Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL516i05ex.5                        157 END     2           0        1                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012767287 Xl3.1-IMAGE:7299635.5 - 560 ESTs
                                                                       .........-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7299635.5                                                  CACGCTGCTACGGGCGTGGTCACCACCTGCGGACCTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAAAATAAAAGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAGGCTAAGTGAAGACCAACAGCCATTGGCTAGAGGACGGGCACCTAGGGTGATAATCCTTACTCCTACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCTGGACGCACAGGCGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGCTCTTTGCTCAACATGGAAGCGGGCTACATGACTATAACATTGAAGAGCTCAGTACCCATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGATGATGTTGATTCCAAAATCCATAGAATGTGTCTACTCAAGGACTCCATGGGGGTGTGTTTTGATGTTCGTTCAGAAAACCTGGAATCAATGCAGGAGCGCTGGACAGATACAAAACAGTGGCAGTTTACAGTTGCAACTGAACTACCCGCAATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGAACAGAAGTTTTGGCGGAAGAGGGAGGAGACCTTTTGACAGAAGAAATAATTCCAGAAATTCAAACCGAGGAGGAGGAGGACGACGAGGCAGAAGTGGAGGATTTAGAAGGGGCCGTTAGTGACTCCAAACATCCCAACTTTTTTAATACACCGCCATGTTCATATATATTCCTTCTTAAAGTAACTTAAGACATATTATATGCAATGTAAAACTGTGTACTTAGCCCCTATTAAAATCTATCTGTTAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012684981                                                        GCTACGxGxGxxGTxxxCACCTGCxxxCxTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAxxxGxTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAAAATAAAAGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAGTGAAGACCAACAGCCATTGGCTAGAGGACGGGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGCTCTTTGCTCAACATGGAAGCGGGxTxCxTGACTATAACATTGAAGAGCTCAGTACCCATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGATGATGTTGATTCCAAAATCCATAGAATGTGTCTACTCAAGGACTCCATGGGGGTGTGTTTTGATGTTCGTTCAGAAAACCTGGAATCAATGCAGGAGCGCTGGACAGATACAAAACAGTGGCAGTTTACAGTTGCAACTGAACTACCCGCAATTCAAGAATCTGAGAGAAACTTTGATGGTCCAAGGAACAGAAGTTTTGGAGGAAGAGGGAGGAGACCTTTTGACAGAAGAAATAATTCCAGAAATTCAAACCGAGGAGGCGGAGGAxGAxGxxGCAGAAGTGGAGGATTTAGAAGGGGCCGTTAGTGACTCCAAACATCCCAACTTTTTTAATACACCGCCATGTTCATATATATTCCTTCTTAAAGTAACTTAAGACATATTATATGCAATGTAAAACTGTGTACTTAGCCCCTATTAAAATCTATCTGTTAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                       4    14    12    35    20    50    25    55    26    59    31    64    31    68    33    70    34    73    34    77    34    86    35   111    35   141    58   151    71   156    77   158    79   159    82   159    83   160    83   161    83   164    83   163    84   163    85   163    91   165    91   165    92   165    91   167    91   167    92   166    93   164    95   165    94   166    95   168    96   169    97   171    95   170    94   171    96   170    95   167    94   165    90   159    89   156    91   156    91   160    90   159    89   160    91   160    79   160    87   158    84   159    84   161   138   160   138   160   138   163   140   167   132   164   124   160   125   157   117   156   120   156   117   156   114   152    99   150   105   147    96   145   105   146    81   146    88   146    88   142    86   137    79   136    80   130    77   127    78   121    73   117    67   114    71   109    69   102    70    97    68    96    69    92    72    90    68    83    69    85    64    87    66    86    69    86    69    88    65    86    71    87    72    85    71    85    68    82    71    84    67    84    68    83    66    81    68    82    58    83    69    82    72    84    71    85    71    86    72    88    74    89    69    87    68    89    70    89    71    91    70    93    67    92    66    91    69    94    39    94    73    93    71    93    75    94    68    93    74    90    74    89    74    88    73    89    73    91    71    91    72    92    72    91    75    91    76    88    76    90    75    94    76    96    72    95    75    97    76   100    78   102    75   103    79   108    62   113    86   119    83   124    79   124    81   129    79   132    81   135    72   138    88   141    79   147    85   151    92   154    95   160   103   163   115   164   120   165   118   166   119   167   108   168   135   169   144   175   147   176   151   179   155   181   159   184   160   184   165   188   153   190   166   196   155   195   171   199   178   206   178   213   187   214   189   216   161   217   121   223   200   225   201   227   201   229   194   230   211   229   212   226   204   230   216   228   207   225   211   226   214   227   197   227   206   225   208   224   205   223   110   224   208   225   201   225   202   224   193   223   198   219   197   219   198   218   197   217   195   218   197   219    99   219   198   217    96   213    97   212    97   210    96   209    96   206    97   203    96   198    91   190    86   170    75   160    54   131    38    81    35    55    20    33     5    15
                                                                   VAR                                                              TGTGGCGTGGTC
                                                                   VAR                                                                          TGCGGACCTCGT
                                                                   VAR                                                                                      CGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGT
                                                                   VAR                                                                                                                                                                                                              AAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAAT
                                                                   VAR                                                                                                                                                                                                                                                                          AATCCGTAAACG
                                                                   VAR                                                                                                                                                                                                                                                                                      AGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAACACAACAGGAGATGAACCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGATGTGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTTAGTTGGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGGTGGCAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCATCGGGCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGCAGGAATAGAAATGGGGGGTTTAGAAGGGGCCGTTAGTGACTCCGAACATGCCAATTCAGATTAACTTTTTCAATACTTCCTAAAGTAACTGAAGACATATTTTTATGCAATATACAAATTAAAAGCT
                                                                   SNP                                                                                                                                                                                                              C-----------
                                                                   SNP                                                                                                                                                                                                                          ------A-----
                                                                   SNP                                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                  --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T-A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --G-------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------A-C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A-----A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G--A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------TG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A--C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----GT-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------CG---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---C---A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------AC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------AC---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T---G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------A---C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C-----T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C---------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A--A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T---G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                               BLH ATG      76     329                                                  
                                               BLH MIN      76     305                                                  
                                               BLH OVR     202     378                                                  
                                               ORF LNG     202     121                                                  
  5   1   2       bld Oo1  5g                         IMAGE:5078708.5p TCAATTCTGAGAACAGGAAGTGACGCACGATCGTTCCTTCCTTTCTCACGCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGCTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAAATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGCAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTANAAAATCCAAAAAGAACACACAGGAGATGAAACAGCTCCTAGGAANAGAAAAACAGATACTTCNGAGATCACTGCAGCCAATGAGTGTGAAGAAAAAGGAGTTAACCCAAAGAGGAAGAGGAAATCNGGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTTCAATCTCCAAGGGATACATTTAAGAAATTACCAGGCTAAAGGCCGGGACCTATCTGGTTCCCAATTCAATTCAAAAACATTC
  3   1   2       bld Ga18                              rxlk65i12ex.3p                          CCCCGTCCGNGGNCGCGTGGGTCACGCTGCTACGTGTGGCGTGGTCACTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCNTCTCAGGGGGGCCAATGTGATGGAGANNANNCAGNNC
  5   1   2       bld Gas3      in                      xlnga001o09.5p                                GATCGTTCCTTCCTTTCTCACGCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGGTAACAACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACT
  5   1   2       chi Int2      in                    IMAGE:8821587.5p                                CTGTCTCTGTGGGGTGGGCGGAACAACGAATTAGAATCGTCCGTCCCTGCGGGACCTCGTTTCTTCTTGGGTACGGGAGTTTCACGAGAATCATCGATGCCCGGGAAGTTTATACCGATGAAATGGAGGGTAAAGTATCAAGAAGAAGAACTGACTGAAACTCCTCTACCCAAGTTAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAGAACACAACAGAGATGACCAGCTCCTAAGAAAAGAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAGAAAGGAGTAACCAAAGAGAGAGGAAATCAGAAGAAAATAGATGGTGACTTCTCAAATTCCATCTCAGATACATAAGATTTACAGCTAAAGCGGACTATCTGTTCATCATCAAACATTCCCACTGTTAAGTGCAGATGTTTGTCAGCGTAAGCCAGAAACATCCGTGATCATATGGAAAGCTATGAAACACGCGTGCTAAGACGACCTAGGAAATCCTAC
  5   1   2       bld Int2 5x                         IMAGE:8528899.5p                                   AAAANNCCCATGACATTGGAGGGCATCAATAGAATTCGTCCCTGCGGATCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAGGAGAAGAAAAACAGATACATCAGAGATCACTGCAGCCATGAGTGTGAAGAAAGGAGTAATCAAAGAGGAGAGGAATCAAGAAAGAAAATAGATGTGACTTTCAAAATTCCATCTCAAGATACCATAGAATTACAGCAAAGCGGACTATCGTTCCATCATCAAACATCAACTGTACGGGCAAATGTTGTCAGCGTAAGCAAGAACTTCTTGTATATATGAGGAAG
  5   1   2       chi Bone      in                    IMAGE:8739603.5p                                    CCCGTGCCTGCTACTTGAGGAGCCGATCGCATTCGAATTCGTCCCCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGAGATGAACCAGCTCCTAGAAAGAAAAACCGATACATCAGAGGATCACTGCAGCATGAGTGTGAGAAAAGGAGTTTACAGAGAGAGAATTCAAGAAGAAAATGATGGTGACTCTCAATCATCTCCAAGGATACAATAGAATCAGCTAAGCCTGAACATCCGTCATCATCAACATCCACGTCATGCAAAAGTCGTGTCAGACGTCAGGCATA
  5   1   2       bld Li1  5g                         IMAGE:3397333.5p                                        CACGCGTCCGCCCACGCGTCCGGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCANGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACT
  5   1   2       chi Tad1 5g                         IMAGE:6939730.5p                                        GGGCCTTTCTCACGCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTGCCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGCCCCN
  5   1   2       chi Tad1                            IMAGE:6939684.5p                                        GGGCCTTTCTCACGCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGTACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaagattaagaagaaaaaactaaaagagggcaaggaaagaTTTCAGATTGCACAGGGAAGGAAACAGGACCATATCCTGaaaaccacaaaaatggaattgggcccttgaaaaaaggtggtttaaaaaaaaattcccttaaaaaaggaaacccccccaaccccggggaaggaaatggaaaaacccccgggccccTCCT
  5   1   2       bld Emb4 5g                         IMAGE:5515195.5p                                              CACGCTGCTACGTGCGTTAATGGGTCCCTGCGGATCTCGTTCTCTTGGGTACGGGAGCTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAGGAAAAGGAGTTACCAAAGAGGAAGAGGAAATCAAGAAAGAGAAATAGATGGTGACTTCTCAAAATTTCAATCTCCAGGA
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3549108.5p                                                  GCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagttaagaagaaaaaactaaaagagggcaaggaagattcagatgcacaggaagaaaCCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAA
  5   1   2       bld Sp1  5g                         IMAGE:5505753.5p                                                  ACCACGCGTCCGGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagttaagaagaaaaaactaaaagagggcaaggaagattcagatgcacaggaagaaaCCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAGGAGTTAACCAAGAGGAAGAGGAATCTAGAAGAAAAATGATGTGACTCTCAAATTCCATTCNAGGATACATAGATTTAAACTAAGCTGACTATTGTTCATCATCAACATCAC
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975823.5p                                                  GCGGATTCGGGGGATGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagttaagaagaaaaaactaaaagagggcaaggaagattcagatgcacaggaagaaaCCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACAACACAGGAGATGAACCAGCTCCTAAGAAAAAGAAAACGGATACATTCGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGA
  5   1   2       bld Ov1  5g                         IMAGE:8331639.5p                                                  CACGCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACNACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGAG
  5   1   2       chi Emb1 5x                         IMAGE:6632980.5p                                                   ACGCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTANAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGGAGATGGAACCAGCTTCCTAAGAAAAAGAAAAACNGATACCTTCNGGAGATCACTTGCAGCCCAATGGAGTGGTGAAGAAAAAGGGAGTTAAACCCAAAGGAGGAAGGGAGGAAAANTCCCAGaaaagaaaaaaaaaTAGGAATGGGTGGACCTTCCTTCAAAAAATTTTTCCCAAATTCTCCCCAAGGGGGATACCCCAATTTAAAGAAAA
  5   1   2       bld Emb3 5g                         IMAGE:3398895.5p                                                    TGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACcaaagaaagttaagaagaaaaaaactaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAGAGAAGATTA
  5   1   2       bld Ga18      in                       xlk70p15ex.5p                                                    CNGCTACGTGTGGCGTGGTCACCTGCGGATCTCGTTCTCTTGGGTACGGGNNNNCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGANTAAGAAGaaaaaaaaaa
  3   1   2       bld Ga18      in                       xlk70p15ex.3p                                                    CTGCTACGTGTGGCGTGGTCACTGCGGATCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCNTCTCAGGGGGNCCAATGTGATGGAGANNA
  5   1   2       bld Te2N      in                    IMAGE:7765604.5p                                                     GCTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTaaaaaatctaaaaagaaaaCAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAGGAGTTAACCAAA
  3   1   2       bld Ga18      in                      xlk115d20ex.3p                                                     TGCTACGTGTGGCGTGGTCNNTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCNTCTCAGGGGGGCCAATNTGATGGAGA
  5   1   2       bld Ga18      in                      xlk115d20ex.5p                                                     TGCTACGNGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGNNNNNCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGaaaaaaaaaa
  5   1   2       bld Brn1      in                    IMAGE:6956860.5p                                                      CTGCTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaagattaagaagaaaaaaactaaaagaGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCNTCCANGGATACCATTNAAGAATTTANCAGCTAAAAGGCGTGACCTATCTGTTTTCCAATTCAATCCAAAACATTTCCACAACTGTTTTACAGTGGGCAAAAGATGTTTGTGGGTCCAAGGCCCCGTA
  5   1   2       bld Emb4      in                    IMAGE:4201973.5p                                                        GTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGGAAAGTTTATANCCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGA
  5   1   2       bld Ga18      in                       xlk70e12ex.5p                                                        TGCTACGTGTGGCGTGGTCACCTGCGGATCTCGTTCTCTTGGGTACGGNNNNNCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACANATGAATGGCGTGAAGAGTGTTaaaaaaatctaaaaaGAACACAACAGGAGANGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGNGGAAGAGGAAATCAAGAAAGAAAAAATAGNNNNGACTTCTCAAA
  5   1   2       bld Ga15 5g3  in                       XL468p04ex.5p                                                         CTACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCNTCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCCAGGATACCATTAAGAATTTAC
  5   1   2       bld Thy  5g                         IMAGE:8547365.5p                                                         CGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaagattaagaagaaaaaactaaaagagggcaaggaagattcagatgcacaggaagaaaCAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTgaagaaaaggagttaaccaaagaggaagaggaaaatcagaaagaaaaaTAGATGGTGACTTCTCAAAATTTCAATCTCCAAGATACCATAAGAATTACAGCTAAAGCGTGACTA
  5   1   2       bld DMZ  5g3  in                         xl221g17.5p                                                          GTGTGGCGTGGTCACCTGCGGATCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTgttaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacagaTACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAA
  5   1   2       bld Sp1  5g                         IMAGE:4964720.5p                                                           TGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAA
  5   1   2       bld Ga18      in                        xlk1n22ex.5p                                                           TACGTGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGNNNNTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAANGAAAAAATAGANNGNGACTTCTCAAAANTTNCAATCTCCAA
  5   1   2       bld Li1  5g3  in                    IMAGE:3397048.5p                                                            CACGCGTCCGCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATC
  5   1   2       bld Ga15 5g3  in                       XL422c17ex.5p                                                            GTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTtaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacaGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGA
  5   1   2       bld Eye1 5g                         IMAGE:6946333.5p                                                             TGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacaGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGANAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAAGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCCAAAACATTCCACACTGTTTTACAGTGGGGCAAAGAATGTTGTGGGTCCCAGGCCC
  5   1   2       bld Sp1       in                    IMAGE:4173955.5p                                                              TGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCA
  5   1   2       bld Sp1       in                    IMAGE:4174293.5p                                                              TGTGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174798.5p                                                              GGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCA
  3   1   2       bld Gas3      in                      xlnga001o09.3p                                                                TGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACACCTATAATCCGGTAACAACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGAAAA
  5   1   2       bld Ga15 5x                            XL417c10ex.5p                                                                TGGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGaaaaaaaaaa
  5   1   2       bld Emb1      in                    IMAGE:3403164.5p                                                                 GGCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAG
  5   1   2       bld Li1       in                    IMAGE:3397525.5p                                                                  CACGCGTCCGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGANACCACCATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCA
  5   1   2       bld Oo1  5x                         IMAGE:6642633.5p                                                                  GCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGATAAAACTACAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACTACAGGAGATGAACCAGCTCCTATGACAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGTAAAGGAGTTAACCAAAGAGGAAGAGGAAATCGAGAAAGAAAAAATAGATGGCTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTNAAGAATTTACAAGGCTAAAGGCGTGCACCTATCTGGTTTCCAATTCAATCCGAAAACATTTCCACACCTGTTTNACAGTTGGCCAAAAGATTGTTGTGGGTCCCAGGGCCCCGTACAGGGCACAGGGGAAAAACATTTCCTCGGTTTGGGAATTTCCACTTAAGTGGGGAGGAGGGTTTAC
  5   1   2       bld Oo1  5g                         IMAGE:6642728.5p                                                                  GCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAGCTAAAGGCGGTGACCTATCTGTTTCCAATTCAATCCAAAACCATTCACACTGGTTACCNTTGGCaaaaaaaaTGGTTGGGGGGTCAAGGCCCGCTACAAGGGCACAGGGAAAACCATTTCTTCGGTTTGGGAATTTCCCATTC
  5   1   2       bld Ga15 5x                            XL475e19ex.5p                                                                  GCGTGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCNAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGaaaaaaaaaa
  5   1   2       bld Lu1  5g                         IMAGE:4057727.5p                                                                    GTCACCTGCGGATCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCA
  5   1   2       bld DMZ  5g3  in                         xl262k24.5p                                                                    GTCACCTGCGGATCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGA
  5   1   2       bld Gas3      in                      xlnga003b15.5p                                                                     TGGTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGATTAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCAC
  5   1   2       bld Sp1  5g                         IMAGE:5505958.5p                                                                      CACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCCTAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTNGAGAANAGGAGTTNACCNAAGAGGGAGAGGAAATCNNAGAAGANAAATAGATGGTGACTTCTCAAATTTCCNATCTCCAGGATACCATTAGATTTACAGCTAAGGCTGACTATCTGTTCATTTCATCAACATCAACTGTTAGTGCA
  5   1   2       bld DMZ       in                         xl299m17.5p                                                                       GTCACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAA
  5   1   2       bld Sp1       in                    IMAGE:4969115.5p                                                                         CCACGCGTCCGCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACAACAGGAGAT
  5   1   2       bld Emb4 5x                         IMAGE:5543676.5p                                                                         CACCTGCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaagattaagaagaaaaaaactaaaagaGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTTCAATCTCCAAGGATACCATTAAGAATTTACNAGCTAAAGGCGTGACCTATCTGTTTCAATTCCATCCAAAACATTCCACACTGGTTACAGTGGCAAAAGATGTTGTGGGCCAGGGCCCGTACAGGGACAGGGAAAACCATTTCTCGTTGGAATTTCAATTAATGGNAAAAGCTAAATGAAAA
  5   1   2       bld Emb4 5g                         IMAGE:5515289.5p                                                                         CTGCGGACCTTGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAGGAGTTNACCAAGAGGAAGAGGAAATCAGAAGAAAAATAGATGTGACTCTCAAATTTCATCTCAGGATACATTAGATTACAGCTAAGCGTN
  5   1   2       bld Ga15 5g3  in                       XL406o09ex.5p                                                                           GCGGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaaTAGATGGTGACTTCTCAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAGGCGTGACCTATCTGTTTCCAATTCA
  5   1   2       bld Neu7 5g3  in                         XL016i14.5p                                                                            GGATCTCGTTCTCTTGGGTACGGGAGTTTNNCGAGCAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAANCTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCANAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCANAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAANAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCC
  5   1   2       bld Emb4 5x                         IMAGE:4930202.5p                                                                                GGACCTCGTTCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGGGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGGGAATCAGAAAGAAAAATAGATGGTGACTTCTCAAAATTTCCCAATCTCAAGGATACCATTTAAGAATTTACCAGCTAAAGGGGGTGACCTATCTGGTTTCCAATTTCAATCCAAAAAAATTCCCCCACTGTTTTTAAAGGGGGCAAAAGATGGTTGTGGGGCCCCAGGGCCCGTAAA
  5   1   2       bld FaB  5g                         IMAGE:8072819.5p                                                                                TTCGGTCCGGATTCCCGGGATGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAATTCAAGAAGAAAAAATAGATGGTGACTTCTTCAAATTTCCAATCTCCCAGGAATACATTTAAGAATTTC
  5   1   2       bld Emb4 5g                         IMAGE:4202180.5p                                                                                      TCTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACT
  5   1   2       bld Brn1 5g                         IMAGE:4741033.5p                                                                                       CTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCATAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAA
  5   1   2       bld DMZ  5g3  in                         xl324j07.5p                                                                                          CTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAACCAGATACNTCAGAGATCACTGCAGCCNATGAGTGT
  5   1   2       bld DMZ  5g3  in                         xl302b13.5p                                                                                          CTCTTGGGTACGGGAGTTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACNTCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGA
  5   1   2       bld Oo1  5g                         IMAGE:5078838.5p                                                                                             CTGGACCGGTCCGGAATTTCCGGGATGTTCAGTCAAATTCNTGGGAACAGGAAATTACGCACGATCGTTCCTTCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACAAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGCCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTTCTTTAGTGGAGAAGCTAATGAAGACCAACAGCCATTGGCTAAAGGACCGTGCACCTAGGGTGATAAATCTTAACTCCACCA
  5   1   2       bld Emb1 5x                         IMAGE:6633027.5p                                                                                                   CGGGAGTTTCACGAGAAATCATCGATGCCCNGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTANAAGAGGGCAAGGAAGATTCAGATGCACAGGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTNAAAAAGACACAACAGGAGATGAACCAGCTCCTAGGAAAAGAAAAACCGATACCTTCCGAGATCCCTGCAAGCCAATGAGTGTGAAAGAAAAAGGAGTTTACCCCAAGGAGGAGGAGGGAAATCNNGAAAGAAAAAAATAGATGGGTGACTTTCTCCAAAATTTTCCCATTCTCCCAGGGAATCCCCTTTTAAGGAATTTTACCCAAGCTTAAAGGGG
  3   1   2       bld Gas3      in                      xlnga003b15.3p                                                                                                    GGGAGTTTCACGAGAAATCATCGAATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAA
  5   1   2       bld Te2  5g3  in                    IMAGE:7390298.5p                                                                                                       TTTCACGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAANAGGAGTTTACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCNAGGGATACATTAG
  5   1   2       bld Lmb1 5x                         IMAGE:8534578.5p                                                                                                          GTTTCCGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTNACCAAGAGGGGAGAGGAATCAGAAGANNAATAGAGGTGNACTCTCAAATTTCCATCTCCAGGATACATTAGATTNACAGCTAAGGCTGACTATCGTTTCATCATCAAACATCACACTGTACGTGCAAGAGTGTGTCANGCGTACAGCAGGAACATCCGTTGATCATNATGAAGCATGAACAC
  5   1   2       bld Thy  5g                         IMAGE:8548598.5p                                                                                                            CGAGAAATCATCGATGCCCGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAGGAGTTACCAAAGAGGAGAGGAATCAAGAAGNAAATAGTGGTGACTCTCAAATTNCATCTCCANGTACANTAGATTACAGCTAGGCTGACTACTGTTCATCATCAACATCACCTGTACGTGCAGATGTTGTCAGCCGTCGCCAGAACTCCGTGATCTATGAAGCATGAACACCTGTAGAGCCT
  5   1   2       bld Oo1                             IMAGE:6644040.5p                                                                                                               GCTGGTAACCGGTCCNGGAATTCCCTGGGATGGAAATTACGCACGATCGTTCCTTCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACAAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAAACAGCTCCTAAGAAAAGAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGGAAGAAAGGTGTTTANCCAAAGAGGGAACGGGAATTAAATCAAGGAAAAAATAGACGGGTGGACTTCTCCTAAATTTTCCACTTTTCCCAAGGGAGAACCATTAAGAAATTTTACAAAGCTTAAGGGGAGGGGAGCCTTATCTTTGTTCCCAAATTTCAGTTCCAAAAAACATTTCCCCAACTGGGCTTTacaggggggaaaaaaatggtttggggggtcacagggcccccgttaacaggggcccgggGGAAAAAAACATTTCCCCCCGTTTTGGCAATTCTCCCTTTAAGGGGGGGAAAACGTTTTATTGGAAAAcccccccacccc
  5   1   2       bld Emb1 5g3  in                    IMAGE:3403242.5p                                                                                                                     ACGTTCAGTCAAATTCTGGGAACAGGAAATTACGCACGATCGTTCCTTCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGG
  5   1   2       bld Ooc3 5g                         IMAGE:3437514.5p                                                                                                                       GTTCAGTCAAATTCTGGGAACAGGAAATTACGCACGATCGTTCCTTCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGA
  5   1   2       bld Neu7      in                         XL024f23.5p                                                                                                                         GCACGAGGGAAAGTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACC
  5   1   2       bld Neu7      in                         XL039l24.5p                                                                                                                                     GTTTATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGT
  5   1   2       bld Emb4 5g                         IMAGE:5572359.5p                                                                                                                                     GGACGCGTGGGAAATTACGCACGATCGTTCCTTCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCCAATTAGTCAAAAACATTCCACACTGCTTTACGTGGGAAAAGATGTTGTGGGTCCAGGCCCGTACAGGGCACAGGGGAAAAATTTCTCGTTTTGCTATTCCTTTAGGGGGAGAAGCTAAAAGGGAGAACCACAAGCCATTGGCTTAAAGGA
  5   1   2       bld Brn2                             Brn2-za98f11.5p                                                                                                                                            ATACCGATGAAATGGAGGGTAAAAGTATCAAGAAGAAGAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATT
  5   1   2       bld Sp1  5g                         IMAGE:5513263.5p                                                                                                                                                CGGACGCGTGGGTCCGGACGCGTGGGCGGACGCGTGGGTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGANATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTCCACTTTCAAGGAGACCATTAGATTTACAGCTAAGGATGAGCTATCTGTCCCATCAGTCAAACATTCACCTGCTACGTGCAAGATGTGTGTCCAGCGTCAGCCAGGAACATCCGTGCTATCTAN
  5   1   2       bld Thy  5g                         IMAGE:8550139.5p                                                                                                                                                 AAAAANNNCCAAGATGGTTGAGTCCTCGATTCGATTCGTCCGTGTGGTGTGGTCCCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTACCAAAGAGAACAGGAATAATCaaaaaaaaTAAGGTGACTCTTAATTTCACTTTCAGGAACATTAGATTACAGCTAGGATGACTATCGTCCATCATCAAACATCACATGCTACGTGCAAATGTGGTCAGCCGACNGCCAGAACTCTCGTGATCTTATGAACTATGAACACGCTGTAAGATGCTAGGAACTCTCCGAATGCTCATCAGATCGCTCAACTAGCTGTCGGACTCAAATTCTAAGTATTC
  5   1   2       bld Ga18      in                      xlk148i12ex.5p                                                                                                                                                         TGTGTATGTGCAATGTTTGTGTAAACTGACTGAAACTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCGGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTgttaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacagaTACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGANTTCTCAAAATTTCCAATCTCCAAGGATNNCATTAAGAATTTACAAGCTAAAGGNGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTG
  5   1   2       chi Tad1                            IMAGE:6939558.5p                                                                                                                                                             GGGCCCTTTCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCCGTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAAGAAAACTGATACAACGGGAGATCACTACAGCCAAAGGAGTGTGAAGAAAAAGTGTTAACCCCAAGAAGGACCAGGAAATAAATTCCAGAAAAAATTAGAACCGTGAACTTTCTCTAAATTTTCCACTTTTCCCAAGGAAGACCATTTAAGAAATTTTACCAAGCCTAAAAGGGAATGGAGCCTATTCTTGTTTCCCCAAATTCCAGGTTCAAAAAAACATTTTCCACAACCTGGCCTTTATACAGTGGGCaaaaaaaaaTGTTTGTC
  5   1   2       bld Int2 5g                         IMAGE:8824014.5p                                                                                                                                                             CACACAGAGGCGGGAGGAGGTGGCGATTCGAGTTCGTCCCCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTaaaaaaatctaaaaaGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGAAAACATTCTCGTTTGCTATTCTTTAGTGAGAAGCTAAATGAGACCAACAGCCATGCTAGAGACGTGCACTAGGTGATAATCCTACTCACAGAAGGGTTAGCTATTTCAAATCACAAATGAAATT
  5   1   2       bld Emb4 5g                         IMAGE:5514078.5p                                                                                                                                                              TCGTTCCTTCCTTTTGTCGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCNCAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTNCAAACATTCACACTGCTACAGTGCAANGATGTGTGGGTCAGCCGTACAGCACAGGAAACATCTCGTTGCTATCTTT
  5   1   2       bld Tad2 5g                         IMAGE:6936255.5p                                                                                                                                                                 GGGGCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAGACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTaaaaaaaatctaaaaaGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGGAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTTCACTTTCCAAGGAGACCCATTAAGAATTTACAAGCTAATTGGAGTGAGCTNATCTGTTCCCCAATTTCAGTCAAAAAACATTTCCACAACTTGCTTACAGTGGGCAAAAGATGTTGGTGGTTCCAAGGCCCCGTTACAGGGCACCAGA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532539.5p                                                                                                                                                                 CCttttttttGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAGGAGACCATTAAGAATTTCAAGCTAAAGGATGAGCTATCTGTTCCAATCAGTCAAACATTCACCTGCTACGTGGCAGATGTGTGTCAGGCCGTCAGCACAGGAAATCTCGTGCTATCTATGAGACTATGAACACGCATGTAAGATGCCTAGTGAACTCTCACGAGTGCTCATCATGACC
  5   1   2       bld Tad1 5g                         IMAGE:6880691.5p                                                                                                                                                                  GGGCCCTTTTGCACGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCNNANaaaaaaaaaaaaaaaaaaaaGAGACCTTGTC
  5   1   2       bld Sp1  5g                         IMAGE:5512997.5p                                                                                                                                                                   CCCACGCGTCCGCGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCACACTGCTACAGTGGCAAGATGTGTGGTCCAGCCGTACAGCACAGGAAACATCTCGTTGCTATCTTTATGGAGAC
  5   1   2       bld Kid  5g                         IMAGE:7007988.5p                                                                                                                                                                   CGGACGCGTGGGGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTNCCCATTCAGTCAAAAACATTCACACTGCTACAGTGGCA
  5   1   2       bld Li1  5g3  in                    IMAGE:3398125.5p                                                                                                                                                                    CACGCGTCCGCCCACGCGTCCGGTGGTGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCA
  3   1   2       bld Ga18      in                       xlk61a12ex.3p                                                                                                                                                                      CNNNGNNNNNGCTGCTTTAGTGTGGTGTGNTCNACNGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCNCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAAAATAAAAGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGNACANTC
  5   1   2       bld Kid  5g                         IMAGE:7008127.5p                                                                                                                                                                        CCCACGCGTCCGCCCACGCGTCCGGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGANAAAATAGACGGTGACTTCTCTAANTTTCCACTTTCCNAGGAGACCCATTAGAATTTANNCAGCTAAGGAGTGAGCTATCTGTTTCCATTCAGTCAAAAACATTCACACTGCTTACAGTGGCAAAGATGTTGTGGGTCAGCCCGTACAGCACAGGGAAACATCTCGTTGCTATCCTTAGTGAGAGCTAATGAGACCACAGCATTGCTAGAGACTGCACTAGGTGATATCCTACTCACAGAAGTAGCTATCATCCAATGAATCGCGCTCCTAAAGCTGGGTCTNTGTTTACGAGACTCTATCACACATTTTGCATAGATGATGATCTATCGGACCTGCNGGAAATTGCAATACCTGACTCACTTAGCTGACTACATGAGAGTCATGCTCCAANTAGATN
  5   1   2       bld Ga18      in                       xlk61e15ex.5p                                                                                                                                                                        TTTTGCACGCTGCTTTGGTGTGGTGTGGTCNCCTGCGGACCCGTTCTCTTGGATACGGGAGNTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGANGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGNGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTNCACACTGCTTACAGTGG
  5   1   2       bld Emb4 5g                         IMAGE:5542945.5p                                                                                                                                                                             CCACGCGTCCGGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATaaaaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCCTTTAGGTGGAGAAGCTAAATGGAAGACCAACAGCCCATTGGCCTAGAAGGACGGGGCACCCTAGGGGTGAATAATCCCTTACCTCCAACCCAGAGGAGTT
  5   1   2       bld Thy  5g                         IMAGE:8547905.5p                                                                                                                                                                             TTAATTTAAAAAGCAAGCACAACTTCAATATAAATTCGTCCCCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACACGAAATAAATCAAGAAAAAATAGACGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAACATTCCACACTGCTTACAGTGCAAAGATGTTGTGGTCCAGGCCCGTACAGCACAGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAATGAAGACCACAGCCATTGGCTA
  5   1   2       bld Sp1  5g                         IMAGE:5506897.5p                                                                                                                                                                              CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCTTNAGTGGAGAGCTAATT
  5   1   2       bld Sp1  5g                         IMAGE:5511139.5p                                                                                                                                                                              CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCACACTGCTTCAGTGGCAAGATGTGTGGTCAGGCCGTACGGCACAGGAAACTTCTCGT
  5   1   2       bld Te2  5g                         IMAGE:7394317.5p                                                                                                                                                                              GCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATaaaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTNCAAACATTCACACTGCTACAGTGGCAAGATGTGTGGTCAGGCCGTACAGCACAGGAAACATCTCGTTGCTATCTTAGTGAGAGCTATGAGACACGCATGCTAAGACTGACTAGTGAATCTACTCACGGGTACTTCATCCAGATCCCTCCTAACTAGTCTGTTCGGAC
  5   1   2       bld Em10 5g                         IMAGE:8319203.5p                                                                                                                                                                              CGCTGCTTTGGTGTGGTGTGGTCACCGGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTTCAAGCTTAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCCACACTGCTTACAGTGGCAAA
  5   1   2       bld Lmb1 5g                         IMAGE:8533933.5p                                                                                                                                                                              CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAGGAGACCATTAAGAAATTTACAGCTAAGGAGTGAGCTATCTGTCCATTCAGTCAAAACATTCACCTGCTACAGTGCAAGATGTGTGGTCAGCCGTCAGCCAGGAAACATCTCGTGCTATCTTTAGTGAGACTATGAGACACAGCATGCTAAGAGGCCTAGTGAATCTCTCACGAATACTTCATCCAGATCCCTCTA
  5   1   2       bld Lmb1 5g                         IMAGE:8533960.5p                                                                                                                                                                              CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGATAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaATGGGGACACAGAAGATCTTGATTTGGAATATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAAAGAATGGTGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAGCTCCAAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCCAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCTCATTCAGTCAAAAACATTCACACTGCTACAGTGGCAAGATGTTGTGGTCAGGCCGTACAGCACAGGAAACATCT
  5   1   2       bld Lmb1 5g                         IMAGE:8534911.5p                                                                                                                                                                              CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGATAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGCGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTNAATTTCCACTTTCCCAGGAGACCATTNAGATTTANCAGCTAAAGGAGTGAGCTATCTGTTTCCATTCAGTCAAAACATTCACACTGCTTAAGTGGCAAGATGTGTGGGTCAGCCGTACAGCACGGAAAACATCTCGTTGCTATCTTT
  5   1   2       bld Panc 5g                         IMAGE:8737746.5p                                                                                                                                                                              CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCACGAGTGTGAGAAAAGGTGTACAAAGAGGACAGGAAATAAATCAGAAAAAATAGACGGTGACTCTCTAATTTCCACTTCCAGGAGACATAGGATTACAGCTACGGATGGAGCTATTCTTGTCCAATCAGTCAACATCCAACTGCTACGTGGCAGAATGTTGGGTCAGCGTCGCAAGAACTTCGTTGCATCCTATGGAAGCTATGACAGCATGCTAGACTGACTAGGTATCTATCGAGGTGCATCATCCAG
  5   1   2       bld Emb4 5g                         IMAGE:5514072.5p                                                                                                                                                                               CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCACACTGCTTACGTGGCAAGATGTGTGGTCAGGCCGTACAGCACG
  5   1   2       bld Ga15 5g3  in                       XL440i05ex.5p                                                                                                                                                                               CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCNTCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCNAACAGCC
  5   1   2       bld Tail 5g                         IMAGE:8545790.5p                                                                                                                                                                               CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACNAAGCTAAGGAGTGAGCTATCTGTTTCCATTCAGTCAAAACATTCACACTGCTACAGTGGCAAGATGTGTGGTCCAGCCGTACAGCACAGGAAACATCTCGTTGCTATCTTTATGAGAGCTATGAGACACAGCATGCTAAGACTGCCTAGTGATATCTCTCACAGAATGCTTCATCCATGATCGCCTCTAAACTAG
  5   1   2       bld Spl  5g                         IMAGE:8462617.5p                                                                                                                                                                               CGCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACAAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAATGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCNAGGAGACCCATTAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCACACTGCTACAGTGGCAAGATGTGTGGTCCAGCCGTACAGCACAGGAAACATCTCGTTGCTATCTTTATGAGAGCTATGAGACACAGCATGC
  5   1   2       bld Emb4 5g                         IMAGE:5571992.5p                                                                                                                                                                                GCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACAAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTANATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTANAGGAGTGAGCTATCTGTTCCNCATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTTGGGTCCAGGCCCGTACAGGCACAGGGAAAAACATTCTCGTTTGCTATTTCCTTTAGTGGGAGAAGCTAAATGGAAGACCAACAGCCCATGGGCTAGAAGGAACGTGCCACCTAAGGGTGATAATTCCTTTACTCCAAACCCAGAGAAGTTTAGCTTATTTCACAATCCCCAAAATGGAAAATCCCGCCAGGCATCACCTTAAAAAAAGCTGTGAAGGG
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8531534.5p                                                                                                                                                                                GCTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTNCCATTCAGTCAAAACATTCACACTGCTACAGTGGCAAGATGTGTGGTCAGGCCGTACAGCACNGG
  5   1   2       bld Li1  5g3  in                    IMAGE:3398000.5p                                                                                                                                                                                 CTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGT
  5   1   2       bld Thy  5g3  in                    IMAGE:8548804.5p                                                                                                                                                                                 CTGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagattcagacacacaggaagaagCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAGCTAAATGAGACACAGTCATTGGCTAGAGGACGTGCACTAGTTGATATCTACTCACAGAGAGTAGCTATCATTCACAATGAATCGCAGCATACTAAGCTGACGATCCTGGTTTTTTACGGGAGAAACCTCTCCCT
  5   1   2       bld Li1  5g3  in                    IMAGE:3396589.5p                                                                                                                                                                                  GCTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCAT
  5   1   2       bld Spl  5g                         IMAGE:8462434.5p                                                                                                                                                                                  TGCTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACAAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAGGAGACCATTAAGATTTACAAGCTAAGGAGTGAGCTATCTGTTCCCATCAGTCNAAACATTCACCTGCTACGTGGCAGATGTGTGTCCAGCCGTCAGCCAGGAAACTCTCTTGCTATCTTATGAGACTATGAACACGCATGCTAAGATGACTGGTGAACTCTCACGAATACTTCATCATGATCCCTCTAACTA
  5   1   2       bld Tail 5g                         IMAGE:8543728.5p                                                                                                                                                                                   CTTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAAATCAGAAAAAATAGACGGTGACTTCTCTAAATTTCACTTTCCAGGAGACCATTAGAATTTACAGCTAAGGAGTGAGCTATCTGTTCCATTCAGTCAAAACATCACCTGCTACAGTGCAAGATGTGTGGTCAGCCGTCAGCCAGGAAACATCTCGTGCTATCTTATGAGACTATGAGACACGCATGCTAAGACTGCCTAGGAATCTCTCACA
  5   1   2       bld Li1  5g                         IMAGE:3396750.5p                                                                                                                                                                                    TTTAGTGTGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGATGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGA
  5   1   2       bld Ga15 5g                            XL461j11ex.5p                                                                                                                                                                                    CTTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk142b19ex.5p                                                                                                                                                                                    TTTAGTGTGGTGTGGTCNCCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGANCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGNCCAGNNCCNTACAGGCACNGGGAAAACATTCTCGTTTNCNNNTNCTTTAGTGGAGAAGCTAAATGA
  5   1   2       bld Ga18      in                       xlk61a12ex.5p                                                                                                                                                                                      TTTAGTGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGNNNNTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTaaaaaaaaaa
  5   1   2       bld Neu7 5g3  in                         XL049l24.5p                                                                                                                                                                                       ACGAGGGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAA
  5   1   2       bld Sp1  5g                         IMAGE:4965101.5p                                                                                                                                                                                         TGTGGTGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGtgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCANGCTCGTACAGGCACAAGGAAAACATTCTCGTTTGCTATTCTTTTAGTGGAAAGCTAAATGAAGACCACAGCCATGGCTAA
  5   1   2       bld Emb4 5g                         IMAGE:4970716.5p                                                                                                                                                                                          TGTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGtgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAA
  5   1   2       bld Sp1  5g                         IMAGE:5512624.5p                                                                                                                                                                                           TGGTGTGGTCACCTGTGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCACACTGCTTACGTGGCAAGATGTGTGGGTCAGCCGTACAGCACGGNAAACATCTCGTTGCTATCCTTAGTGAG
  5   1   2       bld FaB  5g                         IMAGE:8072458.5p                                                                                                                                                                                           GTGGTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAGCTAAAGGGTGAGCTATCTGTTCCAATTCAGTCAAAACATTCACACTGCTTACGTGGCAAGATGTGTGGTCNAGCCGTACAGCACAGGAAACATCTCTTTGCTATCCTTAGTGGAGAA
  5   1   2       bld Panc 5g                         IMAGE:8736598.5p                                                                                                                                                                                           TGGTGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGAAAACATCTCGTTGCTATTCCTTAGTGGAGAGCTAATGAGACACAGCATGGCTAGAGACGTGCACCTAGGGTGATAATCCCTTACTTCCAC
  5   1   2       bld Sp1  5g                         IMAGE:4174057.5p                                                                                                                                                                                            GGTGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGA
  5   1   2       bld Li1  5g3  in                    IMAGE:5129891.5p                                                                                                                                                                                            GGTGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAA
  5   1   2       bld Li1  5g3  in                    IMAGE:3397648.5p                                                                                                                                                                                             TGTGGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATaaaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCA
  5   1   2       bld Tail 5g                         IMAGE:8544250.5p                                                                                                                                                                                             GGTGTGGTCCCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAACATTCACACTGCTACAGTGGCAAGATGTGTGGTCAGGCCGTACAGCACAGGAAACATCTCGTTGCTATCTTNAGTGAGAGCTAATGAGACACAGCATTGCTAAGACTGCCTAGTGAATCTACTCACGAAGTGCATCATCCATGATCCGCTCTAAG
  5   1   2       bld Ga18 5g3  in                      xlk127d22ex.5p                                                                                                                                                                                             TGGTGTGGTCNCCTGCGGACCCGTTCTCTTGGATACGNNNNNNTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAANCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCNATTCAGTCAAAANNTTNNACACTGCTT
  5   1   2       bld Li1  5g3  in                    IMAGE:3398165.5p                                                                                                                                                                                              TGTGGTCACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAAATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCNACTCCCAAGTTAAATAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTAAAACCGCAGAAGAATGTAACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGaaaaaaaaaataaaagaaaaCAAAG
  5   1   2       bld Lu1  5g                         IMAGE:4056671.5p                                                                                                                                                                                              TGTGGTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAATTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAGGTGTTAACCANAGAGGAACANGANATAAATCAAGAAGAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTTAGAATTTACAAGCTTAAGGAGTGAGCTATCTGTTTCCCATTCATGCAAAAACATTTCAC
  5   1   2       bld Ga15 5g3  in                       XL450b11ex.5p                                                                                                                                                                                              GTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGA
  5   1   2       bld Ov1  5g                         IMAGE:8331033.5p                                                                                                                                                                                              GTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCC
  5   1   2       bld Ga18 5g3  in                       xlk64g02ex.5p                                                                                                                                                                                              GTGTGGTCNCCTGCNGACCCCGTTCTCTTGGATACGNNNNTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATNNATGGTGAGATCNANAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCNAAGAAAGTCAAGAAGaaaaaaataaaaGTNAGCNAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTNATGATNATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTNTGAAGAAAAGGTGTTANNCNNAGAGGAACAGGAAATAAATCAAGAAAAANTAGACGGTGACTTCTCTAAATTTCCACTTTTCCAAGGAGNNCATNNNGAATTTACNAGCTAAAGGAGTGAGCTATCTGTTCCNNATTCAGTCAAAAACNTTCCACACTGCTT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175191.5p                                                                                                                                                                                               TGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGA
  5   1   2       bld Sp1                             IMAGE:4963584.5p                                                                                                                                                                                               CTCCTCTACCCAAGTTAAAAAAGAGAAAAATGCAGAACGGGGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCTTATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAAC
  5   1   2       bld Emb1 5g                         IMAGE:6865069.5p                                                                                                                                                                                               GTCGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTAtgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTTGGCTAGAGGACGTTGCACCTAGGGTGGATAATCTTTACTCCCAACCAGAAGAGGTTAGCCTATTTCAAATCACCAAATGGAAATTCCGGCAT
  5   1   2       bld Emb4      in                    IMAGE:4202504.5p                                                                                                                                                                                                CGTCGCCACCGTCGGTTAGGGGTGTGGTCACCTGGGACCGTCTTTGGTACGGAGTTTAGAGAAATATATGCCCGGAGGTTTATGCGGGAAATGGAGGGTGAAAGTTGAGAGGAAGAAATGTCTGAAACTCCTCTACCAGNTAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGACTTGTTTGGAACATATGGCTGATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGA
  5   1   2       bld Ga12 5g3  in                         XL179a16.5p                                                                                                                                                                                                GTGTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGT
  5   1   2       bld FaB  5g                         IMAGE:8073095.5p                                                                                                                                                                                                GTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTTAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGCCCGTAC
  5   1   2       bld Lmb1 5g                         IMAGE:8535818.5p                                                                                                                                                                                                GTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCNTAATTTCCACTTTCCAAGGAGACCATTAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCAATTCAGTCAAAACATTCACACTGCTTCAGTGGCAAGTATGTGTGGTCAGGCCGTACGGCACAGGGAAACATCTCGTTGCTATCCTTATTGAAAGCTAA
  5   1   2       bld Int2 5x                         IMAGE:8527598.5p                                                                                                                                                                                                GTGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAGGAGACCATTAAGATTTACAAGCTAAGGAGTGAGCTATCTGTTTCCATCAGTCAAAACATTCACACTGCTACAGTGCAAGATGTGTGGTCCAGCCGTACAGCCANGAAACATCCGTTGCTATCTTATGAGAGCTATGAGACACAGCATGCTAAGACTGCCTAGGATACTCTCACAAGGTACTTCATCNAGATCGCCTCTAACTAGTCTGTTCGGACCATAAAT
  5   1   2       bld Int2                            IMAGE:8825322.5p                                                                                                                                                                                                GGCCAAGTTCTCATACGGTCGCCGGTGGTGTCTCTTTTTTAACGTCCATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAAATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACGGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCCAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTCCCAATTCATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGCCCGTACAGGCACCGGGAAAACATTCTCGTTTGGTATTCCATTATGGAGAGCTAAGTGAAGACCAGCAGCTGTTGGCTAGAGGACGGCACCTAGGGTTATTATCCTTACTTCCCACTGAGAGCTAGCTATTCAGATACAATGAACTCCGGCAGTATGACTAAAGCTGATGTTTGCTGTTTTTACGAGAACACATATGCAACGCAAGTTTTTGCATTAAGGATGGAAATTGGCACTCGT
  5   1   2       bld Sp1  5g                         IMAGE:4174386.5p                                                                                                                                                                                                 GGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTAtgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCAC
  5   1   2       bld Ga15 5x3  out                      XL484g18ex.5p                                                                                                                                                                                                 TGGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGaaaaaaaaaa
  5   1   2       bld Te2  5g                         IMAGE:7392104.5p                                                                                                                                                                                                 GGTCACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTAtgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCANGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAA
  5   1   2       bld Sp1       in                    IMAGE:4173201.5p                                                                                                                                                                                                  GGTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAA
  5   1   2       bld Sp1  5g                         IMAGE:5513148.5p                                                                                                                                                                                                  GTCACCTGCGGACCCCTTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTAtgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCCATTAGAATTTANCAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTNCAAACATTCACACTGCTTACGTGGCAAGATGTTGTGGGTCAGCCGTACAGCACAGGAANACATCTCGTTGCTATTCTTAGTGAGAGCTAATGAGACACAGCATTGCTAA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4964129.5p                                                                                                                                                                                                   TCACCTGCGTTTCCCCCTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACTTCTATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGTCTGCTCCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACA
  5   1   2       bld Oo1  5g                         IMAGE:6642233.5p                                                                                                                                                                                                   CGGCTGGACCGGTCCGGATTCCCGGGATGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATaaaaaaagagaaaaaTCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAATTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGGCTAGAGGACGTGGCACCTAGGGGTGGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGGTCTCGTGGTTTTTACGGAGGAAACTCATATCAACAACNAGTTTTTTGCCATTAAAGATGGAATTGC
  5   1   2       bld Brn1 5g                         IMAGE:6952043.5p                                                                                                                                                                                                   TTGGGATTGCGGACCCGTTCTCTTGGATACCGGAGTTTTAGGAGAAATCTCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAGCTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATATGTGACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAAGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGGTGACTTTCTCTAAATTTCCCACTTTTCTAAGGAGACCATTTAGAAATTTTAAGAGGCTAAAAGGAGTGGGAGCCTATCCTGGTTCCCAAATTCCAGTCAAAAAAACATTTCCACCAACGGCCTTTACAGGTGGGCCAAGAAAAAGGTATGGTGGGGTCCCAAGGGACCGGTAACCGGGGTCTCATGTGGGTGAAAAACCTTTTTCCGTCGCTTTTTGGCCTTAATTCCCCCCCTTTTAAACTGGGAAACATAAGCTCTAAAAATTGGAAAGGAACCCTAAAAGATCTCCTTTTGGGCTCTAGAAAGAAAAACCGCCCAACCTTAGGGGGTGGAATTAATTCCCCTTAACATCCCGAACTCCAGAAAAAGTGTTTGAGCTTAATTTCTAAAACGCACCAGAAAGGTGAAAATTCCGGGACGACATATCCCCCTaaaaaaaaatataggaagggactctgcggtgtttttttttCCCGGGAAGGAAAACTCCCCATTAATCCGCCACCACAAAGGttttttttGGCCGTCTTTTAAAGGA
  5   1   2       bld Int2 5g                         IMAGE:8529489.5p                                                                                                                                                                                                   GTCACCTGCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGtgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGAAAACATTCTCGTTTGCTATTCTTTAGTGGAGAGCTAATGAGACCACAGCCATGGCTAGAGACTGCACTAGGTGA
  5   1   2       bld Ga15      in                       XL420k18ex.5p                                                                                                                                                                                                    CACCTGCGGACCCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaatgaagaaTGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTNAAATGAAGACCNACAGCCATTG
  5   1   2       bld Emb4 5g                         IMAGE:5572710.5p                                                                                                                                                                                                     ACCTGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTANAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAAAATGGTTGTGGTCCCAGGCCCGTACAGGGCACAGGGAAAAACATTTTCTCGTTTGCTATTTCCCTTTTAGTGGGGAGAAAGCTANATGAANGAACCAACAGCCATTGGGGCTTAGAGGACGTGGCCAACCCTTAGGGGTGAATAAA
