Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 70%

 1012767406 Xl3.1-XL515f08ex.5 - 108 ESTs
                                                                       .........-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL515f08ex.5                                                                                GAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAATTGCATCCTTTCACCAGAAAAAAA
                                                  Xl3.1-CHK-1012685545                                                                                      CCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATATATCATACAATAAAATTGCATCCTTTCACCAGA
                                                      consensus depths                                                                                    26    37    42    51    46    57    54    65    54    69    59    72    60    73    60    76    64    80    67    84    60    83    66    84    68    85    68    86    69    86    72    87    78    87    80    87    81    87    83    88    80    89    84    90    80    91    69    93    86    93    87    92    86    92    90    94    89    94    88    94    89    94    89    93    85    93    92    94    89    94    90    94    86    95    87    95    69    94    82    95    85    95    82    97    84    97    85    97    76    98    76    97    73    97    71    97    75    97    73    96    75    97    72    95    71    93    67    93    69    93    66    93    64    88    59    87    53    81    52    80    31    78    16    59    21    42    15    30     9    25     5    15
                                                                   SNP                                                                                                                                                                                                                                                                                C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                        ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                        ----T--C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                    -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                            -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------C-G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------C-A
                                               BLH ATG      47      68                                                                                
                                               BLH MIN      47      79                                                                                
                                               BLH OVR      47      30                                                                                
                                               CDS MIN      47      56                                                                                
                                               EST CLI       8      56                                                                                
                                               ORF LNG      47       2                                                                                
  3  -1   2       bld Ga11                            IMAGE:3475373.3p CCCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGCCTTACCGCAGAGACGCCTTTGTAGATTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGCCCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCCTGACGTTACCGAATATCATGCAGTTATCTAT
  5   1   2       bld Ov1  5g                         IMAGE:5074516.5p                    gatatcgtcgacccacgcgtccgcggacgcgtgggtcgacccacgcgtccgcTTACCGCAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGC
  5   1   2       chi Tad1                            IMAGE:6937743.5p                                                        GGGACTGTTGTGCTCCTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGCTAAACGTAATGTGCTTGAGGAGAGCGCACGGATTGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCACCGTACTGGCTGCAAAGCTCTTTTCCTGGGATGTGAAACTGACTGTCGGGCTGTTCATACCGAAGTGTGAAAAAAGTGGCCCATAATGCAGGGCACCAGCAAGCCTGCCCATTTAAGGGACCTTCGGAAAGCCAACCACCTTCAATCCAACCAAAGGGGAAGGTGAAGGTCCCTTGTGGGCATGCCAAAGAAACAAGGTTTGGTTCCCCCACCCAGCCGCCCTTTTATGGTTGTAACCAGTTCCAAGTTTCATTTGAGGATTTTATGTACCGGCCTTTTGGGGGAAAAATGGGTGGAAAAACCCCTTTTCCTAAAACCTTAAACAAATTGGAATAACACCCTTATTCTCCAACGTAGTTCTGATTTTCAAAAGAGGGGGGAATTTTATTAATATCCACAAAAACATTTAAAATGTGCGCCCCCCCTTTT
  3   1   2       bld DMZ  5g3  in                         xl264k09.3p                                                                  CGAATTCGGCACGAGGGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAACTCTTTCCTGGATGTGAACTGACCGTCGGCTATGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATG
  3   1   2       bld DMZ  5g3  in                         xl286n11.3p                                                                    AATTCGNCACGAGGGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAACTCTTTCCTGGATGTGAACTGACCGTCGGCTATGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTAAAAT
  5   1   2       bld DMZ  5g3  in                         xl248m07.5p                                                                    CTCCTTACCGCAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAA
  5   1   2       bld Ga15 5g3  in                       XL404j08ex.5p                                                                      CCTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCANATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGANATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATATATCATACAATAAAA
