Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012767420 Xl3.1-xlk137a11ex.3 - 168 ESTs
                                                                       ........-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk137a11ex.3                                                                               AAACTTCTGAGAGCAGAGATGCTGCCGGAAGTCCCGCCCTCCCTGCAGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACAAA
                                                  Xl3.1-CHK-1012685246                                                                                     CTGAGAGCAGAGATGCTGCCGGAAGTCCCGCCCTCCCTGCAGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACAAAGCAAAA
                                                      consensus depths                                                                                    3     4     3     4     3     4     4     6     6     7     9    12    17    20    28    38    34    46    50    54    53    59    55    60    59    63    62    66    62    66    61    65    61    65    64    69    63    69    65    69    65    69    65    69    65    69    61    69    65    70    68    72    67    72    67    72    66    73    67    72    67    72    66    74    70    75    72    75    72    75    74    76    73    74    72    73    70    75    73    75    70    74    71    73    68    72    68    72    70    73    70    74    64    72    67    73    68    74    55    74    69    75    62    74    63    75    61    73    57    71    56    71    57    70    54    69    50    66    54    69    44    68    51    70    50    69    42    68    36    66    35    62    35    61    31    55    30    53    37    61    39    61    42    65    51    68    58    71    55    71    55    71    56    70    60    73    63    73    63    73    67    74    71    76    71    77    71    78    75    79    77    79    79    80    76    81    80    82    80    81    79    81    80    80    81    81    76    81    74    80    73    73    72    72    73    73    74    74    72    74    72    73    73    74    52    74    52    74    52    74    52    74    50    73    52    75    51    74    49    74    50    74    50    74    50    74    50    75    50    75    50    74    50    74    50    74    49    74    49    74    49    74    49    73    49    73    49    74    51    74    50    74    50    74    49    74    47    73    47    70    45    69    43    68    26    59    15    45     9    21     5    12     4     8
                                                                   VAR                                                                                                                                                                               AGGTGTGGAGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAA
                                                                   SNP                                                                                                                                                                                           ---------A--
                                                                   SNP                                                                                                                                                                                                       ----G-------
                                                                   SNP                                                                                                                                                                                                                               ------T-----
                                                                   SNP                                                                                                                                                                                                                                                       --T------T--
                                                                   SNP                                                                                                                                                                                                                                                                               -------G-A--
                                                                   SNP                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                               ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                           ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                   ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                               ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                       ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                           -------G-C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               G---------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G---G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T--G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                               BLH ATG     106    1177                                                                               
                                               BLH MIN     100     218                                                                               
                                               BLH MPR      76     218                                                                               
                                               BLH OVR     106      94                                                                               
                                               EST CLI      73      37                                                                               
                                               ORF LNG     106       7                                                                               
  5   1   2       bld Ga12 5g3  in                         XL159n07.5p GAACACCTTAGCGCACTGGCTCACTTGTTTGCAAGAAATAGTTTGTGTTAACCCAGCGAAGTGTTTTGTTGCTACTGGAAACTTCTGAGAGCAGAGATGCTGCCGGAAGTCCCGCCCTCCCTGCAGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAA
  5   1   2       bld Oo1  5g                         IMAGE:6639717.5p                               TGGACCGGTCCGGATTCCCGTGATAGCGAAGTGTTTTGTTGCTACTGGAAACTTCTGAGAGCAGAGATGCTGCCGGAAGTCCCGCCCTCCCTGCAGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGAATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGACGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCCGGAGACTCTGATGTAGAATTNAATGATGTTGAAAGAATACCAGTATAGCAGAAAATGTGAAGGATATAGGAAAATATTTCTTCAAATCTCAGAACTGGGGAATGGCAACAAAGAAGTATAAACAGGCTCTTAGATATGTANAAAAGCTGCAAGATGTCACAGGGAGATGACAACATTTCNAAGNTAAAATCCTATTTGCCTGTCAGCTGTAAAACTTGAATATTTGCTGCCTGGCAAAACTCAAAAGTA
  5   1   2       bld Emb1 5g                         IMAGE:6865456.5p                                                                            TGGAAACTTCTGAGAGCAGAGATGCTGCCGGAAGTCCCGCCCTCCCTGCAGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGGAGACTCTGATGTAGAATTAAATGATGTTTGAAAGAATTACCAGTATAGCAGAAAATGTGGAAGATATTAGGAAATAATTTTCTTCAAATCTCAAGAACTGGGGAAAATGGGCAACAAAGAAAGTATAACCAGG
  5   1   2       bld DMZ  5g3  in                         xl237k07.5p                                                                              GTCGCCTGAAACCAGAGATGCTGCCGGAAGTCCCGCCCTCCCTGCAGCGGAAGTGTGGCTAGGAGCTGAGAAGCCGGTGAGCGGTGCGTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGA
  5   1   2       bld Ov1       in                    IMAGE:5048909.5p                                                                                                         TATCGTCGACCCACGCGTCCGGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTA
  5   1   2       bld Oo1  5g                IMAGE:6639717-IMAGp.IMAGp                                                                                                                  GCCCTCCCTGCAGCGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGAATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGACGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGT
  5   1   2       bld DMZ  5g3  in                         xl302p14.5p                                                                                                                               CGGAAGTGTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAG
  5   1   2       bld Ga18      in                       xlk81f09ex.5p                                                                                                                                  GGAAGTGTAGCGAGGTGNAGAGAAGNCGGTGAGCTGNNNNTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGNTGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGNTATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGNCTGCAAAGATGTGTNCGATAGCAGAGTGTGGGGGAAGTGAATGACAGCAATGAGTGGATNGCTTCTCCATCAGATGGTTCTNGCGACACTCACCCTGATTTTCCGGNGACTCTGATGTAGAATTAAANGATGTTGAAAGAATTACCAGNNTAGCAGAAAATGTGAAGNNNNNGGGAAANATTNTTCNAATCTCAG
  5   1   2       bld Gas9 5g                              BG409824.5p                                                                                                                                   CCCACGCGTCCGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTTCATCAGATGGGTCTGGCGACACTCACCCTGATTTTTCNGAGGACTCTTGATGTAAAATTAAA
  5   1   2       bld Ga18      in                       xlk81d08ex.5p                                                                                                                                     AGTGTAGCGAGGTGNAGAGAAGNCGGTGAGCTGNNNNTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGNCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGNTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTNCAAANATGTGTACGATAGCAGAGTGTGGGGGAAGTGAATGACAGCNATGAGTGGATGNNTTCTCNNTCAGATGGTTCTGGCGACACTCACCCTGATTTNCCGGNGACTCTGATGTAGANTTAAATGATGTTGAAAGAATTACCANNNTAGCAGAAAANGTNAGAATATNNGAAATATTTCTTCNAATCTCAGAACTNG
  5   1   2       bld Brn1 5g                         IMAGE:7019065.5p                                                                                                                                      GTAGCGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGACGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGGAGATGACCACATTTCAAAGTTAAAATCCTATTGCCTGTC
  5   1   2       bld Ga15 5g                            XL513e08ex.5p                                                                                                                                          CGAGGTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTANAATTAAATGATGTTGAAAGAATTACCANTATANCANAAAATGTGAAGAATATANGAAAATAATTTCTTCAAATCTC
  5   1   2       bld Ga15 5g3  in                       XL515p04ex.5p                                                                                                                                              GTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTANAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCANAACTGGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGA
  5   1   2       bld Em10 5g                         IMAGE:8319908.5p                                                                                                                                              GTGCAGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCATCAGATGGTTCTGGCGACACTCACCTGATTTTCCGANGACTCTGATGTAGAATAATGATGTTGAAGAATTACCAGTTAGCAGAAATGTGAGAATATAGAATATTTCTCAATCTCAACTGGGATGCAACAGAGTATACAGCTCAAATTGAAAGCTCAGAGTCCGGAATAACTTTAAGTA
  5   1   2       bld Thy  5g3  in                    IMAGE:8550254.5p                                                                                                                                                  AGAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCAAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGACGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGGGACTCTGATGTAGATTAANTGATGTTGAAGAATTACAGTTAGCAGAAATGTGAAGAATATAGAATATTTCTTCATCTCAGACTGGGAATGCANNCAGNTATACAGGCTTAGATTGTAGAGCTCAAATGCCAGAATGACACTCAAGTATCTTGCTGCACGACTGAATGCGCGCATCAGTCGATGACGCTG
  5   1   2       bld Emb9 5g                         IMAGE:7974666.5p                                                                                                                                                   GAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATACCAGTATAGCAGAAAATGTGAAGA
  5   1   2       bld DMZ  5g3  in                         xl269a05.5p                                                                                                                                                   GAGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203636.5p                                                                                                                                                    AGAAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTTCAATCTCAGAACTGGGNAATGGNCACAAAGAAGTATAACANGGCTCTAAGATATGTAGAAAGCTGNCAAGATGTCACAGGAGATGACAACAATTTCAAAGTTAAATCCTATTTGCTGTCCAGCTTGTACCTTGAAAATTGCTGCCCTGCCAAACTCAAAGGTATCTGAACTTT
  5   1   2       bld Neu7 5g3  in                         XL008c13.5p                                                                                                                                                     GCACGAGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCA
  5   1   2       bld Ga15 5g3  in                       XL463a12ex.5p                                                                                                                                                      AAGCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAG
  5   1   2       bld Emb1 5g                         IMAGE:5154912.5p                                                                                                                                                        GCCGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTTCCGGAGGACTCTGATGTAGAATTTAATGGATGTTGAAAGAAATTACCGTATAGCAGAAAAATGGGGAAGATTATAGGGAATTAATTTCTTCAAAATCTCAGGAACTGGGGAAATGGGCAACCAAAGAAATTTTTACCAGGGGTTCTAAGAAAATGGTAAAAAGGCTTGCCAAAGAAGGTCCCAAGGGAAATGGCCAACCCTTTTTCCAAAGTTTAAATTCCCTT
  5   1   2       bld DMZ  5g3  in                         xl259j18.5p                                                                                                                                                         GGTGAGCGGTGCGTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCTGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCANTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGANAAGCCTGCGAAGGTGTGTGCGATATCANAGTGTGNGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTT
  5   1   2       bld DMZ  5g3  in                         xl324k16.5p                                                                                                                                                         GGTGAGCGGTGCGTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACA
  5   1   2       bld DMZ  5g3  in                         xl290b05.5p                                                                                                                                                         GGTGAGCGGTGCGTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCGGAAAACATGAAGAATATAGGAAACAATTTCTT
  5   1   2       bld Ga15 5g3  in                       XL411e08ex.5p                                                                                                                                                          CGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTANAATTAAATGATGTTGAAAGAATTACCAGTATANCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCANAACTGGGAAATGGCAACNAAGAAGTATAACAAGGCTCTAANATATGTANAAAAGCTGCAAAG
  5   1   2       bld DMZ  5g3  in                         xl302p04.5p                                                                                                                                                          CGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGNAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACANAATTATTAANAAATTCATGATCCAATGT
  5   1   2       bld DMZ  5g3  in                         xl317o18.5p                                                                                                                                                          CGGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCA
  5   1   2       bld Em10 5g                         IMAGE:8318485.5p                                                                                                                                                           GGTGAGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTTGGAAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCCAGTATTAGCAGAAAATGTGAAGAATATA
  5   1   2       chi Spl       in                    IMAGE:8464320.5p                                                                                                                                                           GGNGNGCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGATGCCTGCCACGATGTGTACGATACCCGAGTGTGGGGAATTGAATGACTGCAATGAGTGTATGGCTTCTCCATCAGATGGTTCTGGCACACTCACCCTGATTTTCGCGAGGACCTGATGTAGAATTAATGATGTTCTAACAATTACCTTCTCCAGACAATTGGAGATAACTTAATAATTTCTTAATCTCAGACTGGGAATGTAATAA
  5   1   2       bld Emb9 5g                         IMAGE:7978615.5p                                                                                                                                                                GCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACTATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGATTTACCAGTATAGCAGAAAATGTGAGGATATTAGGAAATAATTTTCTTTCAATCCTCAAACTGGGAAATGGCCACAAAG
  5   1   2       bld DMZ  5g3  in                         xl305j08.5p                                                                                                                                                                GCTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGA
  5   1   2       bld Te2N 5g                         IMAGE:7204269.5p                                                                                                                                                                 GTGCGTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCGGAAAACATGAAGAATATAGGAAACAATTTCTTTCAATCTCAGGACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTGAGATATGTAGAAAGCTG
  5   1   2       bld Spl  5g3  in                    IMAGE:8464052.5p                                                                                                                                                                 CTGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAA
  5   1   2       bld Tbd1 5g                          Tbd1-da93f10.y1                                                                                                                                                                  TGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAATGATGAGAAGCCTGCAAAGATGTGTACGATAGCC
  5   1   2       bld Ga18      in                      xlk166d20ex.5p                                                                                                                                                                  TGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGNCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGNCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCNATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTNCGGNGNCTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAANATAGGAAANAATTNCTTCAAATCTCAGAACTGGNNAATG
  5   1   2       bld Tbd5 5g                         IMAGE:3579587.5p                                                                                                                                                                   TGTGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAAAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTG
  5   1   2       bld Ga18      in                      xlk118o02ex.5p                                                                                                                                                                   TNNNNNGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGNCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGANGGNTCTGGCGACACTCACCCTGATTTTCCGGNGNCTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGNNNTAGGAAATAATTTCTTCNAANCTNAGAACTNGNNAATGGCANNAA
  5   1   2       bld Ga18      in                      xlk137a11ex.5p                                                                                                                                                                   TGTNNNGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAANTNNTTAAGAANNTCATGATCCAGTGTGGAGNNTTCTCAAACCAAGATGGAACTGGAGNNGAANGNATNTATGGGGAAAAANTTGAGNNTGAAANCTTNCATT
  5   1   2       bld Ga18 5g3  in                      xlk119p24ex.5p                                                                                                                                                                     TGCGTGTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCNATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGNGACTCTGATGTAGAATTAAATGATGNTGAAAGAATTACCAGTATAGCAGAAAANTGTGAAGAATATAGGAAATAATTTCTNCNAATCTCAGAACTGGGAAATGNCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTNAAANNCTATTGCTGTCAGCTGTAACTTGAATATTNCTGCCTGCAAACTCA
  5   1   2       bld DMZ  5g3  in                         xl227m14.5p                                                                                                                                                                     GTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGA
  5   1   2       bld DMZ  5g3  in                         xl280i03.5p                                                                                                                                                                     GTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCTGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTATCAGTATAGCAG
  5   1   2       bld DMZ  5g3  in                         xl315p15.5p                                                                                                                                                                     GTCTAGTGTGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCTGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTATCAGTATAGCAGAAAACAT
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075701.5p                                                                                                                                                                       CGTGTAGTGTGTGGAGAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTCCGGAGGACTCTGATGTAGAATAAATGATGTTGAAGAATACCAGTTAGCAGAAATGTGAAGATATANGAATATTTCTCAATCTCAGACTGGAATGGCACAAGAGTATACAGGTCTAGATAGTAAAACTGCA