  5   1   2       bld Emb4 5g                         IMAGE:5536844.5p                                                                                                                                                                                                        TGCGGACCCCGTTCTCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGGCAAAGATGTTGTGGGTCCAGGCCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCCTTTAGTGGAGGAAACTAAATGAAGACCAACAGCCATTGGGCTAGAGGACGTGGCACCTAAGGGTGGATAATCCTTAACTCCCACCCAGAGAGGTTAGCTATTCAAATCACAAATGGAAATCCCGCAGCATC
  5   1   2       bld Oo1  5g                         IMAGE:6639812.5p                                                                                                                                                                                                        TGGACCGGTCCGGATTCCCGGGATGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAATTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTANATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGNTGATAATCCTTACTCCACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAAGGTCTCGTGGTTTTTTACGGGAGGAACTCCCATATCANCANCNNAGTTTTTGCCCATTTAAAGAATGGGAATTGGACTTNCTTNNAGTCGGGNACACCCTGGCCCCGCGGNTGGAAA
  5   1   2       bld Sp1  5g                         IMAGE:5512722.5p                                                                                                                                                                                                          GCGGACCCGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTNCCATTCAGTCAAAAACATCCACACTGCTACAGTGGCAAGATGTGTGGGTCAGCCGTACAGCACAGGAAACATCTCGTTGCTATCCTTAGTGAGAGCTAATGAGACACAGCATTGCTAAGACTGC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4202327.5p                                                                                                                                                                                                             CACGCGTCCGCTTGGATACAGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagattcagacacacaggaaagaAGCAGAACAATCTGAACCACAAAC
  5   1   2       bld Ga15 5g3  in                       XL423c16ex.5p                                                                                                                                                                                                                CGTTCTCTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATaaaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGTGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCCACAGCCATTGG
  5   1   2       bld Sp1  5x                         IMAGE:5512511.5p                                                                                                                                                                                                                 CGGACGCGTGGGCGCGGTATTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACGTATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGaaaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCANGCCCGTACAGCACAGGGAAAACATCTCGTTGCTATC
  5   1   2       bld Int2 5g                         IMAGE:8530237.5p                                                                                                                                                                                                                       CTTGGATACGGGAGTTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCATTCAGTCAAAAACTTCCCACTGCTACAGTGGCAAGATGTGTGGGTCAGCCGTACAGCACAGGAAACATCTCGTTNGCTATCTTAGTGAGAGCTATGAGACACAGCATGGCTAAGACTGCCTAGTGATATCTCTCACAAGGTGCTTCATCCATGATCCACTCTNAAGCTAGCCGGTTACGGATC
  5   1   2       bld Emb4 5g3  in                    IMAGE:4201689.5p                                                                                                                                                                                                                         TGGATACGGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGtgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGGAAGAAGCAGAACAATCTGAACCACAAACGGAATGGCGTTGAAGAAGCGTTTAAAAAATCTAAAAAGAAACATTACCAAGGTGGATGATTAATGAACCCCAACTTCCTAAGaaaaagaaaaaaCCCTGATTCCAACCGGAGGATCCA
  5   1   2       bld Sp1  5x3  out                   IMAGE:4963544.5p                                                                                                                                                                                                                         TGGATATTTGACCTTTAGGAGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGtgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTT
  5   1   2       bld Ov1       in                    IMAGE:5047862.5p                                                                                                                                                                                                                                AGAACGTTTAAACCGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAA
  5   1   2       bld Oo1  5g                IMAGE:6639812-IMAGp.IMAGp                                                                                                                                                                                                                                GGGAGTTTTAGGAGAAATCATCAATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAATTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGC
  5   1   2       bld DMZ       in                         xl316e19.5p                                                                                                                                                                                                                                       GGAAACAGAAGATCTTGATTTGGAACATGTGACTGAATCCGTAAACGGAAAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTG
  5   1   2       bld Bone 5g                         IMAGE:8739987.5p                                                                                                                                                                                                                                            AGAAATCATCGATGCCCGTGAAGGTTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGACAGAATAATCAAGAAAAATAGACGTGACTCTCTAATTTCCACTTTCCAGAGACCATTAGAATTACAGCTAAAGGGTGAGCTATCTGTTTCCATTCAGTCAAAACATCACACTGCTAAAGTGGCAAGATGTTGTGTCAGCCGTACAGCAAGAACTTCTCGTGCATTCTAATGAAAGCTTATGAAACACAGCATGGCTTAGACTGACCTAGGTTATCCTATCACAGAGTTGCATTCCATTCAATGAATCCGCGCACTCTACTTAAAGCGTCAG
  5   1   2       bld Ov1       in                    IMAGE:5073958.5p                                                                                                                                                                                                                                                                    TTTATGCCGAGGAAATGGAGGGTGAAAGTATGAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATAAAAAAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATT
  5   1   2       bld Tail                            IMAGE:8545365.5p                                                                                                                                                                                                                                                                                     GGAGAGATCAACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACCGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGaaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGC
  5   1   2       bld Te2                             IMAGE:7393558.5p                                                                                                                                                                                                                                                                                         GtgaaagtatgaagaagaagaaactgtctgaaactcctctacccaagataaaaaagagaaaaaTCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAAGCTAATGAAGACCACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATATCCTTACTCCNACAGAGAGTAGCTATTCAATCACAATGAATCCGCGCATCCTAAAAGT
  5   1   2       bld Ga15      in                       XL492l18ex.5p                                                                                                                                                                                                                                                                                           AACAACAATAATCCGACTCCCAAGCTGAAGAAGAATAAGAAGCCTGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGttaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacagaTACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAA
  5   1   2       bld Sp1                             IMAGE:5512290.5p                                                                                                                                                                                                                                                                                              TGACGGAGAGCAGCCATGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGAAAAATGAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCACCAGAGAGTAGCTATTCAATCA
  5   1   2       bld Ga15                               XL424h19ex.5p                                                                                                                                                                                                                                                                                                  GAAGAAGAAGAAACTGTCTGAAACTCCTCTACCCAAGATaaaaaaagagaaaaaTCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCaaaaaaaaaa
  5   1   2       bld Kid                             IMAGE:7010633.5p                                                                                                                                                                                                                                                                                                                                       TGCACCGAAATCAGATCTCTCTGAAACTGCAGAACAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGA
  5   1   2       bld Emb4                            IMAGE:4930249.5p                                                                                                                                                                                                                                                                                                                                              AAGAGAAAAATCAAGAATGGGGACACAGAAGATCTTGATTTGGAACATATGGCTGAATCCGTAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGGGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAAGGTCTCGTGGTTTTTTACGGAGGGAACTCCATATCAACCAACAAGTTTTTGGCCATTTAAAGATGGGGATTTGACTTTCCTTAGTCGGGAAACCCgggggcccgggggggAGAAGAACCTTTGGTCC
  5   1   2       bld Em10      in                    IMAGE:7981563.5p                                                                                                                                                                                                                                                                                                                                                          GAAGAATGGGGACACGAAGATCTTGATTTGGAACATATGGCTGAATCCATAAATGGAGAGATCAACAACAATAATCCGACTCCCAAGTTGAAGAAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaaagtcaagaagaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAA
  5   1   2       bld Tail                            IMAGE:8545420.5p                                                                                                                                                                                                                                                                                                                                                                            ATTNTTTCCCACGTTNNNNGANGAGACATAAAAANATTCGTCCCAGAAAGTTAAGAAGaaaaaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAANAAGCTGAAGGTTGCCTGTTTTTACGGAGGA
  5   1   2       bld Li1                             IMAGE:3397191.5p                                                                                                                                                                                                                                                                                                                                                                                      GCAGCCAGATCCAAGCACTCCCACACcaaagaaagttaagaagaaaaaaactaaaaGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATGTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTGTACAGTGGCAAAGAT
  5   1   2       bld Lmb1                            IMAGE:8534850.5p                                                                                                                                                                                                                                                                                                                                                                                          GCCAGATCCAAGCACTCCCACACCAAAGAAAGTTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGGCCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAAGGAAAACATTTCTCGTTGGTATTCATTAGTGGAGAGCTAAGTGAAGACAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGTAATATCTTACTCTACCAGAGAGCTACTATCAGATACAATGAACTCGCACATGATAAAAGCTGAAGGTGCTGTTTTACGAGACACCTTCACACCAGTTTGCATTAGGAGATGACTCTTGTGGACCCTGCCAAAAATCTTCAA
  5   1   2       bld Emb4                            IMAGE:4202938.5p                                                                                                                                                                                                                                                                                                                                                                                                  GGCTGAATCCGTAAAGGAGAGACAACAACAATAATCCGACTCCCAAGTTGaaaaaaaaGAAGAAGCCTGCACCAATATCAGATCTCTCTGAAACCGCATAATAATGTGACGGAGAGCAGTCAGGAGCAAGCACTCCCACACCTAAGAAAGTCAAGAAGaaaaaaataaaaGAGAGCAAGGAGGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAANNATCTAAAAAGAACATAACANGTGATGATAATGAACCAGCTCCTAAGAAANGAAAANCTGNTNCCNCGGNNATCACTACAGCCAAN
  5   1   2       bld Thy       in                    IMAGE:8549248.5p                                                                                                                                                                                                                                                                                                                                                                                                                              CAATAATCCGACTCCCAAGTTGAAGAAAAAGACGATGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAATCACAAATGAATCCGCACATCACTAAAAGCTGAAGTCTCGTGTTTTAGGAGGACTCCATATCACACAGTTTTTGCATAAGATGGATGACTCTAGCGGACACTGCCGTGGAAGACTGTCAAATACGCTGACTACACTTAACGTGTACAACAGTGACGAGTCATTGGTCCGACATGAGATTACGTCCTCACGATCGAAACAACTTGTCGATGC
  5   1   2       bld Lmb1                            IMAGE:8534542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCTCTGTTNNNNGCGGAGTCATGATATGAATTCGTCCCGAAGAAACCACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAAATATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTGCCTGGTTTTTCGGAGGAACACATATCACCAACAGTTTTTGCCTTTAAGATGGAATGACTTCTAGTTGGAACCCTGGCGCATAGAGATCTGTCCAAATACGCTTGACCTTCATTTTAAGCTGGGGACTGATGAGTGAATGAGTTGAATGGCTCTCGACAG
  5   1   2       bld Emb3      in                    IMAGE:3399963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGAAAAGAAGAAGCCTGCACCAATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGGAAAAGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCCAATCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGGTGGGTCCCAGCCCCGACAAGCACAAGGGAAA
  5   1   2       bld Spl                             IMAGE:8460222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAANAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAGGATGGATTTGACTTCTAGTGGAACCCTGGCGCATAGAGATCTGTCAAACTACGCTGGGACTACGTTTAAGCTGTGTACTGATGAGTGACTGATGTGAATGGCTCTCGACAGTGAGAAA
  5   1   2       bld DMZ       in                         xl241a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAAGATTCAGATGCACAGGAAGAAACCAACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCaaagaagattaagaagaaaaaactaaaagagggcaaggaagattcagatgcacaggaagaaaCAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTtaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacagatacatcagagatcactgcagccaatgagtgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCANCAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTG
  5   1   2       bld Spl       in                    IMAGE:8463822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAGNNNCCATGCATACNNTGNGGATCCATNATATNNNTTCGTCCCCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACA
  5   1   2       bld DMZ       in                         xl328e07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAACAGATCTCTCTGAAACCGCAGAAGAATGTGACGGAGAGCAGCCAGATCCAAGCACTCCCACAccaaagaaagtcaagaagaaaaaaataaaagagagcaaggaagaTTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGACCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACANGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTC
  5   1   2       bld Lmb1                            IMAGE:8535970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACATTTCTCTGTCGTCTCAGGGGGACCAATGTGATGGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAANAAGCTGAAGGTTGCCCTGTTTTACNGAGGAACACCATATCNNACACAGTTTTTGCCATTANGATGGAATGACNNTCTAGTGGAACCCTGGCGCATAGAGATCTGTCAAACTACGCTTGGACTACGTTTTAGCTGTGTACTGATGAGTGACTGAGTTGATTGGCTCTCGACAGTGAGAATATACGTCCTCA
  5   1   2       bld Lmb1                            IMAGE:8535577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAANNCTTTACTATTTNNNNGCGGAGACATAAAATGTATTCGTCCCAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTTAGTGGAAACCCTGGGCGCATAAGAGATCTGTCCAAACTACCGCTTGGACTTACAGTTTAAAGCATGTGTACTGATGAAGTGACTGATGTTGATATGGCTTCTCGAACAGTTGAGAATATATCAGTCCTACAACTGATCTGAGAAAATCCAATCTCTGTCCTGCACT
  5   1   2       bld Thy                             IMAGE:8551263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAANNCCAAGTGNNNNGGGAGTATCGATTGAATTGTCCCGAAAGTCAAGAAGaaaaaaataaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAATTACCGCTTGGACCTTACACTTTAAGCACGTGTACTAGACGAAGTGACTGATGTCGATATGGGCTCTCCGAACAGTGAGAATATATCGTTCCTACAAGCGATCTGAGAAATCCAGACTCCTGTCTCGCACTGCCGACTGAGTCAATGCTAAATATGAAACATTGAAA
  5   1   2       bld Sp1       out                   IMAGE:4964479.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGAGAGCAGCCAGATCCAAGCACTCCCACACCAAAGAAGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTG
  5   1   2       bld FaBN                            IMAGE:8076357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGGAGAGCAGCCAGATCCAGCACTCCCACACCAAAGAGGATTAAGAAGAAAAAACTAAAAGAGGGCAAGGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAGCTGAAGGTTGCCTGTTTTTACGGAGAACACCATATCAACAGCAAGTTTTTGCCAGTTAAGATGGAATTGACTTCTTAGTTGGAACCCCCTGGCCGCATAAGAGATCCTGTCCAAAACTAGCAGCTTGGGACCTTACCGTTTTG
  5   1   2       bld Tail      in                    IMAGE:8542778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTTTNNNCCAAAGTTNNNNGCNGAGACATACATAGTATTCGTCCCaaaaaaaaaGTGAGCAAGGAAGATTCAGACTCACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAGCACGTGGTACTAGACGAAGTTGACATGATG
  5   1   2       bld Thy                             IMAGE:8549842.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAANNNCCCAGGTNNNTGAGTCCATGATTCGATTCGTCCCGAAAAATAAAAGAGAGCAAGGAAGATTCAGACCACAGGAAGAAGCAAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCACAACAAGTTTTTGCCTTAAAGATGGAATGACTCTTAGTCGGGACCCTGGCCTGTGAGAGATCTTGTCCAAATACCGCTTTGGACTACACTTAAGCCGTGTACTGACGAGTGACTGTGTCGAATGGCTCTCGACAGTGAGAAATATCGTCCTCAACTGACTGAGAATCCAATCCTGTCCGCATGCAATGAGTCATGTAATATGAACATGAATGCTTCGCAATCAGTCCTGTAGTGCTCTGCATCAGCCTGATTCGTCGACGACTCTGTATATCTCAG
  5   1   2       bld Kid                             IMAGE:4032220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAAGaaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAATTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCCGACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAAGAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACNATATGGCTAAAAATATATGAAGAAACAATTTGAAAAAAATGGACTTTGATCCGGCATAGAAATC
  5   1   2       bld Tbd7      in                         XL100j24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                aaaaaaataaaaGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGANNTAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACCCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCT
  5   1   2       bld Int2                            IMAGE:8526552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGAGCAAGGAAGATTCAGACACACAGGAAGAAGCAGAACAATCTGAACCACAAACGAATGGCGTGAAGAGCATTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCAAAATTACCGCTTGGACCTTACACTTTAAGCACGGGTACTAGACGAAGTGACTGATGTCGATATGGGCTCTCGAACAAAGTGAGAATAATATCGTCGCTCAAGCGATCTGAGAAATCCCGACCTCTGTCTCGCACTGCCGACTGAGTCAATGGTAAATATTAAACATTGAAATGATGTCGGTAATCAA
  5   1   2       bld Ov1                    IMAGE:6317866-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTgttaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacagaTACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGC
  5   1   2       bld Ga15      in                       XL469b18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGATTCNGATGCACAGGAAGAAACAGACATATCTGAACCNCNAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACNACAGGAGATGAACCNGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTC
  5   1   2       bld Sp1       out                   IMAGE:4964570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTtaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacaGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAAGGTGCCTGTTTTTACGGAAGGACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAAGTGGA
  5   1   2       bld Ov1                             IMAGE:6317866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGATTCAGATGCACAGGAAGAAACAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTtaaaaaatctaaaaagaacacaacaggagatgaaccagctcctaagaaaagaaaaacaGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAAGAAATCCCCAGACTCTCCTGGTCTCTGCAACATGTCCAGACTGGATGTACNACGTGGCTaaaaaatatatgagaaaacnatatgaaaaaaGTGACTTAGTTGGGACATAGAAGTCAGGAAGGCTGCCATCACTGGTTGAGCATTTTGGCCATTGGAGTGGCAACAGGGTCCCAGAAGGCCAGCCAGTCCTTGGGAAGAAATAATTTCCAGGGTGGGAACAGTGGGAAAGCCCCCGGAAA
  5   1   2       bld Lu1       in                    IMAGE:4674278.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCGTCCGACAGGAAGAACAGAACAATCTGAACCACAAACGATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAATTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGGGCCCAGCCCGTACAGGCACAGGAAAACATTCTCGTTTGCTATTTCTTTATGGGAGAGCCTA
  5   1   2       bld Thy                             IMAGE:8548501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATAAAANNNGGGAGAACCGATACGAATTCGTCCCCGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAGCTGATCCCTGAGAAATCCCAGACTCTCTTGTCTCTGCACATGCCAGACTGGATGTCATATGGCTAAAATATTGAGAAACATTTTGAAATGACTGTCGGCATGAGTCGAAGTGCACCTGTGACATTGCA
  5   1   2       bld Thy                             IMAGE:8551352.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTCATATTNNNNGNGAGTCATGATTCGATTCGTCCGAATGGCGTGAAGAGTGTTAAAAATCTAAAAAGAACCAACAGGAGATGAACCCAGCTCCCTAGAAAGAAAAACAGATACATCAGAGATCACTGCAGCCCATGAGTGTGAAGAAAAGGAGTTTAACCAAAGAGGAAGAAGGAATCAAGAAAAGAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGNTTTCCAATTCATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAANAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAATCAGTTTTTGCCATTTAGGATGGAATTGACTTCTTAGTTGGAACCCTGGCCGCATAAGAGATCTTGTCAAAACTACCGCTTGGACTTACAGTTTTAAGCATGTGGTACTGATGAAGTGACATGATGTTTGAATGGGCTTCTCCCGACAGTTGAGGAATATATCAGTCGCTACAACCTGATCTGAGAAATCCCAGATCTCTGTCTCTGCACTGTCAGATGATGTCACGTGCTAAAATTTGAGAACATTGAAAGTGACTGTGACTGAGTCGAGCTCTCTGTGAGCTGCATG
  5   1   2       bld Sp1       in                    IMAGE:4175613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAATCTGAACCACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGAACATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATAT
  5   1   2       bld Ga15      in                       XL423h22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGNACTCTCCTG
  5   1   2       bld Int2                            IMAGE:8527123.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGACATATCTGAACCACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTANCAACCTGATCCTGAAGAAAA
  5   1   2       bld Thy                             IMAGE:8551330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAAACGAATGGCGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAGTTGAGGAAATATATCGGGTCGCTCAAAGCTGATCTGAAGAAATCCCAGACTCTCTGTCTCTGCACATCCCAGACGGATGTACATATGCTAAAATAATGAGAAACATTTGAAATGACTGATCGCTANATCAAAGTGCACCTGTGACATTGCTCATGCCC
  5   1   2       bld Emb4                            IMAGE:5570609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAATGAATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTANAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAAGAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCCAGACTGGGATGTACAACGTGGGCTAAAAAATATATGAGAAANACCATATGAAAAAGTTTGACTTTATTTGGGACATAAGAAAGTCAGAAAAGCTGGCCATCACTGGTTGAGCATTTTGGCCCATTTGGAGTGC
  5   1   2       bld Panc                            IMAGE:8734825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTGAAGAGCGTTAAAAAATCTAAAAAGATCATAACAAGTGATGATAATGAACCAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCCAATTTCAGTCAAAAACCTTCCCCCACTGGCTTACAGGTGGCAAAAAAGGTTTTGGGCCCAGGCCCGTACAGGGCCCAGGGAAAAACTTTCCCCTTTTGCTATTTCCTTTAGGGGAAAAGCCAAAATGAAAAACCAACCCCCCTTTTGGTTAAGGGAAGGGGCCCCCAGGGGGGAAAACCCTTTcccccccccccaaaagttttcctttttcaatccccaaatggaacccccccccccccccttaaaccggggggggcccgggtttttttggggggAAACCCCTTTTCCCAAAAAATTTTTTCCCCTAAAAAAGGGAAttttttttttttttgggggaccccgggggggggaaaaatttttcaaaaaacggggtggggcccaaaaaattaaaccggggggtaaaaaaaaaaaaaaagagtgtataaggggcccccccaaaaaaaaagaaaaaTAAATTGTGTCCCCCCCGCGTATCTAGAGAAAAACACACTCTGTGTTTGTTCGTTGCGCCGCGAGAGTGTGTAGAGTGTAATATAAAAAGACATACAAAAATATTGTGCGCGCGCGCAAAAA
  5   1   2       bld Thy       in                    IMAGE:8546748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGGCGTGAAGAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAATATATGAGAAAACAATATGAAAAAGTTGACTAGTGGGACATAAGAAGTCAGACGCTGCCATCACTGTGAGCATTCGGCATGAGTGCACAGTCCAGAGGCAGCAGTCATGAGATATAGGTCAGGTGTAACAGTTGCAGCCCACGGAAAACCTAAT
  5   1   0       chi Neu7      in                         XL044b01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGGCCCTGTCTGCCTTTCTTTGGACACCACTCTAACAATCTGTGGGCTAACAGGGGTGAAATAAGAGTGGCACAGNAGATACTTGGAGTCTGCTGAATCCTTATACTATCAATATATGAAGGAGATTGGTAAACCGGCAATTGATCCTGATGAACATTTCTTCTCTGAAGAACAGACACTTACTGAGCAGGAAAGAACCAAACGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGCGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTACGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCACGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTA
  5   1   2       bld Emb4                            IMAGE:5515070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGACGCGTGGGCCCCTTGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTANCACGTGGCTAAAAATATATGAGAAACAATATGAAAAAGTGACTTAGTGGACTA
  5   1   2       bld Eye1                            IMAGE:4757257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGA
  5   1   2       bld Brn3                            IMAGE:8537724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACACAACAGGAGATGAACCAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTCCTGTCTCTGCACATGTCAGACTGGATGTACACGTGGCTAAAATATTGAGAAACATATGAAAGTGACTAGTTGACTAAAGTCGAGGTGCATCCTGTGACATTGCATGATGCACAGTCAGAGCACATCTTGAATATCAGTGCTGAACCGAAACTTC
  5   1   2       bld Int2      in                    IMAGE:8822359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTTTGAGGGATCTAATAAAACAAATTCGTCCCGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAACATTTGAAAAAATTGACTGATCGGGCATAGAAGTCAGAATGCTGCACACTGTGAGCATTGCATCGATGCACCGGATCCCAGATCACAGTCTGAGATTTAGTTCAGTGTACATTGAAGTCATAAAACCATCTCTTTGTGATCAATAGAAGCCTCCATTAGCCAAGCTTGGCTCATAATACAGCTCGGCTACTC
  5   1   2       bld Neu7      in                         XL044a20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATATCTGAACCACAAATGAATGGCGTGAAGNAGTGTTAAAAAATCTAAAAAGAACACAACAGGAGATGAACCAGCTCCTAAGNAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGT
  5   1   2       bld Lmb1                            IMAGE:8534632.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTTCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCGCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTTAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACGAGTTGAGGAATATTATCGGTCGCTACAAGCTGATCTGAAGAAATCCCAGACTCTCTGTTTCTGCACATGCAAGACTGATGGTCATATGCTAAAAATTATGAGAACATTGCAAAATGCTTATCGGCTAAATCAATGCTGCACCTGTGACATTGCATCAGGCCCATCTGAGGACGTCTGGAATATTAGGA
  5   1   2       bld Lmb1                            IMAGE:8535134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGATAATGAACCAGCTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCAGACTCTCTTGTCTCTGCACATGCCAGACTGGAGTACATATGCTAAAAATTATGAGAAACATTTTGAAAATGACTGATCGGCATAGAA
  5   1   2       bld Ga15                               XL469p05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGAGATGAACCAGCCTCCTAAGAAAAGAAAAACAGATACNTCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCNAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACNATATGAAAAAGTTGACTTAGTTGGACATAG
  5   1   2       bld Sp1       in                    IMAGE:4174442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAANAAGCTGAAAGTTGCCTGTTTTTACGGAGGAACACCATAT
  5   1   2       bld Brn1                            IMAGE:6953895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCTCCTAAGAAAAGAAAAACAGATACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAAGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGGTCCAGAGTGGATGTACAACGTGGGCTaaaaaaatatatggagaaaaacaatagtgaaaaaGTTGGAACTTAGTTGGGGACATAGAAAATCAGAAAAGGCTGGCCATTCACCTGGTTGGAAGCAATTTGGGGCCACTGTTGAATGGCCAAACAGGGGTCCCCCAGAAAAGGGGAAGCCAGGTCTCGCCTGTGGaaaaaataaaaaGAN
  5   1   2       bld Thy       in                    IMAGE:8546708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACTCCTAAGAAAAGAAAAACTGATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAATTGACTTGATCGGGCATAGAAGTCAGACGCTGCCACACTGTTGAGCATTTGGGCCATCGAGTGCACAGATCCAGACGCAGCAGTCCTTGGAGATTAGTCAGTGTACAGTGAGTCATGAAAACCATCATCTTGTGAATCCAATAGAGGCTCACACAAAGCCACAGCTGTGTGCCTCATA
  5   1   2       bld Sp1                             IMAGE:5512279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAACAGATACATCAGAGATCACTGCAGCCAATGAGTgtgaagaaaaggagttaaccaaagaggaagaggaaatcaagaaagaaaaaaTAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGTCACATGTCCAGACTGGATGTACAACGTGGCTAAAAATATATGAGAAAACATATGAAAAAGTGACTTAGTGGACATAGAATCAGAAGCTGCATCACTGTGAGCATTGGCCATGAGTGCACAGGTCCAGAAGC
  5   1   2       bld Bone                            IMAGE:8742933.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACAACGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTTCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTTAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGGAACTCCATATCAACAACAAGTTTTTGCCATTAAGATGGAATTGACTTCTTAGTCGGGACACTGGGCCGTGTGAGAGATCTTGTCCAAAATTACCGGCTTGGACCTTACACTTTAAAGCACCGTGGTACTAGACGAAGGTTGACATGATGTTTCGATATGGGCTTCTTCCGAACAAGTTGGAGGAATATTTATTCGGGTCGCTACAAGGCTGAATCCTGGAAGAAATTCCCGACTCTTCTTGGTTTCTTCGCACATGGCCGGACTGGAGTGTACAAATGGCTAAATATGGAAAAACATGAAAATGACTGTATCCGCGCTAAAGTTCAAGGTCCCACGTGTGACTGGATCATGACCAGTTCCGATGGACACTTGGAATTTACCTGTGCATGGGAATCCTGTGAC
  5   1   2       bld He1       in                    IMAGE:4407681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATCAGAGATCACTGCAGCCAATGAGTGTGAAGAAAAGGAGTTAACCAAAGAGGAAGAGGAAATCAAGAAAGAAAAAATAGATGGTGACTTCTCAAAATTTCCAATCTCCAAGGATACCATTAAGAATTTACAAGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCNTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGA
  5   1   2       chi Te2N                            IMAGE:7764269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGAGACAGCGTGTGGACGTCTCAGGAGACTCTGAGAGAGAGACTGCCTGCTGCAGTGTGCTGCCCCACCATGACTACGAGAACAATCTGTGGGCTAACAGGGGTGAAATAAGAGTGGCACAGAGATACTTGGAGTCTGCTGAATCCTTATACTATCAATATATGAAGGAGATTGGTAAACTGGCAATTGATCCTGATGAACATTTCTTCTCTGAAGAACAGACACTTACTGAGCAGGAAAGAACCAAACGCTAAAGGCGTGACCTATCTGTTTCCAATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGCGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTACGTTTTTGCCCTTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCACGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAANAAATATATGAGNACACATATGAAAAGTTGACTTAGTGGACATAGAGTCAGAAGCTGCATCACTGTGAGCATTGGNCATGAGTGCACAGGTCCAGAAGCA
  5   1   2       bld Em10                            IMAGE:8320379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAATCCCCAGACTCTCTTGTCTCTGCACATGCCAGACTGGATGTCATATGCTAAAAATAATGAGAAACATTNGAAAATGACTGATCGGCTAGAGTCAAAGTGCACACTGTGACATTGCATCATGCCAATCCAAAGACATCTGGAATATCAGGTCAGGATCTGAAACTCTTTGGATAATAACCACTACCACTTGCTA
  5   1   2       bld FaBN                            IMAGE:8076351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGATCACTACAGCCAAGGAGTGTGAAGAAAAGGTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAACAATTTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAA
  5   1   2       bld Thy                             IMAGE:8547613.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTATTATATTAAAGAATACAAACAAATACAAATTCGTCCCAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAATTGACTTGATCGGGCATAGAAGTCAGAGCTGCCACCACTGTTGAGCATTTGGCATCGAGTGCAACAGATCCCAGAATGCAGCAGTCCTTGGAGATTAGT
  5   1   2       bld Tail      in                    IMAGE:8541990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGAGCCATCGATATGAATTCGTCCCTGTTAACCAAAGAGGAACAGGAAATAAATCAAGAAAAAATAGACGGTGACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTTCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTTAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAATCCCCAGACTCTCTTGTTCTCTGCACATGCCCAGACTGGATGTACATATGGCTAAAAATATATGAGAAAACATTTGAAAAATTGACTGATCGGCATAGAGTCAGAAGCTGCCACACTGTGAGCATTGGCATCGATGCACAGATCCAGAGGCACATCTTTGAATTAGTCAGTGACGTGAGTCTGGAAACATACTTNGGATCAATAGAGCCACC