  5   1   2       bld Skin 5g                         IMAGE:8644234.5p                                                                      CCTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCCCAGCGCCTTTTGTGTACAGTCCGTTCATGAGATTATGACGGCTTGGGGAAATGGTGAAATCGTCTGAGCTACAAATGATACAGATTCCGAAGGTATTAATGTGGATTTTATCTACATAAATGCTCCTCCCaaaaaaaaaaaaaaaaaGCGCGCAGGCGATTCAACGCGCAGCTCGCCTAGATCATCTA
  3   1   2       bld DMZ  5g3  in                         xl278j19.3p                                                                      GCTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGTTTATTTAAAATG
  5   1   2       bld Brn3 5g                         IMAGE:8540288.5p                                                                       CTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCATGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATNCACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACAGCGCCTTTATGTGTACAGTCAGTTCATGAGATTATGAGGCATTGGGAATGTGAATCCTTCTGAGCTACAAATGATACGTATTCTGAGGTATTCAAGTGTATTTTTCTACATAAATGCTCCTTTCGaaaaanaaannaaaaaaaaannaaanaaatataaannnttnnnnnnnaaaaaGGGGCGTCCTTTCCCTCCT
  5   1   2       bld Brn3 5g                         IMAGE:8541080.5p                                                                       CTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTACAGTCCAGTTCATGAGATTATGACGGCATTGGGGAATGGGTGAATCGTCTGAGCTACAAATGATACAGTATCATGAGGGTATTCAATGTGTATATATTCTACATAAATGCTCTTTACAGaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCNNAGGGGGTGCAAGCGATGCTTCGCTGGCTCATCTA
  5   1   2       bld DMZ  5g3  in                         xl278j19.5p                                                                       CTTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCAT
  3   1   2       bld DMZ  5g3  in                         xl292m05.3p                                                                       ACGAGGGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCACGAGGGTTATTTAAA
  5   1   2       bld DMZ  5g3  in                         xl328l19.5p                                                                       CTTACCGCAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCT
  3   1   2       bld Ga18 5g3  in                      xlk151g21ex.3p                                                                        TCNNNGNAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGNAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNNAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCNCGAGGGTTTTTTAAAATGTGNNNNNNNATATCNTACNA
  3   1   2       bld DMZ  5g3  in                         xl256i02.3p                                                                        GCACGAGGGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCACGAGGGTTATTTAAAATG
  5   1   2       bld Ga18 5g3  in                       xlk72g08ex.5p                                                                         CTTACCGCAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGNTGCAAGNACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGANTTATGACGGCATTNGGGAAATGGNGAAATCCNGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATGTGNNNNTTNTATATCGTNNA
  3   1   2       bld DMZ  5g3  in                         xl259a05.3p                                                                         GGCACGAGGGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAACTCTTTCCTGGATGTGAACTGACCGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCATGAGGGTT
  3   1   2       bld DMZ  5g3  in                         xl253o15.3p                                                                         GAGGGCAGAGACACATTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCATGAGGGTTATTTAAAATATG
  3   1   2       bld Ga18 5g3  in                      xlk143n21ex.3p                                                                          ACCGNAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGNAGANCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTCAAATGTGTATTTATATNTCATA
  5   1   2       bld Ga18 5g3  in                       xlk71a06ex.5p                                                                          TTACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGNAGNNATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGNTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGNCTGTGATACAGAGNGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTNAGGAGCTCGNNTGCAAGNACATCAACAAGCAAGTGAGTGAAGNCCATGTGGATGCAAAGAACAAGTTGGTCNNCACCNG
  3   1   2       bld Ga18 5g3  in                       xlk71a06ex.3p                                                                          ACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGTTTATTTAAAATGTGTATTTANNNNNNTAC
  3   1   2       bld Ga18 5g3  in                       xlk72g08ex.3p                                                                          ACCGCAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAANCTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGNAGANCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATGTGTATTTATATATCGTA
  5   1   2       bld Brn3 5x3                        IMAGE:8539366.5p                                                                           CCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTTGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTNAACAATTTGATACAGTATTCACGAGGGTTTTTTAAATGTG
