Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7980437.5.5                    26 PI      78        824     1103                hypothetical protein MGC76071 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 76%

 1012767477 Xl3.1-XL507m05ex.3 - 218 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL507m05ex.3               GAGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAATTTAATGATCCT
                                                  Xl3.1-CHK-1012685157                     CGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAxxxAxTxAxxxxTCCTTT
                                                      consensus depths                    7     9    10    16    15    25    17    30    20    38    21    42    35    60    36    69    36    72    43    75    44    76    46    77    47    78    47    79    48    80    49    80    50    80    50    80    49    79    49    79    47    79    49    79    49    79    49    79    49    79    49    80    49    81    52    83    52    83    50    83    51    82    51    83    51    83    53    84    50    82    51    83    52    84    51    83    53    85    51    85    51    85    52    85    46    86    47    87    43    83    42    80    43    80    42    80    40    78    40    78    40    78    39    78    40    78    38    77    34    69    33    70    30    70    31    68    28    67    28    66    27    66    26    64    23    61    22    60    14    53    17    49    19    50    17    45    18    43    17    45    18    43    17    43    19    44    20    46    21    42    23    40    29    43    28    48    35    48    34    49    37    51    40    54    37    56    42    55    46    59    44    61    50    61    52    64    47    66    57    69    58    74    65    76    64    82    73    85    77    85    48    86    46    86    50    87    50    87    51    88    56    91    57    93    59    94    62    95    65   100    68   101    68   100    68   100    70   102    70   105    70   104    68   104    68   107    69   107    69   109    71   110    68   110    71   110    64   108    69   109    69   110    69   111    60   111    67   113    70   112    67   112    56   111    57   110    58   110    57   109    57   109    57   109    58   108    56   108    54   108    52   108    54   108    52   108    53   104    46    92    45    90    42    89    44    85    38    79    33    74    25    60    19    46    15    36     8    23
                                                                   VAR                           GCTCGGACTAGTCGCATCTTCTGAGTGGTCTCGCAG
                                                                   VAR                                                               CTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAA
                                                                   SNP                                                                                                   -----------T
                                                                   SNP                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                       -----G------
                                                                   SNP                                                                                                                                                                                                                                                                           ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                           -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C--T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------GG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------G-A
                                               BLH MIN      55     134               
                                               BLH OVR     112      62               
                                               EST CLI      59      36               
                                               ORF LNG     112       5               
  5   1   2       bld Neu4 5g                         IMAGE:4085472.5p GGAGCAGAGAGGCGGAGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTATTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTC
  5   1   2       bld Emb1 5g                         IMAGE:6632267.5p   AGCAGAGAGGCGGAGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCCTCCTTTCATCTAGCAAACCCATTGGNTGTTGGGGTCACAGCCCCCAGTTTTGCAGCACCTTCTACAAGAGCTCCCTCCAAAAACACTCCCTAAACTNCAACACGTCGCTTTGCCGGAGGTTGTAAGTTGCCCAAAACTGGCCAAGGCATCTTCCAGGCAAACGAAGGAACCAGGCC
  5   1   2       bld Em10 5g                         IMAGE:7979539.5p       GAGAGGCGGAGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAACAATTTCCCTCCTTTCATCTACAACCCATTGGTGTTGGTCAAGCCCAGTTGCACACTCTACAACTCTCAAACACTCTACTCACACTCCTGCGAGTGTATGCCACTGCAGCTTCAGCACAGACAGCAAGACTCTTTGCCTCAGCTG
  5   1   2       bld Emb9 5g                         IMAGE:7977084.5p       GAGAGGCGGAGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGTGTAAGTGCCCA
  5   1   2       bld Emb1      in                    IMAGE:3403238.5p        CACGCGTCCGGAGGCGGAGGCTCGGACTAGTCGCATCTTCTGAGTGGTCTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTC
  5   1   2       bld Ga10 5g                         IMAGE:3558384.5p         ACAGCGGAGGCTCGGACTAGTCGCATTCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCC
  5   1   2       bld Gas6 5g3  in                    IMAGE:3438535.5p          GGGCGGAGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATNGCCANA
  5   1   2       bld Emb1 5g                         IMAGE:6631524.5p             CGGCGGCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCCTGCGGAAGGTGGTAAGTGCCCAAAACTGCCAAGCATCCTCAGGCAACGAGGAAACCAGGCAAANAGAAAGCTCCATATCTGTCATCTTTCCAGGCTGTTGGCAAAGTGTATGG
  5   1   2       bld Emb3      in                    IMAGE:3400038.5p               GGAGAGGCGGAGGCTCGGACTAGTCGCATCTTCTGAGTGGTGTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACAACAGCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCA
  5   1   2       bld Neu7 5g3  in                         XL050k04.5p                  GCTCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAG
  5   1   2       bld Neu7 5g                              XL028g21.5p                    GCGGACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAG
  5   1   2       bld Emb1                            IMAGE:6636069.5p                    GGCGGAGGCTCGGACTAGTCGCATCTTCTGAGTGGTGTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTTGGTTGTTGGGTCACAGCCCCCAGTTTTGCAGCACTTTCTACAGAAGCTCCTCAAAAACACTCCCTAAACACAACACGGGCGCTGGCGGGAGGGGGTAAAGTGCCCCAAACTGGCCAAGCATCCTCCAGGCAATGAGGAAACCGGGCAAAAAAGAGGCTCCATATCTGCCCATCCTTCCCAGCTGTGG
  5   1   2       bld Ga12 5g3  in                         XL142p13.5p                     GCGGACTGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGAC
  5   1   2       bld Ga18 5g3  in                      xlk161o17ex.5p                     TCGNACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCANNNNANNNNCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGNTCAACCACTTTGACCCAAAGACACTTGAGNNCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTNCATCTAGCAAACCCATTGNNNTTGGGNCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTNCTCCAAAACACTNNTAAANTCAA
  5   1   2       bld Neu7 5g3  in                         XL032a22.5p                        GACTGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAA
  5   1   2       bld Ga18 5g3  in                      xlk126p24ex.5p                         ACTAGTCGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCNGNNNACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGNGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGANTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGNNNACNNTGCCTANCATTTCCNAGACCCNAG
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749528.5p                              CGCATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCAT
  5   1   2       bld Ga15      in                       XL438d04ex.5p                              CGGACTAGTCGCATCTTCTGAGTGGTCTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCA
  5   1   2       bld Ga18 5g3  in                        xlk3o04ex.5p                                 CATCCTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGNGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAnnnnnnnnnCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGNTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGANAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTNGNTGTTGGGNCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCNTCCAAAANA
  5   1   2       chi Emb9                            IMAGE:7974771.5p                                    TCGGTCCGGATTCCCGGGATGTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCTGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGCTAAAGTATTGGCTCCACAAGTGTCAAGCAATGGCTGTTTATCATTTCCAAGACCCTAGTGCATTGGCTCAAGATTTCTACAGCTTTATGCGGTGTTCATCCACTTTGACCTCAATACTTTTCGGTTTCGACGCAATTTGATGAACGAACGTGGAGGAGCCTGCATCAGACGCGTCCAAACTATTTTCCCTCGCATTACTATGCCAAACCGTTGCATGTGAGGCTCACCCTCCATTATGTTCTATTTTTAGAGAGCTTC
  5   1   2       bld Em10 5g                         IMAGE:8320273.5p                                    CTCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCTTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCTTTCATCTAGCAAACCATTGGTTGTGGGTCACACCCCAGTTGCACACTTCTACGAGCTCCTCAAACACTTCTAACTCACACGTGCTGCGGAGTGTATTGCCCACTGCCAGCTTCCAGCACGAGACCAGCAAAAAGCTCTATG
  5   1   2       bld Emb1 5g                         IMAGE:6866617.5p                                     TCTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGGAGTGTAAGTGCCCAAACTGCCCAGCATCTCCAGGCAAACGAGGAACCCAGCAAAAGAAGCTCCATATCTGTCATCTTTCCAGGCTGTGGGCAAAGTGTTATGGAAAGACT
  5   1   2       bld DMZ  5g3  in                         xl314c05.5p                                     CTGATTTCTGTCGCAGCTACTCACTTTAATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTCGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCT
  5   1   2       bld DMZ  5g3  in                         xl338g05.5p                                     CTGATTTCTGTCGCAGCTACTCACTTTAATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTCGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTG
  5   1   2       bld Em10 5g                         IMAGE:8322297.5p                                      CTGATTTCTGTCGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTTTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTGCAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCNAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTC
  5   1   2       bld Neu7      in                         XL049o23.5p                                        GCATCTTCTGNGTGGTCTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAA
  5   1   2       bld Neu1      in                      Neu1-26C1-1.5p                                              CTGAGTGGTCTCGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCATTGGTTGTTGGGTCACAGCCCCAGTTTTGCAGCACTTCTACAGAGGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTG
  5   1   2       bld Ga18      in                      xlk115b17ex.5p                                              TTCTGAGTGGNGTCNCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTNCTTCCCTCCAGNGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCANNNNNTGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGNTCAAGACTTCTCAAGCTTTATGCAAGGNTCAGCCACTTTGACCCAAAGACACTTGAGTTCNACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGANAAGTCCAAACAATTTTCCCTCATTTNATTTAGNNAACCCATTNGTTGTTGGGTCACAGCCCCAGTTTGCAGCANTTCTACAGAGCTCNNNAAAANACT
  5   1   2       bld Em10 5g                         IMAGE:7982474.5p                                                 CGCAGCTACTTACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCGGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAACACTCCTAAACTCACACGTCGCTGCCGGAGGT
  5   1   2       bld Em10 5g                         IMAGE:8318134.5p                                                 CGCAGCTACTCACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTTTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACA
  5   1   2       bld DMZ       in                         xl303l07.5p                                                      GTGTCGCAGCTACTCATTTTCTCCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAG
  5   1   2       bld Ga12      in                         XL200h11.5p                                                         ACGAGGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCC
  5   1   2       bld Emb1                            IMAGE:5154993.5p                                                          CGCAGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGGCTGCCGGGAGGGTGTAAGTGCCCCAAACTGGCCAAGCATCTCCCAGGCAATGGAGGAACCGGGGCAAAAAGAAGCTCCATATCTGCCATCTTTCCAGGCTGTGGGCCAAAGTGGTATGGAAAAACCTTC
  5   1   2       bld Em10                            IMAGE:8322115.5p                                                          CGCAGCTACTCGTTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAG
  5   1   2       bld Emb1 5g                         IMAGE:6632965.5p                                                            ACTTTATTCCAGACCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCCTCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGGCAACGAGGGAACCCAGGCAAAAAGAAGCTCCATANTCTGGTCATCTTCCCAGGCTGNTGGCAAAAGTGGTATGGGAAAAGACTTTCC
  5   1   2       bld Em10                            IMAGE:7978912.5p                                                             AGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGC
  5   1   2       bld Em10      in                    IMAGE:7982158.5p                                                             AGCTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCNTCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGCCCAAACTGCAAGCATCTCAGGCAATG
  5   1   2       bld Gas9                                 BG409684.5p                                                               CTACTCATTTTCTTCAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGGTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCACAGACAAGTNCAAACAAATTTTTCCTTAN
  5   1   2       bld Tbd3 5g                         IMAGE:3548091.5p                                                                         AGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTTTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTTCCTGTCAACTTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGT
  5   1   2       bld Em10 5g                         IMAGE:7982428.5p                                                                         CCAGATATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTTTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGNCAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAACACTCCTAAACTCAACACGTCGCTGCCCGGAGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAC
  5   1   2       bld Ga12                                 XL160m09.5p                                                                          GCTTAGACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCA
  5   1   2       bld Em10 5g                         IMAGE:7980177.5p                                                                           GATATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGGTTCTTCTCCGGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAACACTCTAAACTCACACGTCGCTGCCGGAGTGTAAGTGCCAACTGCCAGCATCTCCGGCACGAGGAACAGCAAAAGAGCTCATATCGTCTCTCAGGCGTGCAGTGATGAAGACTCCATAAAGCCCTACTTGCTGCAGTAAGCGTCTCCA
  5   1   2       bld Ga12 5g3  in                         XL151g11.5p                                                                               ATGATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGAC
  5   1   2       bld Ga12      in                         XL159k05.5p                                                                               GACTGGATATGATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCT
  5   1   2       bld Em10 5g                         IMAGE:7982806.5p                                                                               ATGATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCGGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTGCAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTTCCAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAAGTGCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAGCCTCATATCT
  5   1   2       chi Emb4                            IMAGE:5570510.5p                                                                                CCACGCGTCCGGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAACCTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATCCATTTGATTTGTCTCCCCGCCAAGTATTTGACTCCACCCATGCCGAGCAACGGTTGCCCTACCATTTCCCAGACCAAAGTGCCGTGACTCAAGACTTCTCAAGCTTTTATGCAAGGGTCCAACCACTTTTGACCCCAAAGACACTTGAAGTTCCACACCACATTGGATGGACCCCCACCTTGGTGGAAGCCCTGGAACCAGACCAACTTCCCAAACCATATTTCCCCCCTCACTTTTCATTTTAACCCAAACCCCTTTGGGCTTGGCCGGGGGTCACCGGCCCCCCGGTTTGGCCCGGGCCTTTCTTCGCCGAAGGTCCCCTCCCAAAAAAACCTTCCTAAAAACTTCCAACCACCCGTCGCCTTAGCCGGAGAGGGGTGTAAAGCTGGCCCCACACACTTTGTCCTGTGCCATTCTCTCCCCCCGCTATAGCCGCCGGTGACACCCGGGGGAAATATAAAGAGAACGCCTCCCCCTTATCCTCGGGCATATTTCTCCCAAGGAACATGTGTGACACATAACGTGGTTATGGTACAGCCGAGCTCCTCCCGCACTTTTACACATCGCCCTCTTCTCTCTCACCAACTTGTGTCACATTCCCNGCGACCCTATAAAGACGTCGCTCACCTC
  5   1   2       bld Em10 5g                         IMAGE:7979101.5p                                                                                 GATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAACCCCAGTTTGCGGCACTTCTACAGAGCTCTTCCAAATACTCCTAAATTAATAAGTCTCTGCCGGGAGTGGAGTGCCCAAATGTCCAGCATCTCCCGGCAACTAGAAC
  5   1   2       bld Em10 5g                         IMAGE:8319013.5p                                                                                 GATCTTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTTTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACG
  5   1   2       bld Ga18 5g3  in                       xlk80h21ex.5p                                                                                 TGATCTTGTAAGGCTACTNNTGCTTCTCTCCAGCGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCANNNNNTGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGNTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTNGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGNTGTTGGGNCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTNCTCCAAAANACTCCTAAACTCAACACGTCGCTGC