  5   1   2       bld Spl                             IMAGE:8460121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTTCTCTAAATTTCCACTTTCCAAGGAGACCATTAAGAATTTACAAGCTAAAGGAGTGAGCTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAANAAATATATGAGAAAACAATTTGAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTGAGCATTTGCCATCGAGTGCACAGATCCCAGAAGCAGCAGTCCTTGAGATTAGTTCNGTGTACGTGGAGTCATGAAAAACATCATCTTTGTGATCAAATTAGAGCTCACCATAGCACAGCTGTGCTC
  5   1   2       bld Lmb1      in                    IMAGE:8531919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAANNCCTGCGTCNGNGANGAGTACCAAATAATATCGTCCCTTCCCACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAGCTCACGAATTATCCACAACTGTGGATCATTAAACAGTCG
  5   1   2       bld FaB                             IMAGE:8072306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATCTGTTCCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGAATTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACATCATCTTTTGTGAT
  5   1   2       bld Int2                            IMAGE:8528316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATCTGTTCCAATTCAGTCAAAAACATTCCACACTGCTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAANAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTCAGGTGTACAGTGGAGTCATGGAAAACATCATCTTTGTGATTCAAATAGAGCTCACCATAGCACAGCTGTGCTCATAAACATC
  5   1   2       bld Lmb1                            IMAGE:8533901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGTTTCCATTCAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTCTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATATCTTTTGTGATTCAAANTTACAGCTCACGAATATCCACAACTGTGGATCATAAACAGTCTGCAAACCATACATGGGATCTCACAGAAGAAGGAAGTGTCTGAGGTTCAGCAG
  5   1   2       bld Thy       in                    IMAGE:8549126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCAGTCAAAACATTCCACACTGCTTACAGTGGCTAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGTGTACAGTGGAGTCATGGAAAACCTCATCTTTTGTGATCAAAATAGAGCTCACCTTAGCACAGCTGTGCTCATAAACAGTCTGCATCATACTGAGACTCACAGAAGAGGGATCTCTGAGGTCAGCAGACATGATCTATGCACAGTCACTGGACGATTCAATGACTGAATGCCTGCAGAT
  5   1   2       bld Te2                             IMAGE:7394110.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATCCAAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAACTATTATCTTTTGTGATTCAAATTACAGCTCACGAATATCCACAACTGTGGATCATTAACGTCTGCCAACATACATGGGATCTCAGCGAAGGAAGGGAGTGTCTGANGGTTCAGCAGGTACTTGAGTCTATGCACATGA
  5   1   2       bld Te2                             IMAGE:7394111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAATCCAAACATTCCACACTGTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAACTATTATCTTTTGTGATTCAAAATTACAGCTCACGAATTATCCACAACTGTGGATCATTAAACAGTCTGCCAACCATACATGGGATCTCAGCAGAAGAAGGGNAAGTGTCTGAGGTTCAGCAGGTA
  5   1   2       bld Lmb1      in                    IMAGE:8533238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTACAGTGGCAAAGATGTTGTGGTCCAGGCCCGTACAGGCACAGGGAAAACATTCTCGTTTGGTATTCCATTAGTGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAACTATTATCTTTTGTGATTCAAAATTACAGCTCACGAATATCCACAACTGTGGACATTAAACAGTCTGCCAACCATACATGGGATCTCAGCAGAAGAAGGGNAAGTGTCTGAGGTTCAGCAGGACATTTGAGTCTATGCGACATGACACTCTGACAAATTCAAGTG
  5   1   2       bld Brn1      in                    IMAGE:4740788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGGTCCAGGCCCGTACAGGCACAGGNGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGA
  5   1   2       bld FaB                             IMAGE:8070358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCGTACAGGCACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCA
  5   1   2       bld Gas2                                 3.1-2-c5.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGNNANGCTNTNTGGGAAATTCCCCACGAGATTCCTTTAGTGGANAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCC
  5   1   2       bld Ooc2                            IMAGE:3746442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAGAATGCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTATAAAATATATGAGACAACAATTTGAAAAATTG
  5   1   2       bld Ga18      in                       xlk52p02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGGGAAAACATTCTCGTTTGCTATTCCTTTAGTGGAGAAGCTAAATGAAGACCAACAGCCATTNNNNNAGGACGTGCACCTAGGGTGATAATCCTNCTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACNNNNNNACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATNCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGNNNCAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGNCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGNTCAGGNGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGNTCACACATTAGCCACAAGCTGNNNNNATTAAAACAGTCTGCCAANNCATTACATGGNG
  5   1   2       bld Int2      in                    IMAGE:8823059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTGGAAGGAAATAAAGGATAAAATCGTTTTCAAATTCGTCCCGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGAAAGGGAAGTCGTCTTGAAGGGTTTCAGCAGGAAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATGTACTCTGCACCAAAGAGCAGATGCTATGTCATCGCTCAGACGTACAGAGAGCGACGCCACAGCGTCTGTATATCCCTTATGGACATGGAAAGCATTATCTCAGAATGTGAAGAGACACGAATTCCAATCCAACGTGTTGAAGTACCTTTCCTATATG
  5   1   2       bld Ga15      in                       XL418h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGAGGCTAAGTGAAGACCAGCAGCCGTTGGCTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTANATATCCCAGAAGTTGACCT
  5   1   2       bld Spl       in                    IMAGE:8463764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCANG
  3  -1   2       bld Sp1                             IMAGE:4965617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAATGAAGACCAACAGCCATTGGCTAGAGGACGTGCACCTAGGGTGATAATCCTTACTCCAACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCAATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCAT
  5   1   2       bld Ga18      in                      xlk144o06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCAGCCGTTGGTAGAGGACGGGCACCTAGGGTAATAATCCTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGNCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAANNNTTGAAGTCTTNTTNCNACNAATGTAGCAGCTCGNG
  5   1   2       bld Lmb1                            IMAGE:8536375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAGGGTGATAATCCTTACTCCACCAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCACAGAANGAAGGGAGTCGTNCTGANGGTTTCNGCAGGAACATTGAAAGTCTATGCACNATGTGCACTCGTGACTAATATCCAGAGTGACTGTATATGACTCGCCAANGAGCAATCTAGTCTCCTAGACTCAGAGAGCGCCCAGCTCGTATCCTAGACTGGAAGTACCNGAGTGAGACAGATCTCACGTGAA
  5   1   2       bld Int2                            IMAGE:8529696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTACTCCTACCAGAGAGCTAGCTATTCAGATAACAAATGAACTCCGCAGCATGACTAAAAAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAANGAAGCAGA
  5   1   2       bld Sp1                             IMAGE:5512690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAGCAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGAAAGTCATGGAAAAACCATCATCTTTTGTGATTCACAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACGGTCTGCCAGATCATTACATGGAGACCTCCAACAGAATGAAAGGGAAGTCGTACTTGAGCGCTTCANGCATGGAACATTTGAAGTTCTTACTGCCACCNATGTTGCAGCTCGTGGACTAGATATACTAGAACGTGACCTTGTAGTATTGTACTCTGCACCAGAGGAGCGGATGCGTATGTCATCGCTCAGACGTAAAGAA
  5   1   2       chi Sp1                             IMAGE:5435344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAGAGTTAGCTATTCAAATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAANAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAAGCTGCCACCCACTGTGAGCATTTGGCATCGAGTGCACAGATCCCAAAGGCAGCAGTCCTTGAGATTTAGTTCGGTGTACGGTGAAGTCATGAAAAACCTCATCTTTGGGGATCAAAATAAAACCTCCCCCTTGCCCCAACTTGGGTCCTTAACAGACTGGCAATTTTTCTGGGGAACCCCCCAAAAGAAGGGAATCCCTTTTAGGGTTTCGGGGGAACttttaatttttttCCCCCAGGACCCCTCGAAAAAATCCCAAATTTCCttttttttttcccccaaaaaaaaattttttttCCCGAGAAG
  5   1   2       bld Emb4                            IMAGE:4683737.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATCACAAATGAAATCCGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCAATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCANGACGTACAGGGAAGAGCCGNGACGCACANGGCGTCTGTATATCCCCCTTTATGAACCATGGGGAAAAGGCATTTTATCTCAGGNAATTGTGGGA
  5   1   2       bld Tail                            IMAGE:8545559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTGCGTGNNGNGNNGAGTACTACAAATATTCGTCCGTTGCCTGTTTTTCGGAGGAACCCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTCGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAATTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCCAAGGAAGCAGATGCTTATGTTCA
  5   1   2       bld Lmb1                            IMAGE:8534515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GNGGAGTACCTATATAAAATTCGTCCCGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCAATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCCACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACTTTGTAGTATTGTACTCTGCACCAAGGGAGCAGATGCTTATGTTCATCGCTCAGGACGTACGGAAGAGCCGAACCACAGCGTCTGTTTTCCCTTATGATCATGGGAAAGCTTATCTCAGATGTGAAAGGCCACGGATC
  5   1   2       bld Ov1       in                    IMAGE:5047429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCAGCATCATTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCC
  5   1   2       bld Lmb1                            IMAGE:8534186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCTCTCTCTGNAGNGAAGAGACTTATATAAATTCGNCCGAGGAACTCATATCACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAATAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTTGAAGGTTCAGGCAGGTAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGATGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCTCAGGCGTCTGTTA
  5   1   2       bld Thy                             IMAGE:8548643.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAGCATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACTTGTAGTATGTACTCTGCACAAAGGAGCAGATGCTATGTTCTCGCTCAGACGTCAGGAGAGCCGACGCACAGCTCTGTTTCCTTATGACATGGAAGGCTATCTCAGATGTGAAGACACGATCCATCAC
  5   1   2       bld Bone      in                    IMAGE:8739161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCACTAAAAAGCTGAAGGTCTCGTGTTTTTACGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCAATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAATGAAAGGGAAGTCGTCTTGAAAGGTTTCAGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGACTAGATATCCCAGAAGTTGACCTTGTAGTATGTACTCTGCACCAAGAAGCAGATGCTATGTCATCGCTCAGACGTACAGAGAGCGACGCACAGGCGTCTGTATATCCCTTTATGACATGGGAAAGGCATTATCTCAGGATGTGGGAAAGGAGCCAGGAATCATCAACAGTGGATACTTCTATGACGTGCAATATCATGCTGTGATGCCATAAAGGTCCTG
  5   1   2       bld He1       in                    IMAGE:4409320.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGCTGAAGGTTGCCTGTTTTTACGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAAC
  5   1   2       bld Ov1       in                    IMAGE:8328036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTGCCTGTTTTTACGGAGGAACACCATATCAACAGCAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATG
  5   1   2       bld Tail                            IMAGE:8545951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGTTTTTCGGAGGAACTCCATATCAACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATGTACTCTGCACCAAAGGAGCAGATGCTTATGTCATCGCTCNGACGTACNAGAGAGCCGACGCACAGCGTCTGTTATCCTTATGAACATGGAAGGCATATCTCAGATGTGAGAGACACGGATCACATCACGTGTGAGTACTCTATGATGTGCATCTCATGCGA
  5   1   2       bld Thy       in                    IMAGE:8549222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGTTTTTCGGAGGAACTCCATATCAACAACCATTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTGACCTTGTAGTATTGTACTCTGCACCAAAGAGCAGATGCTTATGTCATCGCTCAGACGTCAGGAGAGCCGACCACAGCTCTGTATATCCTTTGACATGGAAAGATACTCGGATGTGAAGACCGGATAATCACTGTGATACTCTATGAGTGCATCTCGGCGAGATAGCTGACGTCGCAGATGAATAGATGCGATTG
  5   1   2       bld Tad1      in                    IMAGE:6880813.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAGGAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGCTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGGAGGGTTTCAGGCAGGNAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGNACGCACAGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCC
  5   1   2       bld Lmb1                            IMAGE:8534719.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACACCATATCAACAACAAGTTTTTGCCATTAAGGATGGAATTGACTTCTTAGTTGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAGGGAGCAGATGCTTATGTTCTCGATCAGACGTACAGGAAGAGCTGACGCACAGTGTCTGCTATCCTTATGAACATGGAAAAGCTTATCTCAGATGTGAGAGACCAGGGATCCATTCACGTGTGGATACTCTCTAAGAGTCCCATCTCATGCT
  5   1   2       bld Tail                            IMAGE:8545117.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACAACAAGTTTTTGCCATTAAAGATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGACGCACGGCGTCTGTTATCCCTTATGATCATGGGAGGCATATCTCAGATGTGAGAGAGCCGGATCCATCAACGTGTGAGTACTCTATGATTGCNATCTCATGCGAGCATAGTCTGATCGTCGCGAGAA
  5   1   2       bld Ov1       in                    IMAGE:8329085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAG
  5   1   2       bld Lmb1      in                    IMAGE:8533225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGAATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTAATGAACATGGGNAGGCATTATCTCAGGAATGTGAGAGAGCACGGAATCCATTCAACGTGTTGGATACTTTCTAATGATGTGCACATCT
  5   1   2       bld Emb4                            IMAGE:5572750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTGACTTCTTAGTCGGGACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATTATCCCAGAAGTTGACCCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAAATGTGGAGAGGAGCACGGGAATCACATTCAAACGGTGTTGGGAGTACCTTCCCTTATTGNAATGTTGCCCAAATCATCCCAGTGCTGNATGCAATAAAGTCCCTTGGATACAGTTCCCGCCTGAGGTAATTTGAGCATTTTTTTAGAATATGCCCCGGAAACTGGATTGG
  5   1   2       chi Tad1      in                    IMAGE:6878620.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGAACCCCTGGCCGCATAAGAGATCTTGTCCAAAACTACCGCTTGGACCTTACAGTTTTAAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACCGTTCTGCCCAACCATTACATGGGGGATCTCCCCCGCAAAAGGAAAGGGGAAGTTGTCCTTGAAGGGTTTCAGGCAAGGGAAACATTTGAAAGTTCTTATTTGCCGACCAATGTAGCAGCTTCGTGGGACTAGCATATTCCCAGAAGGTTGAACCTTGTAAGTATTGGTAACTCTGCACCCAAAGGGAAGCACATGCCTTAACGCTTCATCGGGTTCCAGGACGTACCGGGAAAGAGCTTGGAACGCAACGGGTGGTTTTGCATTATCCCCTTTTATGAAATCCTTGGGGGAAAAAGCCATTTTTCTTCCAGGAAATGTTTGAAAATGGATTTCCGGGGAAN
  5   1   2       bld Tbd2      in                    IMAGE:3201328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACACCTGGCCGTGTGAGAGATCTTGTCCAAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCATGACGTACATGAAGAGCCCGACGCACG
  5   1   2       bld Thy       in                    IMAGE:8550551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGCCGTGTGAGAGATCTTGTCCAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACAAAAGGAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACCACAGGCGTCTGTTATCCTTTATGAACATGGAAAGGCTTTCTCCAGATGTGGAAGGACACGGAATCCATTCAACGTGTGGATACTTCTTTTGATGTGCAATCATCATGCGATCAAAGTCTTGAACGTCCCTGAGATTGACTTTAGAATGCCGAACGTGAGAA
  5   1   2       bld Thy                             IMAGE:8547103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGATCTTGTCCAAATTACCGCTTGGACCTTACAACTTTAAAGCACGTGGTACTAGACGAAGTTGACATGATGTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGACCCATGGAAGGCATTTCTCAGGATGTGGAGAGAGCACAGAATACATTCAACGTGTTGAGTACTTCNTNNATGATGTGCNATCATCAGTGTGAGCATAAGTCCTGATCAGTCACTGAGTATGAGCTTTNAGATTGCCAGACTGATGACGAGTGCTACGCTACGCGTTAGCCCATCTGGCATCATACAG
  5   1   2       bld Thy                             IMAGE:8549937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTTTAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCGATGCTTATGTTCATCGATCGGACTACAGGAAGACTGGACCACAGTGTCTGCTATCCTTTAGACCATGGAAAGCTTACTCAGATGTGAGAGACACGGATCCATCAACGTGTGATACTTCTATGATGTCCATCTCATGTGACATAATCTGATCGTCACTGAGATGACTTAGACGCAGACGATGAAAGGCTATGCACTCCTATATCTGCATCTACCTTGTATGACGATATATAACTACCATT
  5   1   2       bld Int2                            IMAGE:8529423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTTAAGCATGTGGTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAACGTGTGGNAATACCTTCCTTATGAATGTCGCCAATCATCCATGCTGATGCATAAATCATTGATACAGTTCAGCTA
  5   1   2       bld Spl                             IMAGE:8462829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACTTGATGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGACAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGAATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAACGTGTTGGATACCTTCCTNATGATGTCGCAAATCATCAGTGCGATGCATAAGTCATGGATACAGTCACTGATGTATGACATTTAAGATACGCCAGAGCTATGAAAGAGGTGCTACTGCTACTCACTTACTACTTCTGGCACTCTACACATCTGTAAG
  5   1   2       bld Li1       in                    IMAGE:3396584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGTTGACATGATGTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACANTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAAGAAGCAGATGCTTATGTTCATCGGTCATGACGTACAAGAAGAGCTGGACCGACAGGTGTCTGCATATTCCTTTATGAA
  5   1   2       bld Sp1       in                    IMAGE:4175654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGCGTCCGCCCACGCGTCCGATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATC
  5   1   2       bld Lmb1                            IMAGE:8535043.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAGTACTACTTAATATCGTCCCTCCGAAAAGTTGAGGAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCANGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTATTGAATGTTGCCAATCATCCAGTGCTGATGCAATAAAGTCTTGGATACAGTTCCAGCTGATGTAATTGACTTTTAAAGATT