  3   1   2       bld Ga18 5g3  in                       xlk67k14ex.3p                                                                           CNNNNNNCGCNNCTTTGTGTTTNCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGNAGANCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCTAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCAGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTCAAATGTGTATTTATATAT
  5   1   2       bld Brn3 5g                         IMAGE:8541159.5p                                                                            CGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCCCACCAGCGCCTTTATGTGTACAGTCCAGTCATGAGATTATGACNGCATGGGGAATGGTGAATCCGTCTGAGCTACAATTGATACAGTATCATGAGGTATTNAATGTGTATATATTCTACATAAATTCATCTTCACaaaaaaaaaaaaaaaaaaaaaaaaGGCGCGCAGCTGATCCGACGGCTGGCTTGCTATGATT
  5   1   2       bld Skin 5g                         IMAGE:8640196.5p                                                                            CGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCATTCATGAGATTATGACGGCATTGGGGAATGGTGAATCAGTCTGAGCTACAATTGATACAGTATCATGAGGTATTCAATGTGATTATTTCATACATAAATGCTCTTTACAGaaaaaaaaaaaaaaaaaaGGCGCGCAGCTGATCCGACGGCTCGCTTGCTATGGCTATCTACGACGAAACTGGGTG
  5   1   2       bld Ga18 5g3  in                      xlk143n21ex.5p                                                                            ACCGCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCANNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGNTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGNCATATGCAGGCACAGCAGCTGNCATTAAGGAGCTCGGNTGCAANNACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAANAGTCCAGTTCATGAGATTTNTGACGGCATTGGGGAAATGGTGAAATCCNTTCTGAAGCTAACAAATTGATAACAGNNTTCATGAGGGTTATTTCAAATGNNNNTTTNTNT
  5   1   2       bld DMZ  5g3  in                         xl253o15.5p                                                                             GCAGAGACACATTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTANCAAATTGATAACAGTATTCA
  5   1   2       bld DMZ  5g3  in                         xl292m05.5p                                                                             GCAGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCT
  5   1   2      seed Ga15 5x3                           XL515f08ex.5p                                                                              CAGAGACACATTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAATTGCATCCTTTCACC
  5   1   2       bld DMZ  5g3  in                         xl267m06.5p                                                                              CAGAGACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATT
  3   1   2       bld DMZ  5g3  in                         xl230k20.3p                                                                              GGGAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTATTTAAA
  5   1   2       bld DMZ  5g3  in                         xl230k20.5p                                                                                GAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGG
  5   1   2       bld DMZ  5g3  in                         xl302l02.5p                                                                                GAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTA
  5   1   2       bld DMZ  5g3  in                         xl256i02.5p                                                                                GAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACG
  5   1   2       bld DMZ  5g                              xl309i15.5p                                                                                GAGACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGTTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAAATCAGTTCTGA
  5   1   2       bld Ga18 5x                            xlk51k23ex.5p                                                                                 AGAGNNACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCANNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGNAGNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGNTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGNCACAGNAGCTGNCATTAAGGAGCTCGGCTGCAANNACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGNNNAGTCCAGTNCATGAGATTTATGACGGCATTGGGGAAATNNNGAAATCCGTTCTGAAGCTNACAAATTGATAACAGTATTCATGAGGGTTATTTCAAATGT
  5   1   2       bld Gas5 5g                         IMAGE:3747972.5p                                                                                  GACGCCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGGGAGATTCACGAGTCGTCGGCTGTATACGTGCACCTC
  5   1   2       bld DMZ  5g3  in                         xl286n11.5p                                                                                  GACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAACTCTTTCCTGGATGTGAACTGACCGTCGGCTATGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTG
  5   1   2       bld DMZ  5g3  in                         xl264k09.5p                                                                                  GACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAACTCTTTCCTGGATGTGAACTGACCGTCGGCTATGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCAT
  5   1   2       bld DMZ  5g3  in                         xl259a05.5p                                                                                  GACACCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAACTCTTTCCTGGATGTGAACTGACCGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAA
  5   1   2       bld Ga18 5g3  in                      xlk151g21ex.5p                                                                                   GNGNCNNNTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGNAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCNNNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGNAGNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGNACATCAACNAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGNCACCACCAGCGCCTTTATGTGTAACAGTCCAGTNCATGAGATTTATGACGGCATTGGGGAAANGGTGAAATCCGTTCTGANGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATGTGTATTTATATATCGTA
  5   1   2       bld Emb1 5x3                        IMAGE:6630940.5p                                                                                     ACATTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAATCCAGTTCATGAGATTTATGACGGCATTGGGGAAAATGGTGAAATCCCGTTCTGAAAGCTAACAAATTTGATAACAGTATTTCACGAGGGGTTATTTTAAAAATGGGGAATTTTNATATATCCNNTACCATTTAAAAATTGA
  5   1   2       bld Gas5 5g3  in                    IMAGE:3747900.5p                                                                                      CCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAAACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGTCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGACGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGAGCTGTGAAAGGAAAGGATTGTTCATTTGCAAACGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGATACCCATCGGACTGTGCTGTGTCTCCCCCTGACTGGCTGCAAAGCTCTGTCCTGGATGTGAACTGACTGTCGGCTGGGATACAGAGTGTGACAAGTGGCCATATGCAGGCACATCAACTGACGTTACTGAGCTCCGATGCAATCACATCATCAAGCTACGTAATGACAGTCATGTGGATGCGGAGAACAAAGTTGGTACC
  5   1   2       bld Ga15 5g3  in                       XL509m12ex.5p                                                                                      CCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACNAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCANACATAGATCAGATGCACGTANTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCNCAAGAGGGAATATCANAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCACGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTC
  5   1   2       bld Ga15 5g3  in                       XL412d08ex.5p                                                                                       ATTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAAATTTCATCCTTTCACCANaaaaaaaa
  5   1   2       bld Ga18 5g                           xlk107m21ex.5p                                                                                         CTTTGTGTTTGCNGCTCTCCCTGAAACTATGGNTNAGAAGGNGGCAGTGATCCTTGCTGGCTGTGGGGNTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCNGNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGANTGTTCNGTTGCAAAAGAGGNTGAAGCCGTTATCAAAGGATTCCATGNAGCCAAGAAACCCATCGGNTTGTGCTGTATCTCCCCNGNACTGGCTGC
  5   1   2       bld Ga18 5g3  in                       xlk67k14ex.5p                                                                                          CCTTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCANNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGNAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCTAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTNNNNATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGNTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGNAGCTGCCATTAAGGAGCTCGGCTGCAANNACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTANCAGTCCAGTTCATGAGANTTNTGACGGCATTGGGGAAATGGTGAAATCAGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGNNTNTTTCAAATGTNTATTTATATATCATANANAAAANTGCATCNTTTTACCANNNNaaaaaaaaa
  5   1   2       bld Ga12 5g3  in                         XL159m17.5p                                                                                            GGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACA
  3   1   2       bld DMZ  5g3  in                         xl248m07.3p                                                                                            TGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCCACGAGGGTTTTTTAAA
  5   1   2       bld Ga14 5g                             Ga14-p5a3.5p                                                                                              TAGCAGCTCTCCCTGNAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATTGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATGTTCAG
  3   1   2       bld Ga18                              rxlk61j10ex.3p                                                                                              CGGCCCNNNNNCGCTGAAACTATGGCTAAGAAGNTGGCAGTGANNNNTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCNCCTTANNAGANNCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNNAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTNNNNNAATGTGTATTTATAT
  3   1   2       bld Ga18 5g3  in                      xlk143k19ex.3p                                                                                              TTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGNAGANCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNNAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTCAAATGTGTATTTATATNTCATACNNA
  5   1   2       bld Ga18 5g3  in                      xlk143k19ex.5p                                                                                                 TTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGNAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGNNNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGNAGNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGACGNTNNNNATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTAAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGNAGCTGNCATTAAGGAGCTCGGNTGCAANNACATCAACAAGCAAGTGAGTGAAGNCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTNNNNTCCAGTTCATGAGATTTATGACGGCATTNGGGAAATGGNGAAATCCNNTCTGAAGCTAACAAANTGATAACAGTATTCATGAGGGTTATTTCAAATGTGTATTTATATATCATACAATAAAATTGCATCCTTTTNNNNG