  5   1   2       bld DMZ       in                         xl325a19.5p                                                                                                                                                                         GTAGTGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTT
  5   1   2       bld Neu7 5g3  in                         XL004b02.5p                                                                                                                                                                             GGAGGTGTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCC
  5   1   2       bld Ov1  5g                         IMAGE:8330872.5p                                                                                                                                                                             TGTGTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTC
  5   1   2       bld DMZ  5g3  in                         xl317g04.5p                                                                                                                                                                                GTGGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328161.5p                                                                                                                                                                                  GGAGAAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAA
  5   1   2       bld DMZ  5g3  in                         xl271g24.5p                                                                                                                                                                                   GTGGAGATGTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATTATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCGGAAAACATGAAGAAT
  5   1   2       bld DMZ  5g3  in                         xl304l12.5p                                                                                                                                                                                      AAAATGTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTT
  3   1   2       bld Ga18      in                       xlk81f09ex.3p                                                                                                                                                                                        ANNAAANNTNTANCCCGNNCCCANTGGCNNNCCTTCCNNNCCCCNNCNANCCAAAGNTNTTCCTGGATNNGAGATCGGNNNGAGCNCNNGGGTCGAATTNTTTTGGAANTGTTTGCCGATGTNTACCCAAANCTGCAGAAAATTTCCNTGNNNNNTGTNCCGGAGAAAAGGGCATTGNCNAATCANNTGGNAAGCCTCTTCNTTTAAAGGNTGCCCNNTTCACAGAATTATTNAGAAATTCATGATCCAGTGTGGAGNCTTCTCAAACCAAGATGGANCTGGAGGTGNANGTATATATGGGGAAAAATTTGAGGATGAAANCTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGNCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGNAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCNCCTGATGATAAANCCNTNAGCAGNGAANNNC
  3   1   2       bld Ga18      in                       xlk81d08ex.3p                                                                                                                                                                                          AAANNNNNTAACCCGAGCNNATGNNNAANCNTTCNANNNNNNNANCCAAAGNNNNTNCNGGATNNGAGATCGNNGNAGNNNNNNTGGNTCGANTNNTTTGNAATTGTTTNNCNGNTNTTNNACCCAAACTGNAGAAAATTTCCGTGCCCTATGTACCGGANNAAANGGGCATTNNCAATCANCTNNAAAGNNNCTTCATTTTAAAGGNTGCCCNTTNNACAGAATTATTAAGAAATTCATGATNCNAGTGTGGAGNNNTCTCAANCCNAGATNNNNCTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTNCNNAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACNCCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTNTCACCTGATGATAAANCCGNNAGNAGTGAA
  5   1   2       bld Ga12      in                         XL179g11.5p                                                                                                                                                                                           GTCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTC
  5   1   2       bld Spl                             IMAGE:8460885.5p                                                                                                                                                                                           GTCTAACCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCTGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATATCAGTATAGCGGAAACATGAAGATATAGGAAACATTTCTTCAATCTCNGACTGGNAAATGCACAAGAGTATACAGGCTCGAGATTGTAAAGCTCAAGATGTCCAGAATACACTATCAGTAATCGATGCGCGCTTACTGAATGCGCTGAACTCAGTCGAT
  5   1   2       bld Ga12      in                         XL192i07.5p                                                                                                                                                                                            TCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAA
  5   1   2       bld Ga15      in                       XL497e11ex.5p                                                                                                                                                                                            TCTAACCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATANGAAAATAATTTCTTCAAATC
  5   1   2       bld Ga12                                 XL181g14.5p                                                                                                                                                                                                GCCCGAGCCCAATGGCCAAGCCTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCC
  5   1   2       bld Ga12      in                         XL181o23.5p                                                                                                                                                                                                 CCCAAGCCCAGTGGCCAAGCCTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCNAATACCAATG
  5   1   2       bld Ga18      in                      xlk166h07ex.5p                                                                                                                                                                                                   CGAGCCCAATGGNCAAGCNTTCCAACCCCTCCAATCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGNCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGNGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGNATAACAAGGCTCTAAGANATGTAGAAAGNTGNAAAGNNGTCACAGGAGANGANNNNTTTCAAA
  5   1   2       bld Ga12      in                         XL192i21.5p                                                                                                                                                                                                                  AAGCCTTCCACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGA
  5   1   2       bld Neu7      in                         XL036o23.5p                                                                                                                                                                                                                     CTTCCAACCCCTCCAACCCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGGATGTGTACGATAGCAGAGTGTG
  5   1   2       bld Ga12      in                         XL164l03.5p                                                                                                                                                                                                                         CAACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGT
  5   1   2       bld Tbd7      in                         XL097e05.5p                                                                                                                                                                                                                          AACCCCTCCAATCCAAAGGTGTTCCTGGATGTGGAGATTGGAGGAGAGCGCGTGGGTCGAGTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCA
  5   1   2       bld Tail                            IMAGE:8545543.5p                                                                                                                                                                                                                                      CCAAAGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGNAAATGGCAACAAGAAGTATAACAAGGCTCT
  5   1   2       bld Neu7                                 XL030g04.5p                                                                                                                                                                                                                                          AGGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGC
  5   1   2       bld Neu7                                 XL028i15.5p                                                                                                                                                                                                                                           GGTGTTCCTGGATGCGGAGATCGGAGGAGAGCGCGTGGGTCGAATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCA
  3   1   2       bld Ga18      in                      xlk118o02ex.3p                                                                                                                                                                                                                                                                                   TCGANTTNTTTTNGNATTNTTTNCCGATGTNTACCCAAACTGCAGAAANNTTCCGTNCCCNATGTNCCGGANNAAAAGGGCATTGGCCANNCNACTGGAAAGCCTCTTCATTTTAAAGNATGCCCNTTTCACAGAATTATTAAGAAANNCATGATCCAGTGTGGAGNCTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAANTTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGNCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCNCCTGATGATAAANCCNTCAGCAGTGAA
  5   1   2       bld Ga15      in                       XL401b20ex.5p                                                                                                                                                                                                                                                                                      ATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTANTATGGCTAATGCTGGCCCAAATACTANTGGCTCCCAGTTCTTTATCACCACTGTACCAACACCCTCNTTTACATGGAANGC
  5   1   2       bld Ga15      in                       XL462o22ex.5p                                                                                                                                                                                                                                                                                      GTAGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAACTTCCGTGCCCTCTGTACTGGAGAAAAGGGCATTGGACAATCAACTGGAAAACCTCTTCATTTTAAAGGATGCCCTTTTCACAGAATTATTAAGAAATTCATGATCCAGGGCGGAGACTTCTCAAACCAAAATGGAACTGGAGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGA
  5   1   2       bld Ga15      in                       XL490f19ex.5p                                                                                                                                                                                                                                                                                      ATTGTTTTGGAATTGTTTGCCGATGTTGTACCCAAAACTGCAGAAAATTTCCGTGCCCTATGTACCGGAGAAAAGGGCATTGGCCAATCAACTGGAAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCANATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTANAATTAAATGATGTTGAAAGA
  5   1   2       bld Ga12                                 XL194c19.5p                                                                                                                                                                                                                                                                                                                                                                         CCAATCAACTGGANAGCCTCTTCATTTTAAAGGATGCCCATTTCACNGAATTATTAGCAAATTCNTGATCCATGGTGGAGACTTCTCANACCNAGATGGAACTGGAGGTGAAAGTATATATGGNGAAAAATTTGAGGATGAAAACTTTCATTA
  5   1   2       bld Ga18      in                       xlk75i08ex.5p                                                                                                                                                                                                                                                                                                                                                                                      AAAGCCTCTTCATTTTAAAGGATGCCCATTTCACAGAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTNCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGNAATGANNCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGNCTCAGGGTTNGCAAGGNCTAAAAGA
  3   1   2       chi Ga18      in                      xlk166d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                       AAAGCNNNNTCNNTNNANGGATNNCCNTTTNNNANNNTNNNTNANNAANTCATGATCCAGTGTGNAGNNTCTCAANCCANGNTGGANCNGGAGNNNAAAGNATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGNTGGCCCAAATACTANNGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGNCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATANNNNNNCAGNA
  5   1   2       bld Ga15      in                       XL449a13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GAATTATTAAGAAATTCATGATCCAGTGTGGAGACTTCTCAAACCCAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGC
  3   1   2       bld Ga15      in                       XL462o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAAACCAAAAATGGAACTGGAGGGAGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTCAGTATGGCTAATGCTGGCCCAAATACCAATGGCTCACAGTTCTTTATCATCACTGTACCTACACCTCATTTAGATGGAAAGCATGTGGTTTTTGGCCAAGTGCTAAAGGGATATGGAATTGTCAAAATGTTGGAAAACGTTGACGTAAAGGAAGAGAAGCCTGCGAAGGTGTGTGCGATATCAGAGTGTGGGGAACTGAATGAGAGCGATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGAGACACTCACCCCGATTTTCCAGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCGGAAAACATGAAGAATATAGGAAACAATTTCTTCAAATCTCAGGACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAG
  5   1   2       bld Ga15      out                      XL491f19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGACCAAGATGGAACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTANATGGAAANCATGTGGTTTTCNGCCANNTGCTANNANGATATGGNATTGTCNANATATTGGAAAATGTTGAANTA
  5   1   2       bld Tbd1                                 AW871878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACTGGAGGTGAAAGTATATATGGGGAAAAATTTGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTGCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTA
  5   1   2       bld DMZ       in                         xl244e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGGATGAAAACTTTCATTATAAGCATGACAAAGAGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCG
  5   1   2       bld DMZ                                  xl247e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGTTTACTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCNCCNCTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCANNTGCTNNNAGGATATGGCATTGTCNNNNTATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTANAATTAAATGATGTTGAAAGAATTACCANTATAGCNTAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTATAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCNTTGNNAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAANAGACTATGAACAAGCACTGGAGGAT
  5   1   2       bld Ga15      in                       XL452j22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTAGTATGGCTAATGCTGGCCCAAATACTAATGGCTCCCAGNTTCTTTATCACCACTGTACCAACACCCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCCAAAATGTTTGCCTAAATGTCTGCAGTCC
  5   1   2       bld DMZ                                  xl245e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAATGCTGGCCCAAATACTAATGGCTCCCAGTTCTTTATCACCACTGTACCAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCANAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTANAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCACNATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGAT
  5   1   2       bld DMZ       in                         xl233k12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACACCTCATTTAGATGGAAAGCATGTGGTTTTCGGCCAAGTGCTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCC
  3   1   2       bld Ov1       in                    IMAGE:5048909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGGAAAGCATGTGGTTTTCGGCCAAGTGNTAAAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATTGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTTTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAACAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAG
  3   1   2       chi Ga18      in                      xlk137a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TNNTTNANNNGNAANCATNNNNTTTCGGCNNAGTGCTAAAAGNATATGGCNNNNCAAANNNNGAAAATGNTGAAGTAAAGGATGANANCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCANTGAGTGGATGGCTTCTCCATCAGATGNTTCTGNNGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCANAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTAnnnnnnnnCAATAAAGNCTNNACNNC
  3   1   2       bld Ga18      in                      xlk163e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATANNNNNNCAGCAGTGAA
  5   1   2       bld Ga15      in                       XL450e20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGGATATGGCATTGTCAAAATATTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGGTTCTGTTTGTTGTGGCACTGCATGA
  5   1   2       bld Ga18      in                      xlk163e07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGGATATGGCATTGTCAAAATGTTGGAAAATGTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGNNGNNTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGNCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl322d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAACCGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTG
  5   1   2       bld DMZ       in                         xl304j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCA
  5   1   2       bld DMZ       in                         xl226i11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAAGTAAAGGATGAGAAGCCTGCAAAGATGTGTACGATAGCAGAGTGTGGGGAAGTGAATGACAGCAATGAGTGGATGGCTTCTCCATCAGATGGTTCTGGCGACACTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTG
  3   1   2       bld Ga18      in                       xlk75i08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCTGNNAANATGNNTACGATAGCAGANNNNTGGGNAANTGAATGACAGCAATGAGTGGATGNNTCTCCNTCAGATGGTTCTGNNGACNCTCACCCTGATTTTCNGNNGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGNAGAATATAGGAAATANTTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGNCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTAnnnnnnnnCAATAAAGACNNNACNGC
  3   1   2       chi Tad2      in                    IMAGE:6875860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAACACACCGCCCCTAAGCGGACGCAGTAACACTCCCCTCCGCCCTATGGTTCTCCCGCGTCTAATCTTGTTCCCACGCTCAATCTTTCCCGCCCATTTTCAAGGTCACGGGGAAAGGTCTCCTGCGCTACTTTGGAAGCAAAAGTTTGCATATAGCATTTTCCCCAGGGAGCTGCCCAACCCATATCAACCATTCAAGATCCCCATTCCGTATACGCTTGTAACTTAAATATTGCCCGCTTGTAAACTCAAAGTTTCTGATTTTCGAGCCACCCATTGCATAGCTCCAATGGAGGCGGAGGAAAATTAATCCCTCTCACACCAAAGCACTTTACAGGAGGGTTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCACCCATGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACCTTCC
  5   1   2       bld Egg1                               PBX0021B10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCACCCTGATTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAAGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCANGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAG
  3   1   2       bld DMZ  5g3  in                         xl317g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCACCCTGANTTTTCCGGAGGACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGT
  3   1   2       bld Ga18      in                      xlk166h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CNCACCCTGNTTTTNCGNNGNNNNCTGATGTANNANTAAATGATGTTGAAAGAANTNCCAGTATAGCAGAAAATGTGANNATATAGGAAANAATTTCTTCAANTCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTNCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGNTCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTAnnnnnnnnCAATAAAGACTNNACTGCNA
  3   1   2       bld DMZ  5g3  in                         xl317o18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCTGATGTAGAATTAAATGATGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTT
  3   1   2       bld Ga15      in                       XL452j22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATGTAGAATTAAATGATTGTTGAAAGAATTACCAGTATAGCAGAAAATGTGAAGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTT
  3   1   2       bld Spl       in                    IMAGE:8464320.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAGCTTCTCAGTTCGGCTCACTATTCGAGATTGTTGATAATGGTGANGATACAGTGCGAAATGGAGATTAGAATATTCTCAATTCAGACTGGAATGCACAAGAGTATACAGGCTCTAGATAGTAGAAGCTGCAAGAGTCACAGAGATGACACATTTCAAGTTAAATCCTATGCTGTCAGCTGTACTTGAATATGNCTGCNTGCAACTCNAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAAGTTCAGGAATACAAATCTGTTTACTTCCTCCCAAAAAGACGACGTC
  3   1   2       bld Spl  5g3  in                    IMAGE:8464052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTTCATCGGGTGGGCTCACTATTCGAGATTGGTGATAAGAGTGAGATTTCAGTGCAGAATGGAGATTAGAATATTCTCAATTCAGACTGGAATGCACAAGAGTATACAAGGCTCTAGATAGTAGAAGCTGCAAGAGTCACAGAGATGACACATTTCAAAGTAAATCNTATGCTGTCAGCTGTACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTACTTCCTCCCATAAAGATTTATGTC
  5   1   2       chi Te2N                            IMAGE:7206553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGTCTTCCTTTAAAATGTCTACAATTCTGTACATATAAAGATTTAGCAGATTGTCTGCCTGGCTCTTATGGAGAAAACGGCAAGCACTCCTGGAACCACTCGTAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTGGGCAGATGATGTGGAGGCA
  3   1   2       bld Thy  5g3  in                    IMAGE:8550254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCCTGTTTCGAGATTGTTGATATGTGTGAGATACGTTAGCGAATGGAGATTAGAATATTCTCAATCTCAGACTGGAATGCACAAAGAGTATACAGGCTCTAGATATGTAGAAAGTGCAAGATGTCACAGAGATGACAACATTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTACGCTAGCAACGGCATCAGG
  3   1   2       bld Ga15 5g3  in                       XL411e08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATAGGCAGAAAATGTGAAGGAATATAGGAAATAATTTCTTCAAATCTCAGAACTGGGAAAATGGCAACAAAGAAGTATAACAANGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTAC
  3   1   2       bld Ga15                               XL425h09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAGTATAGCAGAAAACATGAAGGAATATAGGAAACAATTTCTTCAAATCTCAGGACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTGTTACCA
  3   1   2       bld Ga15 5g3  in                       XL463a12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTATAGCAGAAAATGTGAAGAATATAGGAAAATAATTTCTTCAAATCTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACT
  3   1   2       bld Ga18 5g3  in                      xlk119p24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGAAAANNNNNNAANNNNGNAAANNNNTTCNTCAAATCTCAGNACTGGGAAATGNNAACAAAGAAGTATANCAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGNCAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTNCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGNTCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTANNGNNNNNCAATAAAGACTNNA
  3   1   2      seed Ga15      in                       XL490f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAGAACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCAA
  3   1   2       bld Ga15 5g3  in                       XL515p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGNAGAAAGGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCNGNTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTG
  3   1   2       bld Ga12      in                         XL179g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGGAAATGGCAACAAAGAAGTATAACAAGGCTNTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAG
  3   1   2       bld Ga15      in                       XL401b20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGT
  5   1   2       bld Ga15      in                       XL455f01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGC
  3   1   2       bld Ga15                               XL485c24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGAAATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCAATAAAGACTG
  3   1   2       bld Ga12      in                         XL181o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAAATGGCANCAAAGAAGTATANCAAGGCTCTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGAC
  3   1   2       bld DMZ       in                         xl233k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAATGGCAACAAAGAAGTATAACAAGGCTCTNAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGT
  3   1   2       bld DMZ  5g3  in                         xl304l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATGGCAACAAAGAAGTATAACANGGCTTTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCA
  5   1   2       bld Ga15      in                       XL460l09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAA
  3   1   2       bld Ga15      in                       XL460l09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGGCAACAAAGAAGTATAACAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCAAAAAGACTGTA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGGCAACAAAGAAGTATACAANGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACACATTTCNAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTACGTCTTCCCATAAGACTATGGG
  3   1   2       bld Ga12      in                         XL192i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CANCAAAGAAGTATACCAAGGCTCTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATAGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCC
  5   1   2       bld Tad2      in                    IMAGE:6875860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGCTCTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCACCCATGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATGGGCTNTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAAccccccccTTTTAAAAGGTGGGACGTTCCCTGTGTATATTTTTAAGAGACCAGAAAATTATTTGGATTTTGCATAACCTGGCTATAAAATGTGCCAGGGAATTAAACAATCCTGTTTTACCTGGGCCCTATATTAAAGAA
  3   1   2       bld DMZ  5g3  in                         xl324k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTGT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075701.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGAGTATACAGGCTCTAGATAGTAGAAGCTGCAAGAGTCACAGAGAGACACATTCAAAAGTAAATCCTATGCTGTCAGCTGAACTTGAATATGCTGCCGCAAACTCAAAGTATCTGACTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAAAGTGAGGAATACAAATCTGTTTACTTCCTCCCAAAAAGACCTACGCAACCATTCACTACGTTT
  3   1   2       bld DMZ       in                         xl304j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTNAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTT
  3   1   2       bld DMZ  5g3  in                         xl259j18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTNTCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCNGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTNGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCCTGTGTATATTTTAAGAGACAAGAAATTA
  3   1   2       bld DMZ  5g3  in                         xl290b05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTG
  3   1   2       bld DMZ  5g3  in                         xl302p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTNAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCAAAAAGAC
  3   1   2       bld DMZ  5g3  in                         xl305j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCAAT
  3   1   2       bld DMZ  5g3  in                         xl227m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTAATAAAGACTGTACCA
  3   1   2       bld Ga12      in                         XL164l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACT
  3   1   2       bld DMZ  5g3  in                         xl280i03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGATATGTAGAAAGCTGCAAAGATGTCACNGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGAC
  3   1   2       bld DMZ       in                         xl325a19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATATGTAGAAAGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAA
  3   1   2       bld DMZ  5g3  in                         xl315p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGAC
  3   1   2       bld DMZ       in                         xl244e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCTGCAAAGATGTCACNGGAGATGACANCATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTCCCA
  3   1   2       bld DMZ       in                         xl322d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTGCAAAGATGTCACAGGAGATGACAACATTTCAAAGTTAAATCCTATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTT
  3   1   2       bld DMZ  5g3  in                         xl237k07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGCAAAGATGTCACAGGAGATGACAACATATCAAAGTTAAATCCGATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTG
  3   1   2       chi DMZ                                 rxl223h24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNCAAGAATNCTAGGGGATACAATGGTGACTGTAGATGAAAGTGTATTTTGCAGTATATTGTATTTAAACAAACCAACTATTTACTATTACTTATTTTTTTTTTATCTAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGT
  3   1   2       bld Neu7      in                         XL036o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCTATTGCTGTCAGCTGTAACTTGAAATATTGCTGCCTGCAAACTAAAGGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTANACAACAG
  3   1   2       bld DMZ       in                         xl226i11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTATTGCTGTCAGCTGTAACTNGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACNTCCTCCCAAA
  3   1   2       bld Ga12      in                         XL192i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGCTGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTC
  3   1   2       bld Ga15      in                       XL450e20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGTCAGCNGTAACTAGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTNGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACNCCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATA
  3   1   2       bld DMZ  5g3  in                         xl302p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTCAGCTGTAACTTGAATATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACCAAATCTG
  3   1   2       bld Ga12                                 XL165l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGAATATTGCTGCCTGTAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGNTGCAATGAGGCGCTGGAAATTGATCCCTNTCNCACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCNTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTNTGGCATAAGCACGTGTCCCATAATCA
  3   1   2       bld DMZ  5g3  in                         xl269a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTGCTGCCTGCAAACTCAAAGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTT
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTATCTGACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAACAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATACCTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACAAAGCAAAAAAAAAAAAAAAG
  3   1   2       bld Neu7 5g3  in                         XL004b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTGCAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTGTTACCATACCTCCCAACATTGGCAGG
  3   1   2       bld DMZ  5g3  in                         xl271g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCACCCATGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGCAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGT
  3   1   2       bld Tbd7      in                         XL097e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAGAGCAGCCATTGATAGCTGCAATGAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTGCAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTGTTACCATACCTCCCAACATTGGCAGGTTA
  3   1   2       bld Neu7                                 XL007o06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGAGCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCT
  3   1   2       bld Ga12 5g3  in                         XL159n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGCCATTGATAGCTGCAATGAGGCTCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTAC
  3   1   2       bld DMZ                                 rxl270b22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATCTAGGCGCTGGAAATTGATCCCTCTCACACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTT
  3   1   2       bld Ga15      in                       XL455f01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGANATTGATCCCTNTCACACCAAAGCACTTTNCAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACNGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCTAATTATTTAATTGCG
  3   1   2       bld Ga15      in                       XL497e11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCAAAGCACTTTACAGGAGGGCTCAGGGTTGGCAAGGACTAAAAGACTATGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGC
  3   1   2       bld Bla1                            IMAGE:3379700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAAGGGTTCAGGGTTGCAAGGACTAAAAGACTTTGAACAAGCACTGAAGGATCTTAAAAAGGCTCATGAATTATCACCGAATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTGCAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATA
  3   1   2       bld Neu7                                 XL002p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTGGCAAGGACTAAAAGACTTTGAACAAGCACTGGAGGATCTTAAAAAGGCTCATGAATTATCACCCGATGATAAAGCTGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTGCAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGAAGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTGTTACCATACCTCCCAACATTGGCAG
  3   1   2       bld Tbd1                                 AW782451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGAGGATCTTAAAAAGGTTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATACCTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATAAA
  5   1   2       bld Ga15                               XL424g03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTAAAAAGGCTCATGAATTATCACCTGATGATAAAGCCGTCAGCAGTGAAATTCTGCGAGTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACAAAGCaaaaaaaaaa
  5   1   2       bld Gas5      in                    IMAGE:3748952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAAGCAGAGGATTAAAGAGCAGAAAGAAAAAGAGAAGGCTGTGTATGCCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAA
  3   1   2       bld Ga18      in                       xlk57g17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTAnnnnnnnnCAATAAAG
  3   1   2       bld Ga18      in                      xlk128l11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAAAGAAAAAGAGAAGGCGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAANTCTGTTTANNNNNTCCCAATAAAGNC
  5   1   2       bld Ga18      in                      xlk128l11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAAGAAAAAGAGAAGNNGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATaaaaaaaaaa
  5   1   2       bld Ga18      in                       xlk57g17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGAAAAAGAGAAGNNGGTATATGCCAAAATGTTTGCCTAAATGTCTGCAGTCCCTTGGAATGTGTGAGTTTGGCATAAGCAGTTGTCCCATTAACCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACaaaaaaaaaa
  3   1   2       bld Gas5      in                    IMAGE:3748952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAAATGTTTGCCTAAATGTCTCTAGTTCTCTCCCTTGGAAAGTGCGAGTTTGGCATAAGCACGTGTCCCATAATCAAAAACAAAACAAACTTTAGACCTGTGGATTATTTTCCCCCTAGAACTACACCATTGTTTGCAGCTTTCATTTCTCTGGTTTTTCATTCTGTTGTGTGGCACTGCATGAATTATGCAAAGGAGACATCTGGGGTCCGACCGGTTTTATTCTCTTGTGAATTGGCTTTGGTTGGCAGATGATGTGACGGTAGTAAAGCTTGTTTTAGTCTATCTAACCCCCCCTTTAAAAAGTGGGACGTCCCTGTGTATATTTTAAGAGACAAGAAATTATTTGATTTGCATAACTTGCTATAAATGTGCAGGAATAAACATCTGTTTACTGTCCTTAATAAAGACTGTTACCATACCTCCCAACATTTGGCAGGTTATGAAAGTTAAAA
  3   1   2       bld Ga15      in                       XL449a13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGTCCCTTGGAATGTGNGAGTTTGGCATAAGCAGTTGTCCCATTAGCCAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACGAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCNAATTATTTAATTGC
  3   1   2       bld Ga18      in                       xlk65p08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAAAACGGAAGACTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTANNNNNTTCCCAATAAAGACTGTTACTGCTATGA
  5   1   2       bld Ga18      in                       xlk65p08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAACGGAAGANTTCTTTTTCCCCATAACTCTGATAACTGTACATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACAAAGCaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL457b08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCGCATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGCTATGACAACAGTGACGATATACAAAGCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL457b08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCATTGTTTACAGCTTTCATTTCTCTGATTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTA
  5   1   2       bld Ga12                                 XL216m08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGTTGGTTCTGTTTGTTGTGGCACTGCATGAACTATGCAAAGGAGACATCTGCTCGCCGGACGGTTTTATTTTCTTGTGTATTGGCTTTTGTTTGGCAGATGATGTGAAGGCACTAAAGCTTGTTTTAGTCTAACCCCATTTAAAAAGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCACGAATACAAAT
  3   1   2       bld Neu7 5g3  in                         XL008c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTCTAACCCCATTNAAAAAGGGGGGGAAATTCCTGTGTAAATTTTAAGAGAAACGCAATTATTTAATTGCATCATTTCTTTGTTATAAATGTTCAGGAATACAAATCTGTTTACTGTCCTTCCCAATAAAGACTGTTACTGNCTANACAACAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)