  5   1   2       bld Neu4                            IMAGE:4084113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGCTGACTTACCTGGACATACAATTCAGAAAGCTGCCATCACTGTTGACCATTTGGCCATTGAGTGCAACAGGTCCCACAAGGCAGCAGTCCTTGGAGATATACTTCACGTGTACAGAGGAAGCCACGGAAAAACTATTATCTTTTGCGATTCAAAATTACAAACTCACCAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAACAGAATGAAACGGAAGTTGTCTTGAAGGGTCTCATGCCGGGAACATTTCAAGTTCTTATTGCGACCAATGTACCAGCTCGTGGACTAGATATCCCGGAAGTTGACCTTGTACTATTGTACTCTGCACCA
  3   1   2       chi Neu7      in                         XL044b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAAATATATGAGACAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGCTCATTAAAACAGGGTGTGTGTTTTGATGTCCGTTCTGAAAACTTGCTGTCAATGCAGGAGAGCTGGTCAGATACAAGGCGGTGGCAATTTACAATCACAATTGAATTACCCGCAATTCAAGAATCTGAGAAAAGCTTTGATGGAGGAACAGAAGTTTTGGAGGAAGAGGGAGGAGACCTTTTGACAGAAGAAATAATTCCAGAAATTCATCGGGCAGAGGAGGAGGAGGAAGACGACAAGGCAGAAGTGGAGGATTTAGAAGGGGCCGTTAGTGGCTCCAAACATCCCAACTTTTTTAATACACCGCCATGTTCATATATATTCCTTCTTAAAGTAACTTAAGACATATTATATGCAATATAAAAC
  5   1   2       bld Thy                             IMAGE:8548541.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAATCATCCAGTGCTGATGCAATAAGTCCTTGGATACAGTCCAGCTGATGTAATTGACATTTTAAGATATGCCAGAACTGATGACAGAGGTGCATACTGCATACTGCTGCTAGCTCAATCTGGGCACTCAT
  5   1   2       bld Skin      in                    IMAGE:8641223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCGATATGGGCTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCTTATTGAATGTGCCAATCATCCAGTGCTGAATGCATAAGTCCTTGGAACAGTCCAGCTGATGTATTGAACATTTAAGAT
  5   1   2       bld Int2                            IMAGE:8531332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCTCCGAACAAGTTGAGGAAATATTATCGGTTCGCTACAAAGCTGATCCTGAAGAAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCAATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTNCAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGAATGCATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTAAAGATATGCCCAGNAACTGATGACAGAAGGTGCTTTACTGCCTAGCTGCTGCTAGCTCAATTCTGG
  5   1   2       bld Lu1                             IMAGE:4633144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGTCGACCCACGCCCGTCCGAAACCTGGNATCCTGAATAAAATCCCCANACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTNAAAAANATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTGAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGNGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTA
  5   1   2       bld Lmb1      in                    IMAGE:8531519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAANNCNCCTCATACGTNNNNNGCGAGTCCTAAATTGNATTCGTCCCGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAA
  5   1   2       bld Emb1                            IMAGE:5156864.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGTTCGCTACAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGGCGACGTCCATTTAACAGCGATCTTTGCTCAACATGGGAGCGGGGCTACCTGGACGATAACATTGGAAAAGCTCAGAACCCATTCCCAACCTTAAGCTATGCCATGGCGATCCATTTAAG
  5   1   2       bld Lmb1                            IMAGE:8535077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTCGCTAAAACCTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAATTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCNAATCATCCAGTGCTGATGNCATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAGAATACGCCCAGGAGCTGATTGAGAGAANGGTGCATTNACTGCCTAGCTGCA
  5   1   2       bld Bone                            IMAGE:8742886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGATCCTGAAGAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGACGTACAGGAAGAGCTGGACGCACAGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGAATGTGGAGAGGAGCACGGGATCACATTCAAACGTGTTGGATACCTTCCTTAATGATGTCGCAATCATCAGTGCTGATGCAATAAAGTCATGATACAGTCAGCTGATGTATTGAGCATTTTAAGAATACGCCAAGAGCTGATTGGAAAGAGTGCATACTGCTAGCCTGCACTTTAGCTCAATCGTCGGTCATAACCGAATCTTGTCTCACATGGAAGCGGCTTATTT
  5   1   2       bld Spl       in                    IMAGE:8463573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAATCCCCAGACTCTCCTGTTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGC
  5   1   2       bld Tail      in                    IMAGE:8542620.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAATCCCCAGACTCTCTTGTTCTCTGCAACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAAGAATATGCCCAGGAACTGATTGAACAGAAGGGTGCATTA
  5   1   2       bld Ga15                               XL518k09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTCTGCAACATGTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGATCTTT
  5   1   2       bld Te2                             IMAGE:7393964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTGCACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCAATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCTTATCTCAGGAATGTGGAGAGGAGCACAGGAATCCATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCAAATCTCCAGTGCTGAGCAATAAAGCCTTGGAACAGTCCACTGATGTAATGACATTTTAAGATATGCCAGGACTGATGACAGAGGTGCATACTGCATACTGCGCTTACCACTTCTGGGCACTCATAACACCTCTGTC
  5   1   2       bld Lmb1                            IMAGE:8534551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGCACATGCCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGAATGCATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAGAATATGCCCAGAACTGATTGACAGAAGGGTGCATACTGCATAGCTGCTGCTTAGCTCCATTCTGGGCGACTCATAACACGCTCTTGCTCACTGAGCGGGTACAACTTACATGAGAGTATACTATCCGCTAGCAGCTGCATCATAGA
  5   1   2       bld Tail      in                    IMAGE:8543126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCAGACTGGATGTACAACGTGGCTAAAAAATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGTGCATTACTGCCTAGCTGCAGTTTAGCTCACATATCTGGGGCACGTCATTAACAGCGATCTTGCTCACATGAAGCGGCTACTGACATACATTGAGACTCATACCATCACACTAGCTTGCTGCGTCATTAGACACTGGTGGATGCATCTAATCTAAA
  5   1   2       bld Te2N                            IMAGE:7206118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAGACTGGATGTACAATATGGCTAAAAAATATATGAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATATGCCCAGGAACTGATTGAAAAGAAGGGTGCATTAACTGCCATAGCTGCTGCTTTAGCTCACATTTCTGGGGGCGACGTCCATTTAACAGCGCTCTTTGCTCAACATGGAAGCGGGTTACGAGACTATAACATTGAAGAAGTCAGTACCTATTCACANGCTAAAGCTATGCTTTGGGCATCCATTAAAAAACAACGTGGGGTGGATGATGGTGATTCCCAA
  5   1   2       bld Tad2                            IMAGE:6931664.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGATGTACAATATGGCTaaaaaatatatgacaaaacaatttgaaaaaaTTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCGGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATATGCCCAGGAACTGATTGNAAAAGAAGGGTGNNCATTAACTGCCCATAAGCTGCTGCTTTAGGCTCACATTTTTCTGGGGGGCCGACGNTCN
  5   1   2       bld Tad1                            IMAGE:6939612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATATATGAGAAAACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTTCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTTCAGCTGATGTAAATTGAGCATTTTAAAGAATACCCCCCAGGAGCTGATTTGAGAAGAAAGGGTGCATTTAACTGCCCCCTAGCTGCAAGCTTTAGGCTCACATTATCTGGGGGCGCACGNTCCCATTTAAAACAAGCGAATCCTTTTGCCTCAAACCATGGGAAAGCGGGGCCTTACCAT
  5   1   2       bld Brn2                             Brn2-za34e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAAAACAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCT
  5   1   2       bld Ga15      in                       XL489f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACAATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTANCTGCAGCCTTTANCCTCACATAT
  5   1   2       bld Sp1                             IMAGE:4965222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATTTGAAAAAATTGACTTGATCGGGCATAGAAGTCAGAAGGCTGCCACCACTGTTGAGCATTTGGCCATCGAGTGCACCAGATCCCAGAAGGCAGCAGTCCTTGGAGATTTAGTTCAGGTGTACAGTGGAAGTCATGGAAAAACCATCATCTTTTGTGATTCAAAATTAGAAGCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAAGAATATGCCCAGGAACTGATTGAACAGAAGGGTGCATTAACTGCCATAGCTGCTGCTTTAGCTCACATTTCTGGGGCGACGTCCATTANACAGCGCTCTTTGCTCACATGGAAGCGGGTACGAGACTATACATTGAAGAGTCAGTACTATTCCAGCTTAGCATGCTGGCATCATAAAGACACTGGTGATATGTGA
  5   1   2       bld Lmb1                            IMAGE:8534999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACATNNNNCCCCACTGTTNNNAAAGAGAACTACATAATATTCGTCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGATCTTTGCTCAACATGGAAGCGGGCTACTTGACGAATACATTGAAGAGCTCAGTACCCATTCACAACTTAAGCTATG
  5   1   2       bld Neu7      in                         XL005p03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATATGAAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAA
  3  -1   2       bld Bla2      in                    IMAGE:7297089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAGTTGACTTAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATACCTTGGGGCGACGTCATTTAAACAGCGATCT
  5   1   2       bld Lmb1                            IMAGE:8534488.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGGAGTACCTATATAAAATTCGTCCCCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGTACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCNATTTACTGCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCCACGTCCATAAACAGCGATCTTTGCTCACATGGAAGCGGGCTAATGACGATACATTGAAGACTCANTACCCATCACACTTAAGCTTGCATGCGATCGATTAGGACAACTGGTGAGATTCGATCTAAATCATAGATGTGCACTAAGATTCTGGTGGGGTTGATGCGT
  5  -1   2       bld Bla2                            IMAGE:7299635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           NCGTACTAGATTGAGTAAGAATTTNAATCAGACCNTNNTTCAGCGGGTCATGTAATTGGACATGAAATGTGTCGATGATCGAGCTCCCCTGTGGCTTGCATGAGCACAATCCAGAGCACGTCTGGATTTGTCAGGTTACGTGAGTCATGAAACCTCCTTTTTTGATCAAAATAGAGTCACACCTAGCACAGTGGTGGTCATAAACAGTCTGCAAATCATACATGGGACTNCAACAGANGAAAGGGAGTCGTCTTGAGGNTTTCAGCAGGGAACATTGAAGTTCTATTGCCACCAATGTTGCAGCTCGTGGACTAGATATCCAGAAAGTTGACCTGNTAGTATGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAAGAATATGCCCAGGAACTGATTGAACAGAAGGGTGCATTAACTGCCATAGCTGCTGCTTTAGCTCACATTTCTGGGGCGACGTCCATTAAACAGCGCTCTTTGCTCAACATGGAAGCGGGTTACGAGACTATAACATTGAAGAGTTCAGTACCTATTCACAGCTTAAGCTATGCTTGGCAATCCATTAAAGAACAACTGGGTGATGATGTTGATTCCAAAATCCATAGAATGTGTCTACTCAAGGACTCCATGGGGGTGTGTTTTGATGTTCGTTCAGAAAACCTGGAATCAATGCAGGAGCGCTGGACAGATACAAAACAGTGGCAGTTTACAGTTGCAACTGAACTACCCGCAATTCAAGAATCTGAGAGAAACTTTGATGGACCAAGGAATAGAGGTTTTGGCGGAAGAGGGAGGAGACCTTTTGACAGAAGAAATAATTCCAGAAATTCAAACCGAGGAGGCGGAGGAAGAGGCAGGAATAGAAATGGGGGGTTTAGAAGGGGCCGTTAGTGACTCCGAACATGCCAATTCAGATTAACTTTTTCAATACTTCCTAAAGTAACTGAAGACATATTTTTATGCAATATACAAATTAAAAGCTaaaaagaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCCATAGAGATTN
  5   1   2       bld Tbd1                                 AW765172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCCAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCA
  5   1   2       bld Brn3                            IMAGE:8541298.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGCTCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCCACGTCCATTAAACAGCGATCTTTGCTCACATGGAAGCGGGCTACATNGACATACATTGAAGACTCAGTACCATTTCACACTTAGCATGCATGCGATCATTAAGAACACTGGTGAGATGCGATCTAATCC
  5   1   2       bld Tad1                            IMAGE:6938385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGACATAGAAGTCAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAAAAGGAGCACGGGAATCACATTCCAACGTGTTGGAAAACCTTCCCTTAATGAATGTCCCCAAATCATCCAGTGCTGAATGCAATAAAGTCATTGGGATACAGTTCCCAGCTGAATGTAAATTGAAGCATTTTAAAAAATTACGCCCCGGAAACCTGAATTGGaaaaaaaaGGGTGCCATTAAACTGGCCCTAGCCTGCAGCTTCTTAACTCACAATATCCTGGGGGGCAAACCTTCCATTTAAACCGCCGATTTTTTTGCCCTCAAAATTGGAAAGCCGGGCCTTCATTGGAACCAATAAACACTTTAAAGAAGCCTCCAATTACCCCATTTCTCACAAGTTTTAA
  5   1   2       bld Ga12      in                         XL151g22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGGCTGCCATCACTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAANGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGGCGACGTC
  5   1   2       bld Lmb1      in                    IMAGE:8532320.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTTGAGCATTTGGCCATTGAGTGCAACAGGTCCCAGAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAATTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATAAACAGCGATCTTTGCTCACATGGAGCGGGCTACATGACATAACATTGAGAGCTCAGTACCATCACACTTAGCTATGCATGCGATCATAAGACACTGGTGAGATGAATCTAATCATGATGGCACAAGATCATGTGTGGTTGAGCGTCTGAATGATCATGAGAACGCGACAGCGGATCATCACATCGATAATCAATAGTCGACATGGAGGAT
  5   1   2       chi Kid                             IMAGE:7010957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGCTTTTAATTTGTATATTGCATAAAAATATGTCTTCAGTTACTTTAGGAAGTATTGAAAAAGTTAATCTGAATTGGCATGTTCGGAGTCACTAACGGCCCCTTCTAAACCCCCCATTTCTATTCCTGCCTCTTCCTCCGCCTCCTCGGTTTGAATTTCTGGAATTATTTCTTCTGTCAAAAGGTCTCCTCCCTCTTCCGCCAAAACCTCTATTCCTTGGGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAAGAATATGCCCAGGAACTGATTGAACAGAAGGGTGCATTAACTGCCATACCTGCTGCTTCTACTCACATTTCTGGGGCGACGTCCATGAAACAGCGCTCTTTGCTAACATGTAAGCGGGTTGCGTGACTATCACAGTGAAGACTTCAGTACCTATTCCCCGATTAGCTACGCCTGGCGATCCATTAAA
  5   1   2       bld Lmb1      in                    IMAGE:8532327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGGCAGCAGTCCTTGGAGATATAGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAATTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGATCTTTGCTCACATGGAAGCGGGCTACATGAAATAACATTGAGAGCTCAGTACCCTTCACACTTAGCTATGCATGCGATCATTAAGACACTGGTGAGATGAGATCTAATCATGATGGTCACTAGGATCATGGTGGGTTTGAGCGTCGAGATGCTCATGAGAACTGCGATCAGCGTGCATACACCACGATACGATCAATCAGACTGAGCAGACATTGAGAAGGAC
  5   1   2       bld Kid                             IMAGE:7010229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGACGCGTGGGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTANACAGCGATCTTTGCTCAACATGGAAGCGGGCTACATGACGATAACATTGAAGAGCTCAGTACCCATTCACAAACTTAGCTATGCATGGCGATCAATTTAAGAACACTGGGTGAAGATGTCGATTCTAAATCCATAAATGTGTCTACTAAGGAT
  5   1   2       bld Ga15      in                       XL447k16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCGGTTCAGGTGTACAGTGGAAGCCACGGAAAAACTATTATCTTTTGTGATTCNAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGGTCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCCACGTCCATTAAACAGCGATCTTTGCTCAACATGGAAGCGGGCTACATGACAATAACATTGAAGAGCTCAGTACCCATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAAGATGTCGATTCTAAAATCCATAGAATGTGTCTACT
  5   1   2       bld Thy                             IMAGE:8547692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTATTTTTTTAAGGGGAAACAACAATTCGAATTCGTCCCGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGATCTTTGCTCAACATGGAAGCGGGCTACATGACGATAACATTGAAGAGCTCAGTACCCATTCACAACTTAAGCTATGCATGGCGATCAATTAAAGAACAACTGGGTGAGATGTCGATTCTAAATCCATAGAATGTGTCTACTAAAGGATTCCATGGGTGTGTGTTTTGATGTCCGTTCTGAAGACTTGCAGTCAATGCAGGAGAGCTGGA
  5   1   2       bld Tad1      in                    IMAGE:6880660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGTGGAAGCCACNGGAAAAACTATTATCTTTTGTGATTCAAAATTACAAGCTCACGAATTATCCACAAACTGTGGATCATTAAAACAGTCTGCCAAACCATTACATGGGGATCTCCAGCAGAAGGAAAGGGAAGTTGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCGACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGATCAGGACGTACAGGAAGAGCTGGACGCACAGGTGTCTGCATATCCCTTTATGAACCATGGGAAAAGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAATACCTTCCTTAATGAATGTCGCCAAATCATCCAGTGCTGATGCAATAAAGTCATTGGATACAGTTCCAGCTGATGTAATTGAGCATTTTAAAGAATACGCCCAGGAGCTGATTGAGAAGAAGGGTGCATTAACTGCCCTAGCTGCAGCTTTAGCTCACATATCTGGGGCGACGTCCATTAAACAGCGATCTTTGCTNCACATGGAAGCGGGCTACATGACGATTACATTTGAAGAGCTCAGTACCCATTCACAAACTTAAGCTATGCATGGCGATCAATTTAAAGACANACTGGGGTGAGATGTCGATTCTAAAAATCCATAGGAATGTGGTCTACTAAAAGGATTCCATGGGGTGTGGTGTTTTTGAATGTCCCGGTTCTGAAAGACCTGCC
  5   1   2       bld Brn3                            IMAGE:8537269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATNNTNNCCACTTCANNGAAGATCATCAATAAAATTCGTCCCCTCACACATTAGCCACAAGCTGTGGCTCATTAAAACAGTCTGCCAAATCATTACATGGAGACCTCCAACAGAAGGAAAGGGAAGTCGTCTTGAAGGGTTTCAGGCAGGGAACATTTGAAGTTCTTATTGCCACCAATGTAGCAGCTCGTGGACTAGATATCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGAGCCGGACGCACAGGCGTCTGTATATCCCTTTATGAACCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAAGAATATGCCCAGGAACTGATTGAACAGAAGGGTGCATTAACTGCCATAGCTGCTGCTTTAGCTCACATTTCTGGGGCGACGTCCATTAAACAGCGCTCTTTGCTCAACATGGAAGCGGGTTACGAGACTATAACATTGAAGAGTTCAGTACCTATTCACAGCTTAAGCTATGCTTGGCAATCCATTAAAGAACAACTGGGTGATGATGTTGATTCCAAATCATAGAATGTGTCTACTCAGGACTCATGGGGTGTGTTTGATGTCGTCAGAAACTGGATCATGCAGACGCTGACGATACAACATGCAGTTACGTGCACTGACACCGCATCAGATCTAAGACTTATGACAGATAAGTTGCGAGAGAGACTTTCGAAAAATCGATCACAGAGGAGAACGAAAATGGTAAGCTAGC
  3   1   2       bld Ga18 5g3  in                       xlk64g02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTCATGNNANNCCANCNTNNTTTNGNGNTCAAANTTAGNAGCTCACACNTTANCNACAAGCTGTNGCTCATTAANNANTCTGCCAAATCATTACATGGAGNCCTCNAACAGANGGAAAGGGAAGTCGTCTTGAAGGNTTTCAGGCAGGGAACATTTGAAGTTCTTATTNNCNCCAATGTAGCAGCTCGTGGACTAGATNTCCCAGAAGTTGACCTTGTAGTATTGTACTCTGCACCAAAGGAAGCAGATGCTTATGTTCATCGCTCAGGACGTACAGGAAGANCCGNNCGNACAGGCGTCTGTATATCCCTTTATGANCCATGGGAAAGGCATTATCTCAGGAATGTGGAGAGGAGCACGGGAATCACATTCAAACGTGTTGGAGTACCTTCCTTATTGAATGTTGCCAAATCATCCAGTGCTGATGCAATAAAGTCCTTGGATACAGTTCCAGCTGATGTAATTGAACATTTTAAAGAATATGCCCAGGAACTGATTGAACAGAAGGGTGCATTAACTGCCATAGCTGCTGCTTTAGCTCACATTTCTGGGGCGACGTCCATTAAACAGCGCTCTTTGCTCAACATGGAAGCGGGTTGCGTGACTATAACATTGAAGAGTTCAGTACCTATTCACAGCTTAAGCTATGCTTGGCAATCCATTAAAGAACAACTGGGTGATGATGTTGATTCCAAAATCCATAGAATGTGTCTACTCAAGGACTCCATGGGGGTGTGTTTTGATGTTCGTTCAGAAAACCTGGAATCAATGCAGGAGCGCTGGACAGATACAAAACAGTGGCAGTTTACAGTTGCAACTGAACTACCCGCAATTCAAGAATCTGAGAGAAACTTTGATGGACCAAGGAATAGAGGTTTTGGCGGAAGAGGGAGGAGACCTTTTGACAGAAGAAATAATTCCAGAAATTCAAACCGAGGAGGCGGAGGAAGAGGCAGGAATAGAAATGGGGGGTTTAGAAGGGGCCGTTAGTGACTCCGAACATGCCAATTCAGATTAACTTTTTCAATNCTTCCTAAAGTAACTGAAGANAT
  5   1   2       bld Egg1                               PBX0105B12.5p