Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl221k03.3                          145 PI      87          3      986                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012767325 Xl3.1-XL512d02ex.5 - 124 ESTs
                                                                       .......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL512d02ex.5                            AGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAACAAACGTGTGAATTTTCTTCTTTTTTT
                                                  Xl3.1-CHK-1012685421                                  CTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAACAAACGTGTGAATTTTCTTCTTTTTTTTTTTAA
                                                      consensus depths                                26    27    30    32    30    32    31    33    33    33    33    33    33    33    33    33    33    33    33    33    35    35    35    35    35    35    35    35    35    35    35    35    34    35    35    35    38    38    38    38    38    38    38    38    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    38    38    37    38    38    39    37    39    37    39    36    39    36    39    36    39    36    39    35    38    33    38    34    38    34    38    31    35    26    31    24    29    23    28    21    26    21    26    17    20    17    19    17    20    14    19    15    19    12    18    12    16     9    14     7    11     7    12     7    10     7    10     8    11     8    11     8    10     8    11     8    10     8    10     9    10    10    12    10    12    10    12    11    13    12    14    12    14    12    14    12    15    12    14    14    16    14    16    14    18    15    21    17    23    18    24    18    25    20    27    23    30    33    41    30    42    30    42    41    45    43    46    43    45    44    48    49    53    50    55    49    57    49    56    50    57    51    60    51    59    51    59    52    61    58    62    58    62    62    63    62    63    60    63    61    63    62    66    65    69    67    70    67    70    65    69    65    69    67    69    67    69    68    69    66    68    66    69    65    69    65    69    69    71    70    71    70    71    71    73    73    73    71    72    73    74    70    74    73    74    73    74    72    74    69    71    70    73    71    73    72    73    68    72    69    70    66    70    69    70    69    70    67    70    67    70    68    70    66    69    61    68    50    58    28    32    17    22    16    18     8    12     5     7     4     7
                                                                   SNP                                                                                                                                                                                        ------C-----
                                                                   SNP                                                                                                                                                                                                                            A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------A--
                                               BLH ATG      34     370                            
                                               BLH MIN      34      55                            
                                               BLH MPR      34      55                            
                                               BLH OVR      34      82                            
                                               EST CLI      -6      68                            
                                               ORF LNG      34       3                            
  5   1   2       bld Emb9 5x3                        IMAGE:7973835.5p AGCCGGATTCCCGGGATGCTGATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCATGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCTTATGATGCTGATGATATTTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCATCTCTCTGCCAGAATGCATCCCCAAAGTCGACTCCGACCCTTGAAATAGAAATCTTAATGAACTGAACATTGTGATGCAACTCTACTCATAGTTTTCCTGACGGTCTCACATCCCCAAAATTCCCTCTATCAATATGTCTAAGTGCTGTAAATAACCAAACGTTCTGCCATTTTAGAGAAAGTAACTCGTC
  5   1   2       bld Tad1 5x3                        IMAGE:6938829.5p    GGGGTCTCAGAGGAGCTGATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCCTCTGATGCTGGGAGTGATGACCACACTTGCACTTGACCAGTTCTCTCCCTGCCCAGAGNATGGCCAACCCCCCCAAAAAGTTCAGGAACATCCTGGAAACCCCCCTTTGGAA
  5   1   2       chi Emb9      in                    IMAGE:7973939.5p    GGTCCGGATTCCCGGGATATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCTGCCAAGATGCACCCCCAAAGTCAGACTCTAACCCTTGAATATGACATACTGATAAATGGAAACTCTGTGACTCAGCTCTCTCTATATTTTTCCTGTATGTTCCATACCCTTTAAGTGCCTGCTATCAATTTGGCATTTGCCTGGAAATACACAACTTTCTGTCATTTATTGAAATGGAAAGCTTA
  5   1   2       bld Tbd7 5g3  in                         XL073k10.5p                  GCTGATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTG
  5   1   2       bld Ga15 5g3  in                       XL483i07ex.5p                   CTGATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGGTTCACCAATAATCCCCCTATATAATGTGCCACTGCGT
  5   1   2       bld Ga15 5g3  in                       XL516j23ex.5p                   CTGATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAAATCCCC
  5   1   2       bld DMZ  5g3  in                         xl271f08.5p                   CTGATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGAT
  5   1   2       bld Em10 5x3                        IMAGE:8321445.5p                     AATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACTCT
  5   1   2       bld Emb4 5x3                        IMAGE:4724673.5p                      TTTGAAGCTACCNTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGCTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGGTAGTCAGAAGTTTGGCTCATATGTTGCCCCTANTGTGAAAGATTAACNACAATAATCTGGTTCTCAGTGGCTCACAT
  5   1   2       bld Ga15 5g3  in                       XL410n15ex.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGT
  5   1   2       bld Ga15 5g3  in                       XL506m09ex.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCCATAATCCCCTATATAATGTGCCACTGCG
  5   1   2       bld Ga15 5g3  in                       XL517c12ex.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGT
  5   1   2       bld DMZ  5g3  in                         xl247e11.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATA
  5   1   2       bld DMZ  5g3  in                         xl322l04.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTG
  5   1   2       bld DMZ  5g3  in                         xl322l12.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGA
  5   1   2       bld DMZ  5g3  in                         xl323b12.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCC
  5   1   2       bld DMZ  5g3  in                         xl313c01.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAG
  5   1   2       bld DMZ  5g3  in                         xl323j06.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGA
  5   1   2       bld DMZ  5g3  in                         xl314a08.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACA
  5   1   2       bld DMZ  5g3  in                         xl313h13.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAG
  5   1   2       bld DMZ  5g3  in                         xl259n06.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATA
  5   1   2       bld DMZ  5g3  in                         xl264d07.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAAT
  5   1   2       bld DMZ  5g3  in                         xl227c20.5p                      ATTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAA
  5   1   2       bld Emb4 5x3                        IMAGE:5542622.5p                       TTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGANACATCTGGTGACTGCAAGCTCTACTCCCTATTAGTTTTTTTCACTGGTACTGGGTTCACCAATAATCCCCCCTATATAATGTGGCCACTGNCCCN
  5   1   2       bld Tbd1 5x3                             AW765086.5p                        TTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTTGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTG
  5   1   2       bld Em10 5g3  in                    IMAGE:7980591.5p                        TTGAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAG
  5   1   2       chi Emb9                            IMAGE:7975402.5p                        TTTAAGCTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCATATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCTCTGACTGTCCGATCAGACCTTAAATGGAGATATGGAAACATAACTTTACCCTTATGATGCTGAAGATATTTCTGAGTTATTACAAACATGAAAAAGCTAAAAGTTTCTCTGAAACTGAGCTTAAGCTGCTGCTCATGCGTCTCCTCTGAAGTGGAGTAAAACCTCCCGATTGATCATCTTTCTGCTTATAGCACCCCTAAATCATACTCTTACTCTTGATTAGAATATTAATATATGGAACTCTGTTGCGTATCTTATCTATTAGTTT
  5   1   2       bld DMZ  5x3                             xl266c15.5p                             CTACCTGGAAGAGCAAGACATCCACAGACACAATGCATACTGGCCTGTTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTATGCCTATGATGCTGATGATATTCCTGAAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAA
  5   1   2       bld Ga15 5g3  in                       XL456k07ex.5p                              CTACCTGGAAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCAC
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200732.5p                                  TTTGAAGCTACCTGGAAGAGCAAGACATCCACAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTGCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTGCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCACCCTCTGATTGCTGAGTGATGACCACACTGCACTGACCAATCT
  5   1   2       bld Ga15 5x3                           XL423e13ex.5p                                      AAGAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTTGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATA
  5   1   2       bld Emb4 5x3                        IMAGE:4684238.5p                                        GAGCAAGACATCCACAGACACAATGCAGACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCCTTGAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGCTNTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTTGCGTAGTCAGAAGTTTTGGCTCATATGGTGCCCCTATGTGGAAAGATTAACAACANTATTCTGTTCCTCCGTTGGCTCCCATAATTCCTAATGAGGGAAAAAATGTGAAGACGACTGCCAATG
