Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL512d02ex.5                        124 PI      87         12      996                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012767382 Xl3.1-xl221k03.3 - 145 ESTs
                                                                       ....-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl221k03.3                                                                                                                                                                     CTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACAAAAAAAATCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCCCATTTTTTGGTTTATTTTTCAAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTTTTTTTAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTTAA
                                                  Xl3.1-CHK-1012685331                                                                                                                                                                           TGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACAAAAAAAATCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCACATTTTTTGGTTTATTTTTCAAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTTTTTTTAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTTAAAAAAAA
                                                      consensus depths                                                                                                                                                                          8    12    27    30    30    37    42    44    43    46    44    48    46    49    46    50    48    51    49    52    46    52    50    53    51    54    50    55    50    55    53    55    51    56    54    56    54    56    54    56    55    57    53    57    52    57    55    57    56    58    57    58    55    58    54    57    55    57    53    57    53    56    54    56    54    56    53    55    53    55    53    55    55    57    56    58    56    58    55    57    54    57    55    57    56    58    56    58    56    58    55    58    52    56    48    54    50    54    50    54    51    55    51    55    50    54    49    54    44    49    39    45    37    43    22    27    22    26    22    24    18    20    16    20    16    20    14    19    13    17    10    15     9    13     9    12     9    11     9    11     9     9     8     9     8     9     8     9     8     9     8     9     9    10     9    11     7    11     8    10     8    10     8     9     6     8     5     8     7    15    10    15    15    25    18    27    19    28    20    30    28    34    27    35    29    35    36    41    35    42    40    47    40    48    43    48    44    48    45    49    53    57    54    59    53    58    51    57    54    58    53    58    53    61    55    62    58    63    57    62    56    62    59    63    61    66    62    66    62    66    63    67    61    68    63    67    65    67    66    66    62    67    67    68    65    68    65    68    65    68    65    69    62    69    63    69    62    68    61    68    66    69    63    69    67    70    64    71    67    71    63    70    63    69    64    69    56    68    62    68    61    68    57    67    55    62    52    61    51    60    47    57    31    37    29    37    28    34    24    28    15    23     8    14     7    12     7    10     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----A-------
                                               BLH ATG      43     355                                                                                                                                                                     
                                               BLH MIN      43      55                                                                                                                                                                     
                                               BLH MPR      37      55                                                                                                                                                                     
                                               BLH OVR      43      76                                                                                                                                                                     
                                               CDS MIN      43      48                                                                                                                                                                     
                                               EST CLI      -1      48                                                                                                                                                                     
                                               ORF LNG      43       3                                                                                                                                                                     
  5   1   2       bld Neu7 5g3  in                         XL006m02.5p GGNCTGCAGGNAATTCGGCACGAGGTGATTCTTTGGGTTGGGTNAAAAAGACTAAAAGGATCAGGACATCCTGGTTTTAAGGCTGACGTTGATCTCTAGCAGTTATACCTGCTTTGGGTATAAATACACCACCACCTGCAACTTGCAGCATTATCTCAGAGGAGCTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTC
  5   1   2       bld Em10 5x3                        IMAGE:8320073.5p                                                                                 GGCTGACGTTGATCTCTAGCAGTTATACCTGCTTTGGGTATAAATACACCACCACCTGCAACTTGCAGCATTATCTCAGAGGAGCTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCTCAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACACACTGCACTGACCAGTCTCTAATGCCAGAGAGCAACTCTAAAGTCAGAATC
  5   1   2       chi DMZ       in                         xl241j23.5p                                                                                                                                                TCGATTCGAATCGGCACGAGGCTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGGTAAGTCAGACTGATATCATAGAGGATGTCATGGAGATATTCTGCAGTACAAGAACTGTTCCAAAGGGTGGCATAGCGTGACAGCATGAAATGTACAGCCCTCATGTCTATGGCACAAGTACAGATTTAACAGCAACTTCCCTCCCAAGCAAATGGTCCATATGTCCTTTCCCTGTCTGGGGTTTTTCAGATAAAGGCTATTAAAACAAATGTTTGGCCACTAGTATGGATTTATGCTAGAGTTAGTATCAAGAATAAATTGCTGTTTTATTATTACAAAGAAAAAACAATACATTTTTCTATAGAAATTACCATTACTATTTTTTGGAGCAATGGCTTCCACTAGACTAGTGATCCCCAACCAGTAGC
  5   1   2       bld DMZ  5g3  in                         xl307g10.5p                                                                                                                                                                 ATCGATTCGCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCACTCCCA
  5   1   2       bld DMZ  5g3  in                         xl306g10.5p                                                                                                                                                                 ATCGATTCGCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAG
  5   1   2       bld Neu7 5g3  in                         XL050a03.5p                                                                                                                                                                  CTCCTCTGAGNACTACCTGGNAAGAGCAAGNACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGA
  5   1   2       bld Tbd7 5g3  in                         XL101d04.5p                                                                                                                                                                    GCTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCA
  5   1   2       chi DMZ       in                         xl301o23.5p                                                                                                                                                                    TCGATTCGGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTCTGCATATTTTGTTTCACAGTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAG
  5   1   2      seed Ga15 5g3  in                       XL414p13ex.5p                                                                                                                                                                     CTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTA
  5   1   2       bld DMZ  5g3  in                         xl315e13.5p                                                                                                                                                                     CTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCA
  5   1   2       bld DMZ  5g3  in                         xl244p14.5p                                                                                                                                                                     CTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAG
  5   1   2       chi DMZ       in                         xl338e10.5p                                                                                                                                                                     CTGATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGGTAAGTCAGACTGATATCATAGAGGATGTCATGGAGATATTCTGCAGTACAAGAACTGTTCCAAAGGGTGGCATAGCGTGACAGCATGAAATGTACAGCCCTCATGTCTATGGCACAAGTACAGATTTAACAGCAACTTCCCTCCCAAGCAAATGGTCCATATGTCCTTTCCCTGTCTGGGGTTTTTCAGATAAAGGCTATTAAAACAAATGTTTGGCCACTAGTATGGATTTATGCTAGAGTTAGTATCAAGAATAAATTGCTGTTTTATTATTACAAAGAAAAAACAATACATTTTTCTATAGAAATTACCATTACTATTTTTTGGAGCAATGGCTTCCACTAGACTagtgatccccaaccagtagcttgtgagcaacatgttgcaccccaGCTC
  5   1   2       bld DMZ  5g3  in                         xl293b12.5p                                                                                                                                                                        ATCTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAG
  5   1   2       bld DMZ  5g3  in                         xl330o24.5p                                                                                                                                                                         CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGCTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAANCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAANACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCANGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTANAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAANAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAG
  5   1   2       bld Ga15 5g3  in                       XL467o18ex.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACC
  5   1   2       bld Ga15 5g3  in                       XL433n04ex.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGATTGCACTATCTACTCCTATTAGCTTTTTCAG
  5   1   2       bld DMZ  5x3                             xl231p20.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAG
  5   1   2       bld DMZ  5g3  in                         xl310n18.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACA
  5   1   2       bld DMZ  5x3                             xl297p01.5p                                                                                                                                                                          CTGAAACTACCTGGNNGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGG
  5   1   2       bld DMZ  5g3  in                         xl251j21.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAG
  5   1   2       bld DMZ  5g3  in                         xl254f14.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGA
  5   1   2       bld DMZ  5g3  in                         xl261o06.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATG
  5   1   2       bld DMZ  5g3  in                         xl273p05.5p                                                                                                                                                                          CTGAAACTACCTGGAAGAGCANGACATCCNCAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCNGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACNGCATANCTCTTANNAAGGCTTTTGTCGCTGATCGAATGGCNCAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAG
  5   1   2       bld Emb3 5x3                        IMAGE:3399566.5p                                                                                                                                                                            GAAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGNACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTANAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTAGAGTGATCACCACACTGCACTGACCANTCTCTAATGCCAGAAAACCAACTCCCCAAAATCAAACATCACGACCCCTT
  5   1   2       bld Ga15 5g3  in                       XL503b18ex.5p                                                                                                                                                                             AAACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTTCTAATGTCACCCAATGC
  5   1   2       bld DMZ  5g3  in                         xl258p20.5p                                                                                                                                                                              AACTACCTGGAAGAGCNAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACAT
  5   1   2       bld DMZ  5g3  in                         xl227a12.5p                                                                                                                                                                              AACTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATG
  5   1   2       bld DMZ  5g3  in                         xl293d04.5p                                                                                                                                                                                CTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGA
  5   1   2       bld DMZ  5g3  in                         xl244k11.5p                                                                                                                                                                                CTACCTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGATTGCACTATCTACTCC
  5   1   2       bld DMZ  5g3  in                         xl250n24.5p                                                                                                                                                                                CTACCTGGAANAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGAC
  5   1   2       bld Neu1 5g3  in                        Neu1-12E2.5p                                                                                                                                                                                    CTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGTTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAGG
  5   1   2       bld Thy  5x3                        IMAGE:8548573.5p                                                                                                                                                                                    CTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAGTCAGACATCAGAACCCCTGAAATATGACATACTGAATGGAAATGGAACATCTGTGACTGCCTATCTACTCTATAGCTTTTCAGTGACTGGTCTATGTCACATGCCCATATTATCTGCACTGATCCAGCTGCTCATGTGCCTAGGAAGATACAAAAACTGTCCAAGC
  5   1   2       bld DMZ  5g3  in                         xl272a24.5p                                                                                                                                                                                    CTGGAAGAGCAAGACATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAAC
  5   1   2       bld Neu7 5x3                             XL022b15.5p                                                                                                                                                                                        GAGCAAGNACATCCACAGNACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGA
  5   1   2       bld Neu7 5g3  in                         XL004a16.5p                                                                                                                                                                                             AAGACATCCACAGNACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGC
  5   1   2       bld Tbd7 5x3  ?                          XL051e24.5p                                                                                                                                                                                             AAGACATCCACAGNACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCATAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTG
  5   1   2       bld Ga12 5g3  in                         XL217m20.5p                                                                                                                                                                                             GGCACGAGGCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAAT
  5   1   2       bld Neu7 5g3  in                         XL014h01.5p                                                                                                                                                                                                GCACGAGGCAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACC
  5   1   2       bld DMZ  5g3  in                         xl303o03.5p                                                                                                                                                                                                  CATCCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATNAGCTTTTTCAGTGAA
  5   1   2       bld Neu7 5g3  in                         XL013a12.5p                                                                                                                                                                                                     GCACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGACAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACCAAACATGAAG
  5   1   2       bld Neu7      in                         XL047e05.5p                                                                                                                                                                                                     GNCTGGCCTGTNCCCTNATTTGCCTTGTNCCTCCTGTGCTCAGCGCTGGGNGNAAGCTGTCCTTNAAAAAACCAAAGNAAGCAGGCAGGNAACAACTGNATACCAAAACTGNTCAAGNAGCCTGCACCAATAAAAACTAAAGGCNCTGNAANACCCTGGNACAGNAGGCTGGGGNAGNAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGNAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGNAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGC
  5   1   2       bld Emb4 5x3               IMAGE:5537369-IMAGp.IMAGp                                                                                                                                                                                                      CACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGG
  5   1   2       bld Emb4 5x3                        IMAGE:5537369.5p                                                                                                                                                                                                       ACAGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGGTGGCCCTATGTGGAAGAAATACCaaaaaaaaTCTGTTCTCAGAGGCTCACATATTTCTAATTGGGGGGGCCTAAATGTGAAACTGGACTGGCATGGTANAAAAATCACCAttttttttggggtttattttt
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3550157.5p                                                                                                                                                                                                         AGACATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTT
  5   1   2       bld Neu7 5g3  in                         XL044f10.5p                                                                                                                                                                                                            ATAATGCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGNAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTG
  5   1   2       bld Neu7      in                         XL027b06.5p                                                                                                                                                                                                                  GCAGGCTGGCCTGTCCCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACA
  5   1   2       chi Em10                            IMAGE:8319041.5p                                                                                                                                                                                                                              CCCGAAGTTCAGACACTTTAGGGGAGCAAACACACACTCAGATTTGGGGAGATTAATCCCCTTCTTCGGGGGGAACAACTGATACGGAATGCTGATCAACCAGCCTGTACCATTAAAAACTAGAGGCCTGAAGACCCTGTACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACCGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACATAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCCGTAGCTGATGAAAACCAGTCTCCCGATGGATATTATGTGCCAAGGGTCATCTTTATAGATCCCTCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACAGATACATAATGTATGCCTATGACTCTGACAATATTCCTGAGTTGATATACAAACATGATAAAACCCAATAGTTTTCCATTAATCTGAACTTCTAAACTGTTGCACATTGCGCCACCTCCGATGCTGGAATGATTACCACACTGCACTTGACCCGTCTCTAATGCCTTATAAGCATCTCCTAATAATTCGACATCCTAACCCCTTGACTATCTTCCTCTCTGCATGGAATCAGGAACATTCGGCAACATCACTTCATATCCTATTTAGTTTTTCATTA
  5   1   2       bld Em10                            IMAGE:8319089.5p                                                                                                                                                                                                                                 CCTAGTTTGCCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGTACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGT
  5   1   2       bld Emb4                            IMAGE:5513866.5p                                                                                                                                                                                                                                          CCTTGTCCTCCTGTGCTCAGCGCTGGGAGAAGCTGTCCTTAAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCNAATGCCCACTATATATTCTGCCACTGTAGTCTAAGCTTGGGCTCATGTGN
  5   1   2       bld DMZ                                  xl338e08.5p                                                                                                                                                                                                                                                     TGTGCTCNNCGCTGGGAGAAGCTGTCCTTAAAAAACCANAGAAGCNNGCAGGAACNACTGATACCAAAACTGATCANGAGCCTGCACCAATAAANACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAANAGGGCCTGGCCAAAGCTAGAGAANACAACNAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTA
  5   1   2       bld Gas8                   IMAGE:3517296-IMAGp.IMAGp                                                                                                                                                                                                                                                          CATCGATTCGAATTCAAGGCCTCTTAAAAACCAAAGAAGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGTACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACAATGCCCCACTATATATTCTGCCACTGTAG
  5   1   2       bld DMZ                                  xl228a12.5p                                                                                                                                                                                                                                                                      GAAGCTGTCCTTAAAAAACCAAAGANGCAGGCAGGAACAACTGATACCAAAACTGATCAAGAGCCTGCACCANTANAAACTAAAGGCCTGAAGACCCTGGANAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTNGAGAANACAACANACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGNACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGT
  5   1   2       bld Neu7      in                         XL040m14.5p                                                                                                                                                                                                                                                                                                        GGAACAACTGATACCAAAACTGATAAGAGCCTGCACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGA
  5   1   2       bld DMZ       out                        xl322p03.5p                                                                                                                                                                                                                                                                                                            AACTGATACCAAAACTGATCANGAGCCTGCACCAATAAAAACTNAAGGCCTGAAGACCCTGGACNGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCNAAGCTAGAGAAAACAACNNACCTCTGATGGTGATTCNCCACCTGGAAGATTGTCCTTACGGCATANCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCNNGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTC
  5   1   2       bld Gas8      in                    IMAGE:3517272.5p                                                                                                                                                                                                                                                                                                                                CAAGAGCCTGTACCAATAAAAACTAAAGGCCTGAAGACCCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAG
  5   1   2       bld Ga15      in                       XL416o06ex.5p                                                                                                                                                                                                                                                                                                                                                                     CCTGGACAGAGGCTGGGGAGAAAGTATTGAGTGGGTACAGACCTATGAAGAGGGCCTGGCCAAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGATTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCNCATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTANAAATCACATTTTTTGGTTT
  5   1   2       bld Ga12      in                         XL158f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                  GTGAAGAGGGCCTGGCCAAGCTAGAGAAAACAACAAACCTCTGATGGTGATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATA
  5   1   2       bld DMZ       in                         xl294m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTCACCACCTGGAAGATTGTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGATTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCACattttttggtttatttttCAAACTACATTATAGCACACTTCTCCAT
  5   1   2       bld DMZ       in                         xl250p11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCTTACAGCATAGCTCTTAAAAAGGCTTTTGTCGCTGATCGAATGGCACAGAAACTGGCTCAGGAGGATTTTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACNAACATGAAGAAAGCCNAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCANAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGATTGCACTATCTACTCCTATTANCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTACAAATCACattttttggtttatttttCAAACTACATTATAGCACACTTCTCCATCTCT
  5   1   2       bld Int2                            IMAGE:8531081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATAATGCTGAATTTAGTGCATCCAGTAGCTGATGAAAACCAGTCTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCACattttttggtttatttttCNAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGTCACCCTTTCTTTTTGATCACCTTGCATGCATATAGTAGTACTGAAACAACTTTTGATTTTTCCTGGATCAGCCGTAATCTATTTCATATTTTNCTCTGACAGACTGTGCTGTCACCTGTCTCATTCCATCACTGTCAGATAAATAATCTCATTGGACGCTGATATCAGATCAATTTT
  5   1   2       bld DMZ       in                         xl310l14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCAGATGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGA
  5   1   2       bld Ga15                               XL483p22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGACATTATGTGCCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCANACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCANAGAAGCAACTCCCAAAAG
  5   1   2       bld Tad1                            IMAGE:6879803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGGGTCATCTTTATTGATCCATCCCTGACTGTCCGATCAGACCTTAAAGGGAGATACGGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGCCAAAAGTTTCCTAAAAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTAACTGCAGTGTAGAAATCCCattttttggtttatttttCAAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTTCACCTTGTACATCATTTCTCATTTCACATGTTCAGGGATATATTTAAATCCCTCCCAGTTGGACAGCCCCTGAAATAAGGAAGGAA
  5   1   2       bld DMZ       in                         xl294c11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAACAAAATGTATGCCTATGACGCTGACGATATTCCTGAGTTGATTACAAACATGAAGAAAGNCAAAAGTTTCCTAANAACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCA
  5   1   2       bld DMZ       out                        xl222b07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGAGCTTTAAACTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACAT
  5   1   2       bld DMZ       in                         xl268j20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGCACATTGCGCCCCCTCTGATGCTGGAGTGATCACCACACTGCACTGACCAGTCTCTAATGCCAGAGAAGCAACTCCCAAAAGTCAGACATCAGAACCCCTTGAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCCCattttttggtttatttttCAAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGNCCTTTCTTTGACA
  5   1   2       bld DMZ       in                         xl221k03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAATATGAACATACTGAATGGAAATGGAAACATCTGGTGACTGCACTATCTACTCCTATTAGCTTTTTCAGTGAACTGGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCCCattttttggtttatttttCAAACTACATTATAGCACACTTCTCCATCTCTAANATC
  5   1   2       bld Neu7      in                         XL031d18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCTTTTTCAGNGAACNNGTTCTAATGTCACCAATGCCCCACTATATATTCTGCCACTGTAGTCTCAAGCTTGGCTTCAATGTTGCCCTATGTGAAAGAATAACaaaaaaaaTCTGTTCTCAGAGGCTCACATATTCTAATTGGGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCACattttttggtttatttttCAAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGCCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCANCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATNGCTGCACTGCCTTTCTTTGACATGCCATTNTCT
  5   1   2       bld Ga15      in                       XL487e14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGCTTAATGTGAACTGACTGCAGTGTAGAAATCCCattttttggtttatttttCAAACTACATTATAGCACACTTCTCCATCTCTAAGATCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGCGTAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTNATTGGCAGCCAC
  5   1   2       bld DMZ                                  xl286h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCAGTGNAGAAATCCCattttttggtttatttttCAAACTACATTATAGCACACCTTCTCCATCTCTAAGATCTGGTAGATGGTCAACCCTTTCTTTTTGAATCACCTTGCNTGCATATAGTANTACTGANACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAANTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGNCTCANCTTATTTAATCAACAGNTCTACCTTCTACTTTCNATATCTTTAAATATATTGCTGCACTGCCTTTCNTTGACATGCCATTTTCTCGTATATAACCATTGGACTTACAATGTTCNTTCTGGAGTGTGAATGCCCTGATAATACGCTATGTCTGCATAGTGTCCCATCTTCNATTNAATCAAACAGTACTCTGCAGTCTTTTCANATGTGGTCCCAGTTATTTCCCAATGAAATACNAGATAGAAAACATTTCATCNGTTATNCATAAGTCTANTANAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTT
  5   1   2       bld Ga15                               XL496e17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCCATCTCTAAGATCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGNAATTCNATTNCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGNTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAANATCCTCCAGATTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATNTAANCAACAGCTCTACCTTCTACTTTCNATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGGCAGCCACTGTCTTCATATGCAATA
  5  -1   2       bld Thy                             IMAGE:8549097.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAGTCATATGGTATGACGGCGTAATCATTGTATTCATACTAGCAATTCATTTAATGGAGGTACCTCTTTGACACTGCACATTGTAGATGACAACTTGATTTCTGGATCAGCAGAATCTATTCATATTTTCTCTTGATAGACTGTGCTGTCAACNTGACATCATTCTCATTCACAGTTCAGGATATATAAAATCCTCCAGTTGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCaaaaaaaaaaa
  3   1   2       bld DMZ                                 rxl287a13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGATCTGGTAGTGGTCAACCCTTCTTTTGAATCACCTNGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGNTGGCNTAAGTGANGCAGCTCGGGTTCAAACC
  3   1   2       bld DMZ  5g3  in                         xl303o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATCNGGTAGTGGTCAACCCTTTCTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld DMZ                                 rxl286a13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATAT
  3   1   2       bld DMZ       in                         xl310l14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCC
  3   1   2       bld DMZ  5g3  in                         xl310n18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNGGTAGTGGTCAACCCTTTCTTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld DMZ  5g3  in                         xl227a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGTAGTGGTCAACCCTTTCTTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCT
  3   1   2       bld Ga15 5g3  in                       XL433n04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGTCAACCCTTTCTTTTGGAATCACCTGGCATGCATATAGGTAGTACGGAAACAAACTTTNGATTTTTCCTNGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGNGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGNGANGCAGCTCGGTTTCAAACCGCTAAGAGTTCCANGCTACATTTCTATAAAAGGACATNGGTCNGAAACCNGATCTTATNGGCAGCCACNGTCTTCATANGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld DMZ       in                         xl221k03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTNGAATCACCNTGCATGCATATAGTAGTACNGAAACAAACTTTTGATTTTTCCTGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGT
  3   1   2       bld DMZ  5g3  in                         xl307g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTGAATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTG
  3   1   2       bld DMZ  5g3  in                         xl293b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAATCACCTGGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATA
  3   1   2       bld DMZ  5g3  in                         xl261o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAATCACCTNGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTNGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld Ga15 5g3  in                       XL414p13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATCACCTTGCATGCATATAGTAGTACNGAAACAAACTTTTGATTTTTCCTGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTNGCATAAGTTTCAAGATGGCATAAGNGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATNGGTCNGAAACCNGATCTTATNGGCAGCCACTGTCTTCATANGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTA
  3   1   2       bld DMZ       in                         xl338e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCNTNAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld DMZ  5g3  in                         xl258p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCTTGCATGCATATAGTAGTACTGNAANCAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTG
  3   1   2       bld DMZ       in                         xl294c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCACCTTGCATGCATATAGTAGTACTGAAACAAACTTTNGATTTTTCCTGGATTCAGCCAGTAATTCTATTTCCATTATTNTTCTTCTTGGACTAGACTGGTGNTGTTCAACCTTGTACATCATTTCTCATTCCGCATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATNTGTTCTTTTGTCTCAGCTTANTTAATCAACAGCTNTACCTTNTACTTTGTATATCTTTAAATATATTGCTGCACTGCCTTTNTTNGACATGCCATTTTCTCTTATATAACCANNGGACTTACAATGTTCATTNTGTAGNGTGACTGCCCTGATAATACTNTAGGTGATGCATAGTGTCCCATNTTCTATTTAATCAAACAGTACT
  3   1   2       bld DMZ  5g3  in                         xl306g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTNGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATT
  5   1   2       bld Ga15                               XL460d01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGCATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTCTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAAATGTGTGAAttttttttAACCCATTGCNATCATAATAAAC
  3   1   2       bld DMZ  5g3  in                         xl251j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGCATATAGTAGTACTGAAACAAACTTTTGATTTTTCCTGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld DMZ                                 rxl311n18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATATAGTAGTACTGGAACAAACTTCTGANTTTTCCTTGGATTCAGCCAGTANTGCNATTTCCATTATTGTTCNTCTTGGACTAGACTGGNGCTGTTCAACCTTGTACATCATTTNTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGNTGGACAGCCCTGAAATAGTCAGGAATACTAAATNTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCNGCACTGCCTNTCTTTGACATGCCATTTTCTCTNATATAACCATTGGACTTACAATGTTCATTNTGTAGTGNGACTGCCCNGATAATACTCTATGTGTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCNGCAGTCTTNTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTANTCATAATTCTATNATAGTTATTCTAGTNCANTTCCAGCACAGTGACTTNTCATATGCCAATGCAGTCTTGTNGGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACAGTGGTCTGAAACCTGATCNTANTGGCAGCCACTGTCNTCATATGCAATATCCNTTAATTCTGCNGTGTAATGTTATACATTTTATAGTAAATATT
  3   1   2       bld Ga15 5g3  in                       XL503b18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNAGTACTGAAACNAACTTTTGATTNNTCGTTGGATTCAGCCAGTANTTCTATTTCCATTATTTTTCTTCNTGGNCTAGNGTGGTGCTGTTCAACCTTGTACATCATNTNTCATTCCNCATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAANTTGTTCTTNTGTCTCAGCTTATTTAATCAACAGCTNTACCTTNTACTTTNNATATCTNTAAATATANTGCTGCACTGCCTTTCTTTGACATGCCATTTTNTNTTATATAACCATTGGACTTNCAANGTTCATTCTGTAGTGNGAATGCCCNGATAATACTCTATGTCTGCATAGNGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTNTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTG
  3   1   2       bld DMZ  5g3  in                         xl315e13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGATTTTTCCNTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGAT
  3   1   2       bld DMZ  5g3  in                         xl254f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGATTTTTCCTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTTTTTAACCATG
  3   1   2       bld Ga12 5g3  in                         XL217m20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCCTNGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTTTTT
  3   1   2       bld DMZ       in                         xl301o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGGATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATA
  3   1   2       bld DMZ  5g3  in                         xl244k11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGNNTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATT
  3   1   2       bld DMZ       in                         xl241j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTCAGCCAGTAATTCTATTTCCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACNTTCTACTTTNNANATCTTTAAATATACTGNTGCACTGCCTTTCTTNGACATGCCATTTTCTCTNATATAACCATTGGACGTACAATGTTCATTNTGTAGTGNGAATGCCCTGATAATACTNTATGTGNGCATAGTGTCCCATCTTCTANTTAATCAAACAGTACTCTGCAGTCTTTTCANNNGTGGTCCCAGTTATTTNCCAANGAAATACCAGATAGAAAACATTTCNTCAGTTATTCATAATTGTNTTATAGTTATTGTAGTACATNTCCAGCACAGNGACTTGTCATATGCCAATGCAGTCTTGTTNGCNTAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGNTAAGAGTTCCNTGCTACANNTCTATAAAAGGACANNGGTCTGAAACCTGATCNTATTGGCAGCCACTGTCTTCATATGCAATATCCTTNAATTNCGNTGTGTAATGNNATACANTTCANACTAAATA