  5   1   2       bld Neu7 5g3  in                         XL011b20.5p                                                                                                  GAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAA
  5   1   2       bld Brn3 5x3                        IMAGE:8538109.5p                                                                                                       TCTCCCTGAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGTTTATTTNAAA
  5   1   2       bld Egg5 5g3  in                    IMAGE:3431804.5p                                                                                                           CTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATTGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGAGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAAGTTGAAGCAGTTATCAAAAGATTGCATGGAACCAATAAACCCATTCGTTTGTGCTTTATCTTCCCCATACTAGCTTGCAAAAACCTC
  5   1   2       bld Gas3 5g3  in                      xlnga001f06.5p                                                                                                            GAAACTATGGCTAATAATGCGGCAGTGACCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCAGCTGTATACGTTCACCTTATCAGAGCCGGAGCTCAGACTGAATTATTTGCCCCACACATAGATCAGATGCACGTACTGAATCACATCAGCAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTATAGACCTTGACGTTAGTGAATATGACGTAGCTATTATACCAGGAAGCTTTGGAGTTGCCAAAAACCTTTCTACCTGAGCTGAGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTTCATGGAGCCAAGAAACCCATCGGTATGTGCTGTATCTNCCCCGTACTGACTGCAAAGCTCTTTCTCTGATGTGAACTGACTGATCGATGTGATACAGAGTGCGAATAGTGGGCATATGCANGCACAGCAGCTGCCATAA
  3   1   2       bld DMZ  5g3  in                         xl328l19.3p                                                                                                            TGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATG
  5   1   2       chi DMZ       in                         xl289g19.5p                                                                                                             CACATTTGTGTTTGCAGCTCTCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATA
  3   1   2       bld Ga15 5g3  in                       XL509m12ex.3p                                                                                                                ACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTAAAATGTGTATTA
  3   1   2       bld Ga15 5g3  in                       XL404j08ex.3p                                                                                                                   ATGGCTAAGAAGGTGGCAGTGATCNTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTAT
  3   1   2       bld DMZ  5g3  in                         xl302l02.3p                                                                                                                   ATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTATTTAAAATG
  5   1   2       bld Neu7      in                         XL046a08.5p                                                                                                                    TGGCTAANAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGNATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATTGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGATGCAAGCACATCAACAAGCAAGTGAGTGAA
  5  -1   2       bld DMZ       out                        xl294e01.5p                                                                                                                      GCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGAT
  3   1   2       bld Ga12                                 XL148a24.3p                                                                                                                       TAAGAAGGTGGCAGTGATCCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGTTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCAGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATACAATAAAATTTCATCCTTCACCA
  3   1   2       bld Ga15 5g3  in                       XL412d08ex.3p                                                                                                                       TAAGAAGGTGGCAGTGGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCCATGAGGGTTATTTAAAATAT
  3   1   2       bld Ga15                               XL401a17ex.3p                                                                                                                               TGGCAGTGATCCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCCACGAGGTTTATTTAAAATGTGTA
  5   1   2       bld Skin                            IMAGE:8642826.5p                                                                                                                                 GGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAGCTAACAATTGATACAGTATTCTGAGGGTATTTAAATGTGTATTATATATCATACATAAATTCATCTTTCACaaaaaaaaaaaaaaaaaaaaGGCGCGCAGGCTGAATCCTAGACGCGTCGGCTCCCCTAATGACGATACTAATCGATGAAATCTGTGATTGAACCACGATGTGAAAGTATGGATGGACTGTT
  3   1   2       chi DMZ       in                         xl289g19.3p                                                                                                                                 TCCCTGAAACTATGGCTAAGAAGGTGGCAGTGATCCTTGCTGGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTAAAATA
  3   1   2       bld Neu7      in                         XL046a08.3p                                                                                                                                            GGCTGTGGGGTTTATGATGGCAGTGAGATTCACGAGTCCGTCGGCTGTATACGTTCCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGAATCAGATGCACGTAGTGAATCACATCAAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATTGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGATGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTAAAGCTAACAAATTGATAACAGTATTCACAATAGTTATTTAAAATGTGTATTTATATATCATACAATAAAATTGC
  3   1   2       bld Ga18                              rxlk54i22ex.3p                                                                                                                                             TTNCTGGCTNNGGGTTNATGATGGCAGTNAGATTCACGAGTCGTCGGCTGTANACGTTCNCCTTAGNNGANNCGGAGCTCAGACTGAATTTTTTGCCCCNAACATAGATNAGATGCACGTAGTGAATCACATCAAAGGGCTGCCNACAGNAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGNCCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAANCCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNNAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNNAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTNNNNNAATGTGTATTNANNTNNCNNAC
  3   1   2       bld Neu7 5g3  in                         XL011b20.3p                                                                                                                                                           TTTATGATGGCAGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAATTTCAT
  5   1   2       bld Ga15      in                       XL466p10ex.5p                                                                                                                                                               CTCCGCGGACGCGCTGGGCGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAATTGCATCCTTTCACCCGAAAAAANAAA
  5   1   2       bld Skin                            IMAGE:8641745.5p                                                                                                                                                                 ATGGCGGTGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACACCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGAGGATTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGTTTATTTAAATGTGTATTATATATCATACATAAATGCATCTTTCACAGaaaaaaaaaaaaaaaaaaGGGCGGCGCAGGCTGATTCTCTAGACGCGCTCAGCTCTCGCTAATGAGCGATACTAATCAGATGAAGATCTGTGATTGGACACCACTGATGATGAAATGTT
  3   1   2       bld Ga18      in                       xlk78n13ex.3p                                                                                                                                                                        TGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTANNAGANNCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGNCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNNAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATNTNNCANAC
  5   1   2       bld Ga18      in                       xlk78n13ex.5p                                                                                                                                                                           TGAGATTCACGAGTCGTCGGCTGTATACGTTCACCTTAGCAGANNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACNNNNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGNTGCAAGNATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGANTTATGACGGCATTGGGGAAATGGNGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATATATCATACANNAAATTTCATCCTTTCAC
  3   1   2       chi Neu7      in                         XL025d22.3p                                                                                                                                                                               GAGAGAAATGCATTTCTGGAAAAATACCCAAAAATAGAGACAACTGAAGCCTAAATAGGCCAAAGAGACTCNTTCTACAAGCCCATTATAACAACACTTGGGGCATTCCATAAATCCCACGTAGTAACATAGCAAAAATATCAGCACAGTTTTGCCCTATGCTGTACCCTTGAATTACAGAACACCCAGGTTCGTAAAGATGAATCTGTATATCAATAGTCCTTTTAAATTTCTGAAGACCCAATATCTTATGTAATTGTATTTTAGTACCTTGCAAGGACCTTATTCTCCATCTAGCCTGCAAGGGCTCATTGCTTTTGTCTCTAAAACTGGAAATACAGAGACATTTTAACATGAAACTCTCTCTATGTAAAAATGAGAAGTTGCTGTTGTCCCTAAACTTTCATTTGTTTGTTCTATAGGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTATTTAAAATGTGTATTTATATATCATACAATAAAATTGCANCCTTCACCA
  3   1   2       bld Ga18      in                      xlk133d05ex.3p                                                                                                                                                                               CACGAGTCGTCGGCTGTATACGTTCACCTTAGNAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTNCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCANNNCAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATNT
  3   1   2       bld Ga15      in                       XL466p10ex.3p                                                                                                                                                                                 CGAGTCGTCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATA
  5   1   2       bld Ga18      in                      xlk133d05ex.5p                                                                                                                                                                                     GAGTCGTCGGCTGTATACGTTCACCTTAGCAGANNNGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACNNNNNATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGACCTTGACGTTAGNGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCNNNNNNTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGNAGCTGCCATTAAGGAGCTCGGNTGCAAGNATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGNTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAANGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGNGTATNATATATCATACAATAAAATTTCATCCTTTCNC