  5   1   2       bld Emb1 5g                         IMAGE:6863538.5p                                                                                  ATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAAACATGGTGGAGCCTTGCACAGACAAGTCCAAACAATTTCCCCTCCTTTTCTCTAGCAAACCCATTGGGTTGTTGGGTTACAGCCCCAGTTTGCAGCACTTCTTAAAGAACTCCTCCCAAACACTCCTAAACTCAACACGTCGCTTTCCGTGAGGTGTAAATGCCCAAACTGCCAAGCATCTCCCCGGCAACGAAGAAACCAGGCAAAAAGAAAACTCCCAATTCGGTCATCCTTCCAAGGCTGTTGGCAATATGTTTTTGAAAAGAACTTTCCCCTTTTTATATGGCCCCCCTTTATCGTTTGGGCACTGGCAAGGTTGAAAAAGGCCT
  5   1   2       bld DMZ  5g3  in                         xl308j14.5p                                                                                  ATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGG
  5   1   2       bld DMZ  5g3  in                         xl262d16.5p                                                                                  ATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCANTATCCTGGCCACATGCAAACTGNTG
  5   1   2       bld DMZ  5g3  in                         xl262h21.5p                                                                                  ATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGNTTATTCATTTGATTTGNCTCCCGTCNAAGTATTGACTCCACAAATGCAGAGCAANGCTGCCNACCATTTCCAAGACCCAAGTGC
  5   1   2       bld DMZ  5g3  in                         xl227g11.5p                                                                                  ATCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGANGTGTAAGTGCCC
  5   1   2       bld Emb1 5g                         IMAGE:3403117.5p                                                                                   TCTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTATTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTC
  5   1   2       chi Ga12      in                         XL219n20.5p                                                                                    GAAGAGGAGGGCCGGAGGCATGGGTGACAGACTCTCTCTCCAGCTCACTGAGAGGGGCTACCCACGTTCCAAGTGATTAATCTCTATGTGGTGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGGTTGTTGGGTCACAGCC
  5   1   2       bld DMZ  5g3  in                         xl234a20.5p                                                                                    CTTGTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGNCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCNAACTGTCGCCTCTCATGAGCTCCCATTAACCCCNCCNGCGGATCCNACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGATATTGACTCCACAAATGC
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200084.5p                                                                                     TTGTAAGGCTACTGCTGCTTCTCTCCATCTTGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAGTCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCA
  5   1   2       bld Emb9 5g                         IMAGE:7975557.5p                                                                                     TTGTAAGGCTACTGCTGCTTCTCTCTAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCGGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAACAATTTCCCCTCCTTTCATCTAGCAAACCATTGGTTGTTGGGTCACACCCAGTTTGCACACTTCTCAGAGTCCTCCAAACACTCCTAACTCACCCTCCTGCGGAGTGTAGTGCCAAACTGCAGGATCTCAGCCACAGGACAG
  5   1   2       bld DMZ  5g3  in                         xl237g04.5p                                                                                       GTAAGGCTACTGCTGCTTCTCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTCGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGA
  5   1   2       bld Ga18      in                      xlk139g07ex.5p                                                                                        ATGATCTTGTAAAGCTGCTGNTGCTGCTTCCCTCCAGNNNACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAANNATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGNTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGNTGTTGGGTCACAGCCCCAGNTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCNGAGNNTAAGNNCCCAAACTGCCNAGNATCTCCAGG
  5   1   2       bld Ga15      in                       XL432l08ex.5p                                                                                          ATCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTGTGGCAAAAGTGTATGGAAAAACTTCCCATTTAAAAGGCCCACTT
  5   1   2       bld Emb1      in                    IMAGE:3402553.5p                                                                                           TCTTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCT
  5   1   2       bld Neu7      in                         XL027c21.5p                                                                                             GTGTAAAGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCA
  5   1   2       bld Ga18      in                       xlk53j16ex.5p                                                                                                 TAAAGCTGCTNNTGNTNCTTCCCTCCAGCGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAANNNATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGNTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGNTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCNGANNGTAAGTNCCCAAACTGCCNAGCATCTCCAGGCAATGAGGNANNGGGCAAAAAGAAGNTCCATATCTGNNNTCNNNNGCTGTNGNAAAGTGTANNNNAAACTTC
  5   1   2       bld DMZ       in                         xl322o10.5p                                                                                                   AGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGG
  5   1   2       bld DMZ       in                         xl274p02.5p                                                                                                   AGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGCCCAANCTGCCAAGCATCTC
  5   1   2       bld DMZ       in                         xl285n22.5p                                                                                                   AGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAATTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCNAAACACTCCTAAACACAACACGGCGCTGCC
  5   1   2       bld DMZ       in                         xl262b10.5p                                                                                                   AGCTGCTGCTGCTGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGANGTGTAAGTGCCCAAACTG
  5   1   2       bld Neu7 5g3  in                         XL012a02.5p                                                                                                     GCTTCTCTCCGCGGGNACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGAC
  5   1   2       bld Ga12      in                         XL197h23.5p                                                                                                             AGGGCTTCCCTCCAGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGG
  5   1   2       bld Neu7 5g3  in                         XL040b20.5p                                                                                                              ACGAGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGNAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCCAAGTGCAGTG
  5   1   2       bld Emb1 5g                         IMAGE:5154939.5p                                                                                                                GCGGGACAAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTCCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCTCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAAGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTTCCCAGCTGTGGCAAAAGTGTATGGAAAGACTTCCCCATTTAAAGGCCCACTTACGTTGGCATGCAAGGTGGAGAGGCCG
  5   1   2       bld DMZ  5g3  in                         xl287b22.5p                                                                                                                       AAACCTCATGGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGANGTGTAAGTGCCCAAACTGCCAAGCATCTCC
  5   1   2       bld Neu7      in                         XL050g12.5p                                                                                                                          GGCGGGACAAACCTCATGGCTTCTCTGGTTCTGCAGAGAGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCAGACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCAAGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCC
  5   1   2       bld Em10                            IMAGE:8321023.5p                                                                                                                                GGCTTCTCTGGTTCTGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTCCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCC
  5   1   2       bld Neu7      in                         XL026n01.5p                                                                                                                                              TGCACAGAGAGAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTTCAGACGGAGGACCCCTGACATCTTNGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCANTTNTGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTNCNATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAA
  3  -1   2       bld Bla2                            IMAGE:7295729.3p                                                                                                                                                        GAACACACTTCAAGCTTATTTACAGGACAGAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACAGCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTNCAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGNCAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAACAATTTCCCCTCCTTTCATCTAGCAACCCATTGGTTGTTGGGTCACAGCCCAGTTTGCACCTTCTACAGAGTCCTCCAAACCTCTAACTCACACTCCTGCGGAGGGTAGTGCCACTGCAGCTCTCAGCACGAGACAGCAAAGACTCTATCGCTCTCAGCTGTGCAGTGATGAACTCATTANGCATACTGCGAGTAAGCTCCTCATGATATGAATCCGTGAATGAGCA
  5   1   2       bld Ga12      in                         XL200h10.5p                                                                                                                                                                AGACAACACACTACAAGCTTATTTACAGGACAGAACACCTAGTTCTTCACCANACGGAGGACCCCTGACCTCTTTGGCCCTGTTTCCATCAACCTGTGGTCCTGTTATTACAGCANGACCCACTCCCCGGGAGTATACACAGTCTGCATACGATCCAACTTCAGGAATGTTTCNGCTATGGAGCAATGATGTTCNTGCCAATNCAGGGATCGGTTCCCATGCT
  5   1   2       bld Ga18      in                       xlk63f19ex.5p                                                                                                                                                                             TTNNGACANAACTCCTAGTTCTTCTCCAGACGGAGGACCCCTGACATCTTTGGCCCTGTTTCAATCAACCTGTGGTCCTGTTCTTACANCCAGACCCATTTCCCGGGAGTATACACAGTCCGCATACGATCCTGTTGCTCCAACTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCANACANTGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGNNNGTAAGTGCCCAAACTGCCAAGCATCTNCAGGCAACGAGGAANCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTNGNAAAGNNNATGGAAAGACTTCCCATTTAAAGGNCCA
  5   1   2       bld Emb1                            IMAGE:5155349.5p                                                                                                                                                                                                                                                                                                                  CGTACGATCCAACTTCAGGAATGTTTCAGCTATGGAGCAATGATGTTCCTGCCAACTCAGGGATCGGTTCCCATGCTGTGACATTTGGTGTCCCCAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGAAGTTCACCAAAATCTGATGACCTGCAGAAGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAAGAGTGTGGCAAGAAGTTTATGAAGAAATGACCACCTTTTCCAACATAACCAAAACCCCACCAGAGCAAAAAAGAAGAAAGGGGC
  5   1   2       bld Ga15      in                       XL507m05ex.5p                                                                                                                                                                                                                                                                                                                            CTTCAGGAATGTTTCAGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGA
  5   1   2       bld Tbd7      in                         XL107n08.5p                                                                                                                                                                                                                                                                                                                                           GGTTATGGAGCAATGACATTCCTGTCAACTCGGGGATCGCTTCCCATGCTGTGACATTCGGTGTCCCTAAAGTGCAGTATCCTGGCCACATGCAAACTGTCGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAG
  5   1   2       bld Emb9                            IMAGE:7975911.5p                                                                                                                                                                                                                                                                                                                                                 GGAGCAATGATGTGCCTGCCAATTCACGGGATCCGTTCCCATGACTGTGACATTTGGTGTGCCTGAAGTGCAATATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCACCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAAAGCAATGCTGCCTACCATTTCCAAGACCAAAGTGCAGTGGCTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACACACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGAGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTACAGGCTGTGGCAAAGTGTATGGAAGAACTTGCCATTTAAAGGCCCACTTACATTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGACTTTCACCGGATCTGACGAACTGCAGAGGCACCTTATGAC
  5   1   2       bld Em10                            IMAGE:7983624.5p                                                                                                                                                                                                                                                                                                                                                                                               GCCGGATTCCCGGGATAAAGTGCAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTANGACTCATACTGGTGAGAAACGCTTTGGTTGCCANGAGTGTGGCAAGAGGNTTATGAGAAGTGACCACCTTTCAAACATACCAAACCCACCAGAAACAAAGATGAGTGTGCGACTCTCCCTGNAAATATTAAA
  5   1   2       bld DMZ       in                         xl267m04.5p                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTATCCTGGCCACATGCAAACTGTTGCCTCTCATGAGCTCCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCNGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGG
  5  -1   2       bld Bla2                            IMAGE:7299718.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                NAACAACATAAAACAAAAGGGCGGGGCTAATTCCGGGAATCTTTTTTAAAAGGTTCCCAAAAATTTCTTTGACCCAACCCCCGGGGTCTTTTTTATGTTTTCCGAAAATTTGTCCAAAAGGGAGACGTCCTCCCTCCAGACCAAGGGAGGATCAGTTTTCAAAGTTAAGAAGTTCAACCTTTGACCAAAGCCCTGGTTCCAACACATGGGGCCCACACAGTGGAGGCTGCAGCAGACAATTCAAACAATTTCCCCTTCTTCATTAGCAAACCCATTGGGTGTTGGGTAACAGCCCCAGTTTGGAGCATTTTTAAAGGGTTCTTCCAAAAAACTTCTAAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCACGAGGGACCAGGGCAAAAAGAAGCTCCATATCTGTCATCTTNCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAAAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaaacaaacttaaaatTGCACATTTTACTCAACAAAAGACTCGGCCTATGAATGTTTAAACATTAGGGACCCCGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATTTTTCCTAAGTTTGTCTCCGTCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGTTTGTTTCAAATGAGTATGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTCGTGGTATCGCTCATCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTCTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGCTTTGTTTATCTAAATACAATAAAATACTTGACTTCTTATaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCTAAGTAT
  5   1   2       bld Gas5                            IMAGE:3749424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAATTCCATTAACCCCTCCAGCGGATCCTACTGCTTATTCATTTGATTTGTCCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAA
  5   1   2       bld DMZ       in                         xl276f14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGGATCCTACTGCTTATTCATTTGATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAATGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAA
  5   1   2       bld Ga18      in                       xlk62j14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTACTGCTTATTCATTTGATTTGTCTCCAGTCAAAGTATTGGCTCCACAAGTGCAANGNNTGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGGNTCAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTNNNNNGNGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTGTGNNAAAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGNNCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGNNACCTTAGGACTCATACTGGTGAGAAACGCTTTGNNTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGNGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGNNAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTNTTCAACAAAAGACTCAGCCTATGAATGTTTGA
  5   1   2       bld Ga15      in                       XL451o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTGTCTCCCGTCAAAGTATTGACTCCACAAATGCAGAGCAACGCTGCCTACCATTTCCAAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaaacaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTA
  5  -1   2      seed Bla2                            IMAGE:7299616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCGACCCCACCACCCCCCTTTggggggggACCAACAAAAATCCTGCCGATACCCAAAAAAAGGGCCGGGGGCCTTAAATTTCCCGGCGAATCCTCCAAAGAGGAGGCCTCTTTAAAACAAGCGATCATTTTCAATTGCAGGTTACCCTGCCCAGCCTTGGTTCACCCCTTGGGCCACTGGGGACTCAGCGCAAGTCAACATTCCCTCTTTATTAGCACCCATGGTGTGGTCACGCCCCGTTGAGCACTTTACAAGCTCTCCAAACATCCTACTTCACAGTCGCTGCGGAGTGTAGTGCCAAACTGCCAGCATTCCAGGCACGAGGACCAGGCAAAAGAAGCTCCATTCTGTCTCTTCCAGGCTGTGCAAAGTGTATGAAAGACTTCCCATTTAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaatTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCATCGCCCAAGACGCGGN
  5   1   2       bld Ga12      in                         XL175c06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACAAATGCAGAGCATGCTGCCTACNTTTCCAGACCCAAGTGCAGTGACTCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATAT
  5   1   2       bld Ga18      in                       xlk70o17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCANNNNNTGCTGCCTACCATTTCCAAGACCCAAGTGCAGNNNNNAAGACTTCTCAAGCTTTATGCAAGGTTCAGCCACTTTGACCCAAAGACACTTGAGTTCAACGCACATTGATGAACAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTNNNNNGNGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTNTGGNAAAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGGNCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGNNACCTTAGGACTCATACTGGNGAGAAACGCTTTGGCTGCCAGGAGTNTGGCAANAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAGATGAAGNGTGCAGGGNCTCCCCNNNAAAANNNNAAAAGGA