  3   1   2       bld DMZ                                 rxl311l14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGCCAGTAATTCTATTTNCATTATTTTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATANTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATANTGCTGCACNGCCTTTCTTTGACATGCCATTTTCTNTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATNCTNTATGTCTGCATAGTGTCCCATCCTNNATT
  3   1   2       bld DMZ  5g3  in                         xl273p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGNNTATTTAATCAACAGCTCTACNTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCNTGATAATACTCTANGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTNTCANACCGCTAAGAGTTCCNATGNGACANNGCTNTAAAAGGACA
  3   1   2       bld DMZ  5g3  in                         xl244p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATT
  3   1   2       bld DMZ       in                         xl294m17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTTGGACTAGACTGGTGCTGTTCAACCTNGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATT
  3   1   2       bld DMZ  5g3  in                         xl293d04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGAT
  3   1   2       bld DMZ  5g3  in                         xl250n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTCTTTCCCAATGAAATACCAGNTNGAAAACATTNCATCNGTTATTCNTANTNNTNTNNNAGTTATTCTAGTNCATGTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGNTAAGAGTTCCATGNTACANTTCGNTAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCCTCATATGCAATATCCNTTAATTCNGCTGTGNAANNTTAGACATTTGATATCTAAANATTNACCTGNGTACCTTCTAAGTAGAATTCATAAAAATANNGATTCAAAACAAANGTG
  3   1   2       bld DMZ       in                         xl250p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTTGGACTAGACTGGTGCTGTTCAACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTNGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACNTTNNATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTANTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGNGACTTNTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTNTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTT
  3   1   2       bld DMZ                                 rxl272p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGTGCTGNTCAACNTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTNGTTCTTTTGTCTCAGCTTATNTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATNGCTGCACNGCCNTTCTTNGACANGCCATTTTCTCTTANATAACCATTGGACTTACAATGTTCATTCNGTAGCGTGACTGCCCTGATAATACTCTATGTNTGCATAGTGTCCCATCTTNTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTATATTATAGNTATTCTAGTACATNTCCAGCACAGTGACTTNTCNTANGCCAAGGCAGTNTNGTGTGCATAAGTTTCAAGATGGCATANGTGATGCAGCTCGGTTTCAAACCGCTNAGAGNTCCANGNTNCATTTCTATAAAAGGACNTNGGTCNGAAACNTGATCGTATTGGCAGCCACTGTCNTCATAGGCAATATCC
  3   1   2       bld Tbd7                                 XL063h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCAACCNTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAANTAGAANTCATAAAAAT
  3   1   2       bld DMZ       in                         xl268j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCANCCTTGTACATCNNNTNTCATTCCACATGNTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGT
  3   1   2       bld Neu7 5g3  in                         XL013a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTTGGACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCAATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTCTTATATTAAATAT
  3   1   2       bld Neu7 5g3  in                         XL050a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTATTTTTTTTAACCATTGCATCATAATAAACAAGCT
  3   1   2       bld Neu7      in                         XL027b06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTTGTACATCATTTCTCATTCCACATGTTCAGGATTATATTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAA
  5   1   2       bld Gas8      in                    IMAGE:3516412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGTACATATTTCTATTCCACATGTTCAGATATATTAAAATCCTCCATTGGACAGCCCTGAAATAGTCAGGAATACTAAATTGTTCTTTTGTCTCAGCTTATTTAATAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAAAGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTACATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATC
  5   1   2       bld Gas5      in                    IMAGE:3749826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAATTCCTAAAATCCTCCAGTTGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTNTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATAT
  3   1   2       bld DMZ  5g3  in                         xl330o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTNTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTNTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATT
  3   1   2       bld Neu7      in                         XL031d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGNNATTTTTAAGTAGAATTCATAAAAAT
  3   1   2       bld DMZ  5g3  in                         xl272a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGTNGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTATTCAAACAAATGTG
  3   1   2       bld Neu7 5g3  in                         XL004a16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTNATTTTTTTTAACCATTGCATCATAATAAACAAGCTAAGAANC
  3   1   2       bld Neu7      in                         XL047e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGACAGCCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGNATTTTTTTTAACCATTGCATCA
  3   1   2       bld Ga15      in                       XL436j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNGGACAGCCCTGAAATAGTCAGGAATANTAAATTTGGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCNGAAACCNGATCTTATNGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTA
  3   1   2       bld Neu7 5g3  in                         XL014h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGACAGGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTNATTTTTTTTAACCATTGCATCATAATAAACGAGCTAAGAAAC
  5   1   2       bld Ga15      in                       XL436j14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGACAGCCCTGAAATAGTCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACattttatattaaatatttactgtgtatttttaagtagaattcataaaaatattttattcaaaaaaaaaa
  3   1   2       bld Tbd7 5g3  in                         XL101d04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGACAGCCCTGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTNATTTTTTTAACCATTGCATCATAATAAACAAGCTAAGAAACCCA
  3   1   2       bld Ga12      in                         XL158f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAATAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTGCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAAT
  5   1   2       bld Neu4                            IMAGE:3557633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGCAGGAATACTAAATTTGTTCTTTTGTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTT
  3   1   2       bld Neu7 5g3  in                         XL044f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTCAGCTTATTTAATCAACAGCTCTACCTTCTACTTTCTATATCTTTAAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAAT
  3   1   2       bld Ga15                               XL452e05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTTTCTATATCTNTGAAATATATTGCTGCACNGCCTTTCTTNGACATGCCANGTTCTGTTATATNACCANTGGNCTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATGTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGNTATTCATAATTCTATTATAGNTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTNGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAANCCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACANTGGTCTGAAACCTGATCTTANTGGCAGCCACTGTCNTCATANGCAATATCCT
  5   1   2       bld Tbd3      in                    IMAGE:3550337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTAGAGCTGTTGATTAAATTATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGAttttttttAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTTaaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL416o06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTTCTATATCNTTAAATATATTGCTGCACTGCCTTTNNTTGGCATGCCATTTTCTNTTATATAACCATTGGNCNNACAATGNTCATTCTGTAGTGTGACTGCCCTGATAATACTCTANGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATANGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTNTAATTCTGGCTGTGTAATGTTATACATTTTATATTAAATATTT
  3   1   2       bld Ga15                               XL497e17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTNNATATCTTTAAATATATNGCTGCACTGCCTTTCTTTGACATGCCATTTTCTNNTATATAACCATGGGACTTACAATGTTCATTCTGTAGGGTGAATGCCCTGATAATACTCTATGTNTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTNTCATATGTGGTCCCAGTTATTTCCCAANGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACA
  5   1   2       bld Ga15      in                       XL448m17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATATATTGCTGCACTGCCTTTCTTTGACATGCCATTTTCTCTTATATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGAttttttttAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL487e14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCATTTTCTCTTATATNNCCATTGGACTNACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTGTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCNATGAAATACCAGATAGAAAACATTTCATCAGNTATTCATAATTCCTATTATAGTTATTCTAGTNCATTTCCAGCACAGTGACTTNTCATATGCCAATGCAGTCGGTGTTTGCATNAGCTTCAAGATGGCATNAGTGANGCAGCTCGGTTTCAAACCGTTAAGAGTTCCAT
  3   1   2       bld Gas8      in                    IMAGE:3516412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTCTCTTATATAACCATTGGACTTACAAAGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTACATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGGGATTTTTTTTAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd3      in                    IMAGE:3550337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAACCATTGGACTTACAATGTTCATTCTGTAGTGTGAATGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGGATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAAAACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGTTTTTTTTAACGATGCATCATAATAAACAAGCTAAAAAACCCAGTTAAAAAAAAAAAAAGAGGTTTTTCCGCGGCACTGTTATGACGGNTGTTATTCCACTCGGGNTTTGCAACATTTTTTA
  3   1   2       bld Gas5      in                    IMAGE:3749826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATTGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTTTTTTAAGTAGAATTCATAAAAATATTTTATCAAA
  3   1   2       bld Neu7 5g3  in                         XL006m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGACTTACAATGTTCATTCTGTAGTGTGACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAAT
  3   1   2       bld Tbd3 5g3  in                    IMAGE:3550157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTGCCCTGATAATACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCCCTAAGAGTTCCATGCTACATTTCTATAAAAGGACAAAGAAAATGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTTTTTTTAACCATTGCATCAGAATAAACAAGCTAAGAAACCCAGTTAAAAAAAAAAAA
  3   1   2       bld Neu1 5g3  in                        Neu1-12E2.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACTCTATGTCTGCATAGTGTCCCATCTTCTATTTAATCAAACAGTACTCTGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTC
  3   1   2       bld Ga15 5g3  in                       XL467o18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATTTAATCAAACAGTACTCNGCAGTCTTTTCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGC
  3   1   2       bld Ga15      in                       XL448m17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGTCTTTNCATATGTGGTCCCAGTTATTTCCCAATGAAATACCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTNTAGTACATTTCCAGCACAGTGACTTCTCATAGGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTAGTTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCNGTGTAATGTTATACATTTTATATTAAATATTTAGCNGTGTATTTTTAAGGNAGAATTCATAAAAATATTTTAT
  3   1   2       bld Neu7      in                         XL040m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCATATGTGGTNCCAGTTATTTNCCAATGNAATNCCAGATAGAAAACATTTCATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGNCTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGNATTTTTTTTAACC
  3   1   2       bld Gas8      in                    IMAGE:3517272.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGTTATTCATAATTCTATTATAGTTATTCTAGTACATTTCCAGCACAGTGACTTCTCATATGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGGGATTTTTTTTAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTTAAAA
  3   1   2       bld Ga15                               XL440n18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCAATGCAGTCTTGTTTGCATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATNGGTCNGAAACCTGATCTTATTGGCAGCCACNGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTA
  5   1   2       bld Ga15      in                       XL451e07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGAttttttttAACCATTGCATCATAATAAACAAGCTAAGAAACCCAGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL451e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAGTTTCAAGATGGCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTACTGTGTATTTTTAAGTAGAATTCATAAAAATATTTTATTCAAACAAATGTGTGATTTTTTTAACCA
  3   1   2       bld Ga15                               XL475m24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATAAGTGATGCAGCTCGGTTTCAAACCGCTAAGAGTTCCATGCTACATTTCTATAAAAGGACATTGGTCTGAAACCTGATCTTATTGGCAGCCACTGTCTTCATATGCAATATCCTTTAATTCTGCTGTGTAATGTTATACATTTTATATTAAATATTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)