  5   1   2       chi Neu7      in                         XL025d22.5p                                                                                                                                                                                      AATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGATCTCAAAGACCTTGATGTTAGTGAATATGATGCAGTTATTATACCAGGTAACATAGATCTTTCTGGGTCTATACACAATACATACAAATGTTAAGATTCTAGAAGAAATCATTAAACTTTGAATGTGTTTTTGGTTATTCATTATTGATTTATCATTGAATTTTAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTACGTCCAACCTTTGGTAGCACTTTtaaaaactcaacataaaactataactaaaaaactaaaaaaaaCTTGTTCCTAAATTGGATGAAAGTTGAATAGACATTCAGAGACTTGTGTATCTGGAATAGAGAGAGAAATGCATTTCTGGAAAAATACCCAAAAATAGAGACAACTGAAGCCTAAAT
  3   1   2       bld DMZ  5g3  in                         xl267m06.3p                                                                                                                                                                                        TCGGCTGTATACGTTCACCTTAGCAGAGCCGGAGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCCACGAGGGTTTTTTAAAAT
  3   1   2       bld Gas3 5g3  in                      xlnga001f06.3p                                                                                                                                                                                                         CACCTAGCCAGAGCTGGAGCTCAGACTGATTTTCTTGCAGCAAACATAGATCACATGCACGTAGTGAATCCATCATAGGGCTGCCTCAGAAGATCAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCATAGACCTTAAAGACCTTGACGTTAGTGAATATGATGTAGTTATCATACCAGGAGGTTTTGAAGTTGCCGAAAACCTTTCCACCTGGGCTGTGAAAGGAAAGGATTGGTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTCTGTGCTGTATCTCCCCCGCACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGTTGTCATACAGAGTGTGAATAGTGTCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCGCATCAGCAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCTCCCCCAGCGCCTTTATGTGTCACAGTCCAGTTCATGAGATTTATGTCGGCATTGGGGAAATGGTGAAATCAGTTCTGAAGCTATCAAATTGATCACAGTATTCATGAGCGTTATTTAAAATGCGTATTTATACAATAAAATTTCATCCTTTCACCAGACAAAGAAAAA
  3   1   2       bld Ga12 5g3  in                         XL159m17.3p                                                                                                                                                                                                                        AGCTCAGACTGAATTTTTTGCCCCAAACATAGATCAGATGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATGTGTATTTATATATCGTACA
  3   1   2       bld Gas5 5g3  in                    IMAGE:3747900.3p                                                                                                                                                                                                                                  GAATTTTTCGCCCCAAACATAGATCAGATGCATGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGTAATGTGCTTGAGGAGAGCGCTCGGATCGCAAGAGGGAATATCATAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAACAACCTTTCTACGTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATGTGTATTTATATATCGTACAATAAAATTGCATCCTTTCTCCAGAA
  5   1   2       bld Ga15                               XL450d14ex.5p                                                                                                                                                                                                                                                              TGCACGTAGTGAATCACATCAAAGGGCTGCCCACAGAAGATAAACGCAATGTGCTTGAGGAGAGCGCACGGATCGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAATTGCATCCTTTCACCAGaaaaaaaaaa
  3   1   2       bld Egg5 5g3  in                    IMAGE:3431804.3p                                                                                                                                                                                                                                                                                                                   CTTGAGGAGAGCGCACGGATTGCAAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTAAAGCTAACAAATTGATAACAGTATTCACAATAGTTATTTAAAATG
  3   1   2       bld Egg6                            IMAGE:4432828.3p                                                                                                                                                                                                                                                                                                                         AGCCCCCGGTTTGCCAAGCCGAACAACCTAACCCTCCTAGTGTCTTCGACGTCAATGCAAACTCACCCCGTTTTTTCCCAGCAGGGTTTGGGAGTGGCCCAAACCCTTTCACCCGGGGCTGGAAAAGGAAAGGGTGGTCCCGCTGCAAAGAGGGTTAAGCCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGGGCTGAATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGATCGGGTGCAAGCACATCTACAAGCAAGTGAGTAAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAA
  5   1   2       bld Ga15                               XL449b13ex.5p                                                                                                                                                                                                                                                                                                                                          AAGAGGGAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAA
  5   1   2       bld Gas5                            IMAGE:3750638.5p                                                                                                                                                                                                                                                                                                                                                GAATATCAAAGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTT
  3   1   2       bld DMZ       in                         xl271a14.3p                                                                                                                                                                                                                                                                                                                                                         AGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGATGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACCAGTATTCACAATAGTTATTTAAAAT
  5   1   2       bld DMZ       in                         xl271a14.5p                                                                                                                                                                                                                                                                                                                                                         AGACCTTAAAGATCTTGACGTTAGTGAATATGATGCAGTTATTATACCAGGAGGTTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGATGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACAATAGTTATTTAAAATGTGTATTTATATATCATACAATAAAATTGCATCCTTTCACCAGaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL405b14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                               TTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATGTGTATTTATATATCGTACAATAAAATTGCATCCTTTCTCCAGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL405b14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                               TTTTGGAGTTGCCAAAAACCTTTCTACCTGGGCTGTGAAAGGAAAGGATTGTTCAGTTGCAAAAGAGGTTGAAGCCGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTTCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCAGCGAGGGTTTTTTAAAATGTGTATTTAT
  5   1   2       bld Tbd1                                 AW765092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTGTTCAGTTGCAAAAGAGGTTGAAGCAGTTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATNTAAAATGTGTATTTATATATCATACAATAAAATNTCATCCTTT
  3   1   2       bld Tbd1                                 AW764556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATCAAAGGATTCCATGGAGCCAAGAAACCCATCGGTTTGTGCTGTATCTCCCCCGTACTGGCTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCATATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATGTGTATTTATATATCATACAATAAAATTTCATCCTTTCACCAAA
  5   1   2       bld Ga15                               XL460c12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACCCATCGGTTTGTGCTGTATCTCCCCCGTTACTGGCTGCNAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACNNAGTGTGAAAAGTGGCCATATGCANGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCNAGCACATCAACGAGCAAGTGAGTGAAGTTCATGTGGATGCNAAGAACAAGTTGGTCACCACCANCGCCTTTATGTGTAACAGNCCAGTTCATGAGATTTANGACGGCATTGGGGAAATGGTGAAATCANTTCTGAAGCTAACAAATTGATAACAGTATTCATGANGGTTATTTCNNATGTGTATTTATATATCATACNATAAAATTGCNTCCTTTTACCNNAAAANAAA
  3   1   2       bld DMZ                                 rxl317g15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGTACTGGCTGCAAAGCTCTTTNCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACANGCAAGNGAGTGAAGTCCATNTGGATGCAANGNACAAGTTGGTCNCCACCAGCG
  5   1   2       bld Ga15      in                       XL436m15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGGGTTATTTAAAATATGTATTTATATATCATACAATAAAATTGCATCCTTTCACCAGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL436m15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCAAAGCTCTTTCCTGGATGTGAACTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAANCAGTATTCATGAGGGGTTATTTAAAATATGTATT
  5   1   2       bld Ga15      in                       XL434p19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTATTTAAAATGTGTATTTATATATCATACAATAAAATTGCATCCTTTCACCAGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL434p19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGACTGTCGGCTGTGATACAGAGTGTGAAAAGTGGCCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCAGCGAGGGTTATTTAAAATGTGTATT
  3   1   2       bld Gas8                            IMAGE:3517622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATATGCAGGCACAGCAGCTGCCATTAAGGAGCTCGGATGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGAATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGGCGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAA
  3   1   2       bld Egg1                            IMAGE:4678009.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCGGCTGCAAGCACATCAACAAGCAAGTGAGTGAAGTCCATGTGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCAGTTCTGAAGCTAACAAATTGATAACAGTATTCATGAGCGTTATTTGGAATGTGTATTTATACAATAAAATTTCATCCTTTCNCCAGAA
  3   1   2       bld Ga15      out                      XL508d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATG
  3   1   2       bld Ga15      out                      XL509d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGATGCAAAGAACAAGTTGGTCACCACCAGCGCCTTTATGTGTAACAGTCCAGTTCATGAGATTTATGACGGCATTGGGGAAATGGTGAAATCCGTTCTGAAGCTAACAAATTGATAACAGTATTCACGAGGGTTTTTTAAAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)