  5   1   2       bld Neu7      in                         XL044h18.5p                                                         CACAATGCAGNACTGGCCTGTCACTTGCTTGCCTTGTCCTCCTGTGCTCGGTGCTGGGAGAAGCTGCCCTTAGAAAACCAAAGAGACAGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCACCTGTGAAAACTAAAGGCCTGAAAACTCTAGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAG
  5   1   2       bld Neu7                                 XL037g01.5p                                                                                                                                                AGGCAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGNCAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAG
  5   1   2       bld Neu7      in                         XL018f06.5p                                                                                                                                                   CAGGGGCAACTGATACCAATGGTGCTGCCAAGTCTGAGCCTGCCCCTGTGAAAACTAAAGGCCTGAAAACTCTGGACAGAGGTTGGGGAGAAGACATTGAGTGGGCACAGACATATGANTAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCT
  5   1   2       bld Em10                            IMAGE:7979339.5p                                                                                                                                                                                                                                            GAAGACATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATATCTGTTCTCAGTGGCTCACATATCAATGAGGAGAAATGTGAGACGACTGCATGTAGCATTCATATGTAACTCTTTCATACTCATATACGACTCTCGTCCTACATATAATTATCTGATGTCTCTGATTTCACAGTCATGTCATATCACGAAACACTAATCTGCAGCTCTGCATAATCATGCCGA
  5   1   2       bld DMZ                                  xl226o12.5p                                                                                                                                                                                                                                                  ATTGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAATGTGAGAC
  5   1   2       bld Tbd5      in                    IMAGE:3580299.5p                                                                                                                                                                                                                                                    TGAGTGGGCACAGACATATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTAATTCACCACCTGGAAGATTGTCCTTACAGCATAGCACTTAAAAAGGCTTTTGTTGCTGACAAAATGGCACAGAAACTGGCTCAGGAAGATTTTATCATGTTGAATTTGGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTACGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGCT
  5   1   2       bld Ga15      in                       XL469i07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATATGGAAACAAACTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGA
  5   1   2       bld DMZ                                  xl242c13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTACGCCTATGATGCTGATGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCT
  5   1   2       bld Ga15      in                       XL417m10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAACATGAAGAAAGCTAAAAGTTTCCTGAAAACTGAGCTTTAAGCTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATGACCACACTGCACTGACCAGTCTCTCCTGCCAGAGATGCAACCCCCAAAAGTCAGACATCTGAACCCCTTGAAATATGAACATACTGAATAGAACTGGAAACATCTGGTGACTGCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGG
  5   1   2       chi Int2                            IMAGE:8822783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCGACTTAATACCTACCAAGTAACCTCACTTAAATTCGTCCCATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAACGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTCATTAAAGTTGGGGCATTAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTGTATCAGCTTATTTAATCAACACCCCTACATTCCACATTCTATATCTCTTAAGCTAAGTACTGTCTTTCTGGGTCTTTAATGTTCATCTGTACTTTGCATGCCCTGGAACTACTCCTTTACTGCTGATTTTCATCTCTGATATCATACAGCTCTGCAAGGTCGACTGGGGGCTTGGGCCCAACCGGGC
  5   1   2       bld DMZ       in                         xl306p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAGCTCTACTCCTATTAGTTTTTTCACTGTACTGGTTCACCAATAATCCCCTATATAATGTGCCACTGCGTAGTCAGAAGTTTGGCTCATATGTTGCCCTATGTGAAAGATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCCACATTCTATATCTCTTAAGGCTAAAGTACTGNCNT
  5   1   2       bld Skin      in                    IMAGE:8640500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTAACATGAAAAACCAGAATAATAAGATAACGATTCGTCCCAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGCAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTATCTAGCACAATACAGCCATTCAGTAACAGTGACTTCTCATACACGATGCAGTCTTGTTACTGAGCTTTCCAGTGCCAAGCGCTTACGACCTCGGATTTCATTCTGGCTA
  5   1   2       bld DMZ       in                         xl221i01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTAACAACAATAATCTGTTCTCAGTGGCTCACATATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAG
  5   1   2       bld Ga15      in                       XL445a02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCTAATGAGGAGAAAATGTGAGACGACTGCAATGTAGCAATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACG
  5   1   2       bld Ga15      in                       XL449c06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTCCATATGTAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTC
  5   1   2       bld Ga15      in                       XL435g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAACTTCTTTTTCATACTTCATTATACTGTACTTCTCTGTCTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGAT
  3   1   2       bld Skin      in                    IMAGE:8640500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGTACTGGATGTACTGACGTAACAAGATCACGAACGTCTCGTGTCTGACCAAGGCAATATCAGGATGGTCCGTAGATGATCATCAAGGTCATGTACAATTCTACAGAATACATCAGGTAATATCTGCTCAGGCTTTCCTTGCAATTAGAGTCATTTTGGTCATGAGATACATCAGTAGTGGTCAACCATTTCTTCTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCTAGTTCTGCTGTGTCATGTTG
  5   1   2       bld Ga15      in                       XL518g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTAACATAGTAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCT
  5   1   2       bld Ga15      in                       XL451h18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAATTTATCTTGGATTGTTCTGCTGATTTTTCATCAAGTCCATTGTCCAATATCTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAAATCTGCTAAGA
  5   1   2       bld DMZ       in                         xl331m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCAAGTCCATTGTCCAATATCTACAGAATACATCCGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGAttttgatttttttCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCA
  5   1   2       bld DMZ       in                         xl331i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACAGAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTAT
  5   1   2       bld Brn3                            IMAGE:8540668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATACATCAGCTAATATCTTGCTCAGGCTTTCCTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGGCACAGCGCTACAGCTCGGTTTCATCTGCTAAGAATCCCGCTGCATTCTATAGAAGACTTGGTCAAAACTGATCTCATGCAGCACTGTCTTCCATGCATATCTCAGTTTGCGGTC
  3   1   2       bld Ga15      in                       XL518g09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGGCATTTAGAAGTCATTTTNGCTCCNGAGGATACATCCAGTAGTGGGTCAACCATTTCTCTTTGTATCTCCTNGCATGGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTNTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTT
  5  -1   2       bld Emb4                            IMAGE:4970847.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   NAAATCTGTCAGCTTCCTGCATTAGAGTCATTTGTCCTGAGAACATCCAGTAGTGTCACCATTTCTCTTGTATCTCCTGCATGCATATGAAGTGCAACACCGAGATTTGATTTTTTTCTGGATTTACCTACAAATTCTATNTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTTTTTGCATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTACGGAAANAAAGAGTA
  3   1   2       bld Ga15      in                       XL435g09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCATNTAGAAGTCATTGTGCCTCNTGAGATACATCCAGTNGGGGGTCAACCATTTCTCCTTTGTATCTCNTTGCANGCANATAGAAGTGCNACACCGAGATTTGGATTTTTTNTTGGATNTACNTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACANGTAGCAAGTCATTTCTCATTNTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTA
  5   1   2       bld DMZ       in                         xl271b02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGCATTTAGAAGTCATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGA
  3   1   2       chi Emb9      in                    IMAGE:7973939.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAGCTAGATATATTGACAAAAAGATAACCTCGTAGGACTCCGCTTCTGTGTTCAGTGGGAGCTGTATTCTTAAAAGGCACGCATCTGCTCGGATGCGGTGGCGGTGTATAATTTTGTAACTTTCTGATTTTTGTTTTTGATTATGAGGAATTCGAACATCTTTCGGGATGAAAGGTTAGTGAATCACCTAACGCTTTATAAGGAATGATTATAAAAAAATTTTTTTTTCGAATTCAGCCAACTATACTTGGTATATTTACCCCCTTTTTCGTTTTGTGATTCGATGAGATTGGCAAGAATATTTAAAAGTAATGTTAAGTAATTGATTTATTATAATATAAAGCCATACAATCCACAATCTACATCTATTAAGGCTAAACTACACTCATTCTGAGTCTTTTATTTTTCATTTTTTTCTGGGCATGCGCGGGAACTACTCTTAATCTGCTTGAAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGAACTATTTTATAAAGAAATAAA
  3   1   2       bld DMZ  5g3  in                         xl264d07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTCATTTNGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATAT
  5   1   2       bld Ga15                               XL404m19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTTTGCTCCTGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTT
  3   1   2       bld DMZ                                 rxl313p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAGATACATCCAGTAGTGGTCAACCATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTNGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATAT
  3   1   2       bld DMZ  5g3  in                         xl313c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAGTGGTCAACCATTCTCTTGGTATCTCCTNGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTNGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld Em10                            IMAGE:7980502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCATTTCTCCTAGTATCTCCTTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACACCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTAACTGTGTAAATTCAAAAAG
  3   1   2       bld DMZ       in                         xl306p06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTCTCTTTGTATCTCCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGGCTGTGTCATGTTAGACATTT
  3   1   2       bld Em10 5g3  in                    IMAGE:7980591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTATCTCTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTGGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTTAAATCCAAC
  3   1   2       bld Ga15                               XL499g19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCTCCTTGCATGCATATAGAAGTGCAACACCGNGATTTNGATTTTTTCTNGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGNTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTNTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTAC
  5   1   2      seed Ga15      in                       XL512d02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAAATATTTTATTCCNNNAAAAANA
  3   1   2       bld Ga15      in                       XL469i07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TNGCANGCATATAGAAGTGCAACNCCGAGATTTGGATTTTTTCTNGGATTTACNTACAAATTNTATTTCCATTTTCTTCNTGGGCTAGANTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTNTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATT
  3   1   2       bld DMZ  5g3  in                         xl314a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld Ga15 5g3  in                       XL456k07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANGCATATAGAAGGGGCAACACGGAGATNNGGATTTNTTNTTGGATTTACNNTACAAATTNNATNTCCATTTTCTTCNTGGGNTAGACTGGGGCTGTTCACCCTTTNTACATGTAGCAAGTCATTTNTCATTNTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTACG
  3   1   2       bld DMZ  5g3  in                         xl259n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAA
  3   1   2       bld DMZ       in                         xl221i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCATGCATATAGAAGTGCAACACCGAGATTTGATTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATT
  3   1   2       bld DMZ  5g3  in                         xl323j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTNGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAA
  3   1   2       bld DMZ                                 rxl326o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTNGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld DMZ  5g3  in                         xl247e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTT
  3   1   2       bld DMZ  5g3  in                         xl322l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCATATAGAAGTGCAACACCGAGATTTGATTTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCNTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTTTTTGCATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATATT
  3   1   2       bld DMZ                                 rxl229k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCATATAGAAGTGCAACACCGAGATTTTGATTTTTTCTGGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld DMZ  5g3  in                         xl227c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCATATAGAAGTGCAACACCGAGATTTGATTTTTCTGGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld Ga15      in                       XL445a02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAGATTNGGATTTTTTNNGGGGATNTACNTACAAATTNTATTTCCATTTTNTTCNTGGGNTAGANTGGGGCTGTTCACCCTTTTTACANGTAGCAAGTCATTTNTCATTNTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATNGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCNGCATTTCTATAGAAGGACATNGGTCAGAAACCNGATCTCATNGGCAGCCACNGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATT
  3   1   2       bld DMZ  5g3  in                         xl322l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTCTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTTTTTGCATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld DMZ  5g3  in                         xl323b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld DMZ  5g3  in                         xl313h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNGGATTTACCTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAA
  3   1   2       bld Ga15      in                       XL512d02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTACNTACAAATTCTATTTCCATTTTCTTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCNTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATT
  3   1   2       bld DMZ       in                         xl271b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAG
  3   1   2       bld DMZ  5g3  in                         xl271f08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld DMZ                                 rxl295j07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGGGCTAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATNTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCNTGAAATAGACAAGCATACTAAATATGTTCTTTNGTATCAGNTTATTTAATCAACAGCCNTACATTCCACNTTGNNTATCTCTTAAGGCTAAAGTACTGTCTTTNTGAGTCTTNTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTNGTAGTTTCATNNTCCTTGTTTAATCATACAGAGCTGTGCAGTCTTTTCACANGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTNTACANGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCAT
  3   1   2       bld Tbd7 5g3  in                         XL073k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGACTGGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCAGTAGACATTTA
  3   1   2       bld Emb9                            IMAGE:7974118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGTATATCAAACCCTTTTTACAATGTAGCAAGTCATTTCTCATTCTAGTGTTCAAGGGGTTGGATTTTAATTAAATCATATTGCGGAGCCCTTGATAAAGTGGGGCAATAACCCCACCCCCAGTTGGACATCCCGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGGCTAAAGTACTGTCTTTCTGAGTCTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAACAAACGTGTGAATTTTCTTCTTTTTTTTTTTAAACATGCTACAAAGCCAGGCTAAAGAAATAGTGGTATGTGATTTACCGCAACTGGATGAAACGGAAATATTGTTCCGCAATACTGCATACCGGATAACACATACCACTATTCTTTAACCTGCTTAAC
  3   1   2       bld DMZ       in                         xl331m17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTTTTTGCATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATT
  5   1   2       bld DMZ       in                         xl269c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATT
  3   1   2       bld Ga15 5g3  in                       XL517c12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTTCACCCTTTTTACATGTAGGCAAGTCANTTCTCATTGNAAGNGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATATT
  3   1   2       bld DMZ       in                         xl331i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTCACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACAT
  3   1   2       bld DMZ       in                         xl269c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCCTTTTTACATGTAGCAAGTCATTTCTCATTCTAAGTGTTCAAGGGTTGGATTATATTAAAATCATATTGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld Ga15 5g3  in                       XL483i07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGTAGCAAGTCATTNGGTCATTNTAAGTGNTCAAGGGGTTGGAGTATATTAAAATCATATNGCGGAGCCCNNGATTAAAGTNGGGGCAATAACCCCACCCCCAGTNGGACATCCNTGAAATAGACAAGCATACTAAATATGTTCTTTNGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTT
  3   1   2       bld Ga15 5g3  in                       XL506m09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGTCATTNGNCATTGTNAGTGTTCAAGGGTTGGATNATATTNANATCATATNGCGGAGCCCTTGATTAAAGGNGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATAT
  3   1   2       bld Ga15      in                       XL451h18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCAAGGGGGGGGANTATATTAAAATCATATTGCGGAGGCCCNTGATTAAAGGTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTA
  3   1   2       bld Ga15 5g3  in                       XL410n15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGGGTTTGGGATTATATTNAAATGANATNGCGGAGCCCTTGATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTNGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCAGCATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTAC
  3   1   2       bld Ga15 5g3  in                       XL516j23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGTTGGGATTATATTAGNATCATNTNGNCGGAGCCCGNGANNANAGTNGGGGCAATAACCCCCCCCCAGTTGGACATCCNTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTA
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3200732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGGTGGATCAAACTAACATCATATGCCGCAGCCTNTGATTAAGTTCGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCA
  3   1   2       bld Tbd2                            IMAGE:3200644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTTGGATAATATTAAAATCATATGCGGAGCCCTTGATTAAGGTTGGGGCAATTACCCACCCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTTTAGCACATACAGCCCATTTCCAGTACAGTGACTTTTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATTTGCTAAGAGATCCACGCTGCATTTTTATAGAAGGACATTGGTCAGAAACCTGATTTCATTGGCAGCCACTGTTTTCACATGCAATATCCTCCAGTTTTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTAAAGTGTATATTCATAAAAATATTTTATTCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu7      in                         XL044h18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTAAAGTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAAT
  5   1   2       bld Ga15                               XL418m04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTGGGGCAATAACCCCACCCCCAGTTGGACATCCCTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAACAAACGTGTGAATTTTCTTCtttttttttttAAACATGCTACAAAGCCAGGCTAAAG
  3   1   2       bld Ga15      in                       XL449c06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCNCCCCCAGTNGGACATCCNTGAAATAGACAAGCATACTAAATATGTTCTTTTGTATCAGCTTATTTAATCAACAGCCCTACATTCCNCATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTNTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATAT
  3   1   2       bld Tbd1                                 AW782361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCGTGAAATAGCAGAGCAGACTACATATGTTCTTTTGTACCAGCTTATTTAATCACCAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAA
  5   1   2       bld Ga15      in                       XL415o13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCNaaaaaaaaa
  5   1   2       bld Ga15      in                       XL498f08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGNNTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAACAAACGTGTGAATTTTCTTCttttttttttAAACATGCTACAAAGCCAGGCTAAAGAAATAGNGGTATGTGATTTACTGCAACTGGATGAAAAGGAAATATTGTTCCGCAATACTGCATACAGTATTTACACTGAATTTACAACTACNCAAATAAACAGTTTTACC
  3   1   2       bld Ga15      in                       XL415o13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTATTTAATCAACAGCCCTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAAT
  5   1   2       bld Ga15      in                       XL463b14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCNaaaaaaaaa
  3   1   2       bld Ga15      in                       XL463b14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTACATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATATT
  3   1   2       bld EggS                            IMAGE:4785384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTCTGAGTCTTTTAATGTTCATTCTGTACTTTGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCATAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACAGGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTTTTGGAATATCATAAAAATATTTTTTCATCAAGA
  3   1   2       bld Ga15      in                       XL417m10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCACATTCTATATCTCTTAAGGCTAAAGTACTGTCTTTGGGAGTCTTTTAANGTTCATTCTGTACTTNGCATGCCCTGGAACTACTCTTTATCTGCTTGTAGTTTCATCTTCCTTGTTTAATCATACAGAGCTCNGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTNTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTNGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCNGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATNGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTATAAGAAATA
  3   1   2       bld Tbd2                            IMAGE:3201202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGCCCAGTCCGACACTGGCTCAGTCCGACACTGGCTCTGCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTTTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACAATAAATAAGAAATATTTACTGTGTATATTCATAGAAATATTTTATTCAAAAACAAGCGGAAGGAAGGGCCCGTCATGGTACTGTTTG
  3   1   2       bld Tbd5      in                    IMAGE:3580299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGTCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAA
  3   1   2       bld Neu7      in                         XL018f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTTTCACATGTAGTCCCAGTTATTACCCAATGAAATCCCANATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTNTAGCACATACAGCCCATTTCCAGTACAGTGACTTNTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAANAGATCCNCGCTGCATTTCTATANAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCNCTGTCTTCACATGCAATATCCNCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCAAACAAACGTGTGAATTTTNTTTTTTTTTTTTTTAA
  3   1   2       bld Ga15      in                       XL498f08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTCACANGTAGTCCCAGTTATTNCCCAATGAAATCCCNGATNCAAGTTATTTCATCAGTTATTCNTAACNGGAGNACAGTTATTNTAGCNCATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACANGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATNTGCTAAGAGATCCNCGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGNCATTTTATAAGAAATATTTACTGNGTATATTCATAAAAATATTTTATTCAAACAAACGTGNGAATTTTCTTCTTGTTTTTNTAAACATGCTACAAAGCCAGGCTAAAGAAATAGTGGTATGTGATTTACNTGCAAGCNGGATGAAAAGGAAATATNGTTC
  5   1   2       bld Ga15      in                       XL477m16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGNAANAAAAAA
  3   1   2       bld Ga15      in                       XL477m16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAATCCCAGATACAAGTTATTTCATCAGTTATTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATT
  5   1   2       bld Ga15      in                       XL503n23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL503n23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCTAACTTGACTACAGTTATTCTAGCACATACAGCCCATTTCCAGTACAGTGACTTCTCATACACGATGCAGTCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATT
  5   1   2       bld Ga15      in                       XL421d15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTTACTGTGTATATTCATAAAAATATTTTATTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL421d15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTGTTTACATGAGTTTCAAGGTGGCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGATCCACGCTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCCATGTTAGACATTTTATAAGAAATATT
  3   1   2       bld Ga15      out                      XL421n05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGCTGTGTCATGTTAGACATTTTATAAGAAATATTA
  3   1   2       bld Ga15      out                      XL511k15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCATTTCTATAGAAGGACATTGGTCAGAAACCTGATCTCATTGGCAGCCACTGTCTTCACATGCAATATCCTCCAGTTCTGGCTGTGTCATGTTAGACATTTTATAAGAAATATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)