTTTGNCCATCNCCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTANNCTGTAGTAANAANGNTGTCTTTTCTTCATTGCGTNCTGTGACCGTTNCACATTTGCGAAGACATCGCTCATGAAACCATTTTGNTGTATT
  3   1   2       bld Ga12 5g3  in                         XL216k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GNGGGTGGGGGNANANCANAAGGGCCCTCAATTTANTANTTTTTnTTTTTTTTGnAGGnGGGTTTTTTTTTTTTTTCTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATAAAGAA
  3   1   2       bld DMZ       in                         xl299n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNGGGTGGGGGNANAGCNGAAGGNCCNTCNNTTTANTANTTTTTCTTTNTTTTGCNGGGGGGTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGGTTGTATTTTACTTTTTATTCCTTAG
  3   1   2       bld Tbd7 5g3  in                         XL108l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGNTGGGGGAANANCAAAAGGACCTTCANTTTANTANTTTTTCTTTNTTTTGCAGNANGCTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTATTCTTAGTGTAGGATTTTTTCAAGCCATACTCAATTAAAGNA
  3   1   2       bld DMZ  5g3  in                         xl300l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGNTGGGGGAANAGCAGAAGGACCCTCANTTTANTANTTTTTCTTTNTTTGGCNGGNGGGTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Tbd7      in                         XL051d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNGGGGAAAAACAAAAGGACCTTCANTTTANTANTTTTTNTTTNTTTTGCAGGAGGNTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTNTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld Tbd7                                 XL094j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGGGAANAGCAAAAGGACCTTCATTTTANTATTTTTTnTTTnTTTTGCAnnAGGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTAGGATTTTTTCAAGCCATACTCAATTAAAGNA
  3   1   2       bld Ga12      in                         XL149d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTNGGGGAAAAACAAAANGNCCTTCNTTTTANTATTTTTTTTTTTTTTTGCAnnAnGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTAGGATTTTTTCAAGCC
  3   1   2       bld Tbd7 5g3  in                         XL092b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGGAAAAANAAAANGACCTTCANTTTAANANTTTTTNTTTNTTTTGCAGGAGGNTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTAGGATTTTTACAAGCCATACTCAGATTAAAGNA
  3   1   2       bld Tbd7 5g3  in                         XL101e06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGGAANANCAAAAGGACCTTCATTTTANTANTTTTTCTTTNTTTTGCAGGAGGCTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATNCTCAATTAAAGNA
  3   1   2       bld DMZ  5g3  in                         xl304c15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGGGNAAANCAGAAGGNCCCTCNNTTTANTAATTTTTnTTTTTTTTGCnGGGGGGTTTTTTTTTTTTTTCTTTTTNNGATTGNNTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTANTCTTAGTGTATGG
  3   1   2       bld Neu7 5g3  in                         XL033o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGGGAAAANCAAAAGGACCTTCANTTTANTANTTTTTNTTTNTTTTGCAGGAGGNTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGAAT
  3   1   2       bld Tbd7                                 XL053o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNGGGGAANAANAAAAGGACCTTCANTTTAATANTTTTTTTTCTTTTGnAGGAGGCTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTAGGATTTTTTCAAGCC
  3   1   2       bld Tbd7 5g3  in                         XL096h18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGGGAAAAACAAAAGGACCTTCATTTTANTANTTTTTNTTTNTTTTGCANNANGNTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCNTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATGCTCAATTAAAGGAATGTTT
  3   1   2       bld Tbd7 5g3  in                         XL109k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNGGGGAAAAACAAAAGGACCTTCATTTTANTANTTTTTCTTTNTTTTGCANGAGGCTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTAGGATTTTTTCAAGGCCATACTCAATTAAAG
  3   1   2       bld Neu7      in                         XL038m15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGCTGGGGGAATAGCAGAAGGACCTTCATTTTATTATTTTTTCTTTCTTTTGCAGGAGGCTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCTCTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGNCCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTT
  3   1   2       bld Tbd7                                 XL110e14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AANAAAAGGACCTTCATTTTAATANTTTTTnTTTTTTTTGCAnnAGGnTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTAGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTACTTAGTGTATGGATTTTTTCAAGCCATACTCAATTAAAGNA
  3   1   2       bld Ga18      in                      xlk128g21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CNNCCNCGCNNNNNTTTTTTTTTTTTTTTTTTTTTTTGCNGGNNGNNNNNTTNCTTTTTCTTTTTCTGNNNGTCTATTTTNATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGA
  3   1   2       bld Neu7 5g3  in                         XL047p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACCTTCANTTTANTANTTTTTnTTTTTTTTGCAnGAGGCTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       bld Ga18 5g3  in                       xlk73d08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCNNCNTTTTTTTATTTTTTTTTTnTTTnnCnGGAGGCTTTTTTTCTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTNCTTTACCCTCCCTGAAACATCATGACCNCCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCNCCNCNCNACACACAATGTAAAATAANCCTGGCCCCTCCCCCGCCCCACCCCCTTnnCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTNANTCTTAGTGTATGGATTNT
  3   1   2       bld DMZ  5g3  in                         xl340e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCNNTTTATTANTTTTTNTTTNTTTTGCNGGGGGGTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  5   1   2       bld Ga18      in                      xlk161d03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCattttattattttttctttcttttgcagnnnnnnttttttttttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGgcccctcccccgccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGANATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTNNaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl273j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCNATTTANTANTTTTTnTTTTTTTnGCnGGGGGGTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTT
  3   1   2       bld Tbd7      in                         XL052o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTAATANTTTTTTTTTTTTTTGnAnGAnGnTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCCCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTNTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       bld Tbd7      in                         XL074m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAATTTTTTTTTTTTTTnnAAnAnGGTTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCCTTAGTGTAGGAATTTTTTCAAGCCA
  5   1   2       bld Ga18      in                      xlk128g21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ttttattattttttctttcttttgcagnnnntttttttctttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGgcccctcccccgccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTNANAAANAAAA
  3   1   2       bld Ga15      in                       XL438j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANTANTNTTTTTTTTNNTNGNNGGNGGGTTTTTNTTNNTTTTCTTNTTGTGANTGTGTATTNTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCANTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAG
  3   1   2       bld DMZ  5g3  in                         xl306n01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TANTTTTTnTTTTTTTTGCnGGGGGGTTTTTTTTTTTTTTTTCNTTNTCNGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Tbd7 5g3  in                         XL098g22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNNTTTTTTTTTTTTTTGnAnGAGGnTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCNTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCnCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTGCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       bld Neu7 5g3  in                         XL012a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTTTCTTTCTTTTGCAGGAGGnTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCnTCCCCCGCCCCACCCCCTTATCCCnTCCCCCAGGACNTTGAACTATTTCAGTGGTGGTTATANTGTAGTAAAAATGTTGTCTTTTCTTCATTTATTTNTGTGACCGTTTCACATTTGCGAAGACATTGNTCATGAAACATTTTGTTGTATTTTANTTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGA
  3   1   2       bld DMZ  5g3  in                         xl333m15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTTTTNTNTTNNTGGNGGGNGGGNNTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTNG
  3   1   2       chi Em10      in                    IMAGE:7981241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCTTTTNTNTTNNTTTTTTTTTTTTTTTTTTTTTTTTTAAAGATGGAAACATTTTATAACCGAATGTGCCTTTACCCATCCTGACACTTCGAGTCCACCGCAAAATTCCTCATAATGTATCATATGCAAGATCTTTTCAAAACCGATACGCTCCCCGCACGAAATGAAGAAAAGACCAAGACCTTTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAGATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTCAAGCCTCTCATAAAGAATC
  3   1   2       bld Neu7      in                         XL026m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGNTTTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       bld Neu7 5g3  in                         XL034b13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTTTTTTTTTTTNTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAAGNA
  3   1   2       chi Ga18 5g3  in                      xlk125o15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTTTTTTTTTTTNTGNNNGNCNNTNNAGGCCAAATGTNNCTTNNNNNNCCCTGAAACATCATGNNCNCCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCNCCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCnCCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTANNNNNGCCAGAGATANCTCGNCCTGTCTTCAATTNTCTNGTATATG
  3   1   2       bld DMZ  5g3  in                         xl337c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCANTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTNGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Neu7                                 XL011a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTCTTTTTCTGATTGTCTATTTTTANGGNCAAATGTTACTTTACCCTCCCTGAANCATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCCTCAATTA
  5   1   2       bld Ga15      in                       XL457l14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CtttttttctttttctttttCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGgcccctcccccgccccacccccttatcccctcccccAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl313c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTNTTNTTTTTNTTCNTTTTCTGATNGTCTATTNTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCANGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTATGAAGTGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCATCAANTG
  3   1   2       bld Ga18 5g3  in                        xlk6c03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTTTTTTTTNNNNNNCNNANNNNCTATTTTTATGGCCANNNGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATNG
  3   1   2       bld Neu7 5g3  in                         XL014e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTCTTTTTCTGATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTNCTTAGTGTAGGATTTTTTCAAGCCATCTCAATTAAA
  3   1   2       bld Ga18      in                      xlk153o17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTTTCTTNTNCNGATNGNCNANTNNNANGNCCAANTGNNACnnnnnnnnCCTGAAACATCATGNCCNCCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCNCCTCCCCACACACAATGTAAAATAAACCTGNCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTANNNNAGCCAGAGATANCTCGNCCTGTCTTCAATTNTCTTGTATATGTNNNNNCCAAA
  3   1   2       bld DMZ       out                        xl225n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCTGANTGNNTATNTTTATGGCCAAATGTTACTNTACCCTCCCTGAAACATCATGACCACCTCANTAATCCTTNTAAGGAATTAAATTTGAGATNTANTNTTTGACCATCACCTCNCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAATTGTCT
  3   1   2       bld Ga18      in                      xlk122m03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCNGANNGNCNATTTTNANGGCCAAATGTTACTNNACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCnAnnnCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGANNNNNNACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGA
  3   1   2       bld DMZ  5g3  in                         xl291f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATNGTGTANNNTTATGGCCAAATGTTACTTTACCNTCCCNGAAACATCATGACCACCNCATTCATCCTTTTAAGGAATTAAANANGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAATT
  3   1   2       bld Neu7 5g3  in                         XL047o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGTCTATTTTTATGGCCAAATGTTACTTTACCCTCCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGT
  3   1   2       bld DMZ  5g3  in                         xl250p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTATNTTGATGGCCAAATGNTACTTTNCCCTCCCTGAAACATCATGACCACCTCANTAATCCNTTTAAGGAATTAAATTTGAGATGTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTT
  3   1   2       bld Ga18      in                       xlk62c15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTATTNTTATGNCCAANTGNNNNTTNNNCCTCCCTGAANNATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTAAGATATATTCTTTGACCNTCNCCNCCCCACACACAATGTAAAATAACCCTGNCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGA
  3   1   2       bld DMZ  5g3  in                         xl294h15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAAATGTTACNNTACCCTNCCTGAAACATCATGNCCACCTCACTAATCCTTTTAAGGAATTAAATNTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAATTGTCTTGTATA
  3   1   2       bld Ga18 5g3  in                      xlk127a10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCNNCCTGAAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTANNG
  3   1   2       bld Ga18      in                      xlk164p24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNTCCCNGAANCATCANGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTNTANCNTAGTGTA
  3   1   2       bld Ga18      in                      xlk161d03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCNGAAANATAAGGNNCNCCTCACTAATCNTTTNAAGGAATTAAATTTGAGATCTATTCTTNGNCCATCACCTCCCCACACACAATGTAAAATAAACCTGGNCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTANTCTTAGTGTATGGA
  3   1   2       bld DMZ  5g3  in                         xl333a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CNTGAAACATCANGNCCACCTCAGTNATCCTTNNAAGGAATTAAATNTGAGATCTATTCTTNGGCCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTT
  3   1   2       bld DMZ                                 rxl236h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAACATCANNACCACCTCANTAATCCTNNTAAGGAATTAAATNTGAGATNTATTCTTNGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCGTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGATTTTTTCAAGCCATCTCAATTAAAGAATGTTTTCATCTTTCCCGGGGGTCTTTTTACCTGCTTTGACAAATATTACATTGAGACGAGATGTTTCCACAAGTGTTTTTATGTTTCTAACTCCTAGAGAGTGACAAAGTGGTAGCGTATGATGTGTAGTGTGTCCCAAACCTACTCATCCAGTCTTGCCGATTATAAACCTAGAATGTGTGATTTTCTAAAGCAAGCCAGAGATAGCTCGGCCTGTCTTCAATTGTCTGTA
  3   1   2       bld Tbd7 5g3  in                         XL062n14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACATCATGACCACCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCCTTnTCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATNCTGTAGTAANAANGTTGTCTTTTCTTCATTTCGTNCTGTGACCGTTTCGACATTTGCAAAGAACATCGCNCATGAA
  3   1   2       bld Ga18 5g3  in                        xlk6p05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATCATGACCCCCTCACTAATCCTTTTAAGGAATTAAATTTGAGATATATTCTTTGACCATCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTANG
  3   1   2       bld Ga18 5g3  in                       xlk54h02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCATGNCCNCCTCACTAATCCTTTTAAGGAATTAAATTTGAGATCTATTCTTNGACCNTCACCTCCCCACACACAATGTAAAATAAACCTGGCCCCTCCCCCGCCCCACCCCCTTATCCCCTCCCCCAGGACCTTGAACTATTTCAGTGGTGGTTATACTGTAGTAAAAATGTTGTCTTTTCTTCATTTCTTTCTGTGACCNTTTCACATTTGCGAAGACATTGCTCATGAAACATTTTGTTGTATTTTACTTTTTATTCTTAGTGTATGGANNT
  3   1   2       bld Ga18      in                      xlk130i13ex.3p