  5   1   2       bld Emb1                            IMAGE:6862888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAAGACTTCTCAAGCTTTATGCAAGGTTCAACCACTTTGACCCAAAGACACTTGAGTTCAACACACATTGATGACCAGACATGGTGGAGCCTGCAGCAGACAAGTCCAAACAATTTCCCCTCCTTTCATCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGAACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCCTTGGGGTATTTATAGACATTTTCGAAAATTGGAATATGCCNNGAGCTTTTTCTAATATAAAACCTTTGCTTGGTTT
  5  -1   2       bld Bla2                            IMAGE:7299706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          NGTCTGTGTAGAAGAGCAATTTGCCACCGGtttttttttCGAAGGACCAGAGGACTCCCTTCACCAGGGAGTAATTTAATTATAAGTACCATTACCAGCATGTTTAACACTGATCCGCTGGGGGGCTCACAAAAATCAACATTTCCCTCTTTTTTAGAAACCAGGTTGTGGTACGCCCCAGTTTCACATTTACAGACTCTTCAAACCATCTAAAATCACAGTCGTGGCGGAGTGTAGTGCCCAACTGCCAAGCTTTCCCGGCAGGAGGAACCAGGCAAAAAGAGCTCCATATCTGTCTCTTCCAGGCTGTGCAAAGTGTATGAAGACTTTCCCATTTAAAGCCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAAAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaaacaaacttaaaatTGCACATTTTACTCAACAAAAGACTCGGCCTATGAATGTTTAAACATTAGGGACCCCGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATTTTTCCTAAGTTTGTCTCCGTCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGTTTGTTTCAAATGAGTATGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTCGTGGTATCGCTCATCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTCTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGCTTTGTTTATCTAAATACAATAAAATACTTGACTTCTTATTAATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACACTGCAAGAAAATAAAAGGAATTTAATGATCaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCTTAGATACCCN
  5   1   2       bld Ga12      in                         XL176c07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTCCAAACAATTTCCCCTCCTTTNTCTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACTCAACACGTCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaaTTGCACATTTTACTCAACAA
  5   1   2       bld Tbd7      in                         XL098l23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTTCCCTCATTTCATTTAGCAAACCCATTGGTTGTTGGGTCACAGCCCCAGTTTGCAGCACTTCTACAGAGCTCCTCCAAAACACTCCTAAACACAACACGGCGCTGCCGGAGGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGT
  3   1   2       bld Ga18      in                      xlk139g07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNGNTNGNNNACAGCCCCAGTTTNCANNNCNTCTACAGAGCNCCTNNAAANNNCNNCTAAACACAACANGNGCTGCCGNAGGNGTAAGNGCCCAANCTNCCAAGCNNCTCNAGGCAATGAGGNANNGGGNAAAAAGAAGCTCNANNTCTGNCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAANCTTCCCATTTAAAGNNNNCTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGANTTTCACCAGATCTGATGANCTGCAGAGNCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGNTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGNNCCTANNNNNTTTCAACAAACNGCA
  3   1   2       bld Ga18      in                       xlk70o17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCCCCANTTTNNAGNNCTTCTACnnnnnnnCTnCCAAAnnnnnCCTAAnnnCAACnnnnnnGCCGGAGNNGTAANNNNCCAANCTGCCAAGNNNCTCCAGGCAATGAGGANCNGGGNAAAAGAAGCTCCATNTCTGCCNTCTTCCAGNCTGTGGCAAAGTGTATGGAAAANCTTNCCATTTAAAGNNCNNCNTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGNAGANTTTCACCAGATCTGATGNACTGNAGAGNCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGNCCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGNTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGNNCCTANNNNNNTTCAACAAACNGCAAAA
  5   1   2       bld Ga18      in                      xlk163d17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTAAACTCAACACGTCGCTGCCNNNGNGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGNAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGANATGCCTTGNGGTANNNNTAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATNAGGGAGTNNTTGTGGGAATCTTGGNGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTNTNCATTTNNTTTNGGATNNAATGCTTTNATAG
  5   1   2       bld Gas8                            IMAGE:3515817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGCGCCGTGTTGTGTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTATGACTCATACTGGTGAGAAACGCTATGGCTGCCAGGAGTGTGGCAAGAGGTTTATGACAAGTGACCACCTATCCAAACATACCAAAACCCACCACAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTT
  3   1   2       bld Ga18      in                      xlk132a04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CANGNGCTGCCGGAGGTGTAANTNNCCAAACTNNNAAGNATCTCCAGGCAATGAGNACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGNCTGTGGCAAAGTGTATGGAAAANCTTCCCATTTAAAGGNNNCTTACGTTGGCACGCTGGTGAGAGNCCATTCATCTGCANCTGGATGTTATGTGGGAAGANTTTCNCCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGGNTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCCAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGNCTTCTTATTCNTTCCATTCATGCAAATGT
  5   1   2       bld Ga18      in                      xlk132a04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAAGTGCCCAAACTGCCAAGCATCTCCAGGCAATGAGGAACCGGGCAAAAAGAAGCTCCATATCTGCCATCTTCCAGGCTGTNNNNAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGGNCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGNNTGCCAGGAGTGTGGCAAGAGGNTTATGAGAAGNGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGNGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTANGNNTTGTCTCCATCCCCCCAAAAAAAGCCACATGTGATANATTTAAAAGGGNNNNNNCNTTTGGGNATTTATAGACNTTT
  3   1   2       bld Ga15      in                       XL451o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTNTCCCAGGGCAAGGNGGNAACCCAGGCAAAAAGGANGCCTCCCATATCTGTTCATTCTTCCAGGCTGNGGGCAAAGTGTATGGGAAAGACTTCCCATTTAAAGGCCCCACTTACGTTGGCATGCAGGTGAGAGGGCCGTTCATNCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAACAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGCTTGT
  5   1   2       bld DMZ       in                         xl245g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCAAACTGCCAAGCATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGTTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTC
  5   1   2       bld DMZ       in                         xl308g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCTCCAGGCAACGAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTT
  3   1   2       bld Ga12      in                         XL176c07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGAACCAGGCAAAAAGAAGCTCCATATCTGTCATCTTCCAGGCTGTGGCAAAGTGTATGGAAAGACTTCCCATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCG
  3   1   2       bld Ga18 5g3  in                      xlk161o17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNAGGCNAAAANNNAGCTCCANNTCTGTCNTNNTCCAGNNTGTGGCAAGTGTATGNAAAGNCTTCCCATTTAAANNNNNNCNTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGANTTTCACCAGATCTGATGAACTGCAGAGNCACCTTAGGACTCATACTGGTGAGAANCGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAACAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGCTNNNNNNNCTAAATAC
  3   1   2       bld Ga18                             rxlk116h19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANGCAAAAAGNAGCTCCNNNTCTGTCATNNTCCAGGCTNTGGCAAAGTGTATGGAAAGNCTTCCCATTTAAAGGNCNNCTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGNNAGANTTTCACCAGATCTGATGAACTGNAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTNNNNCTNNCATCNTTTCAACACNNNNNAGAAAA
  3   1   2       bld Ga15      in                       XL432l08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAAAGTGTATGGAAAAACTTCCCATTTAANGGCCCACTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGNNGAGTTTCACCAGATCTGATGAACTGCAGAGGCANCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGTTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTG
  5   1   2       bld Gas3      in                      xlnga003i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAAGTGTATGGAAAAACTTCCCATTTAAAGGCCCACTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTNTCTCCTAGGTTTGTCTCCATCCCCCANAAAAAAGCCACATGTGATACATTTAAAAGGGACAC
  3   1   2       bld Ga18 5g3  in                      xlk126p24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAAGTGTATGNAAAGNNTCCCATTTAAAAGGNCCNCTTANGTNGGNATGCAGGTGAGANNCNGTTCATCTGCANCTGGATGTTATGTGGGNAGANTTTCNCCAGATCTGATGAACTGNAGAGGCACCTTAGGACTCATACTGGTGAGAANCGCTTTGGTTGCCAGGAGTGTGNCAAGAGGTTTATGAGAAGTGNCCNCCTTTCCAAACATACCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATNCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACT
  3   1   2       bld Ga18 5g3  in                       xlk80h21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAAANNNNNNGNAAAGNCTNNCNTTTAAAGGNCCNNNTACGTTGGCATGCAGNTGAGNGNCGTTCATCTGNANCTGGNTGNTATNNGGGAAGANTTTCACCAGNTCTGATGNACTGNAGAGGCACCTTAGGNCTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGNCCACCTTTCCAAACATACCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATNCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATNTCTCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATANACT
  3   1   2       bld DMZ  5g3  in                         xl308j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTGTATGGAAAGACTTCCCATTTAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTGTA
  5   1   2       bld Ga14                              Ga14-p17g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAAACTCCCATTTAAATGGCCCACTTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGCGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGCGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTC
  3   1   2       bld DMZ  5g3  in                         xl262d16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTAAAGGCCCACTTACGTTGGCATGCAGGTGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTGT
  5  -1   2       chi Bla2                            IMAGE:7297774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTCATAAGCGGGCACACTCGAGACGAAACATTCTTCGTGGAGTAGAGTCATAAGCATAGTGCACAGGGGCGTCTTGACTGAGTAGTGAGAGTCACAATTGAGACGCAGAGCCTTAGATCATATGTGAGAACCTTGGTTCCGGAGGGGCAAGAGTTATGGAAGTGCCACCTTCCAAACTACCAAAACCCACCAGAAAAAAGATGAAGTGTGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaatTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCAAGAGAGG
  3   1   2       chi Ga18      in                       xlk53j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTACGNNNGCNNGCTGNTGANNNNNNTTCNTCNGCNACTGNNTGNTNTNTGGNNNGANTTTCNCNAGNTCTGATGNNCTGCAGAGGCACCTTAGGACTCATNCTGGTGAGAANCGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGNNCACCTTTCCAAACATNCCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCCAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATNNCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGNNCCTAnnnnnnnnANCAAACTGCAAAA
  3   1   2       bld DMZ       in                         xl303l07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTACGTTGGCACGCTGGTGAGAGGCCATTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTGT
  3   1   2       bld Ga18      in                       xlk62j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACGTTGGNNNNCTGNTGAGAGGCCATTCATCTGNNACTGGNTGTTNTNNGGGAAGANTTTCNCCAGATCTGATGNNCTGCAGAGGCNCCTTAGGACTCATNCTGGTGAGAANNNCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGNNCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATNCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGNCTTCTTATTCNTTCCATTCANGCAAAT
  3   1   2       bld Ga18      in                      xlk163d17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGNATGNAGNTGANNNNNTCNTCTGCAACTGGATGTTATGTGGNANNANTTTCACCAGATCTGATGNACTGNAGAGNNACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAANCTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATNCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGNNNNNNTNNCNTNNNNANNAC
  3   1   2       bld Ga15      in                       XL507m05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGNGAGAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTCAACACAT
  3   1   2       bld Neu1      in                      Neu1-26C1-1.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAGAGCCCATTCATCTGGCAACTGGATTGTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCCAGGAGTGTGGCAAGAGGTTTATGAGAGGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTT
  3   1   2       bld Ga18      in                      xlk115b17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGANGNCNTTCATCTGCAACTGGATGNTNTGTGGNNAGANTTTCNCCAGATCTGATGNNCTGCAGAGNNACCTTAGGACTCATACTGGTGAGAANNNCTTTGGCTGCCAGGAGTGTGNCAAGAGGTTTATGAGAAGTGNCCACCTTTCCNAAACATNCCAAANCCCACCAGAACAAAAAGATGAAGTGTGCAGGNTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTGTNCCTANNNNNTTTCAACAAACTNNAAANNNNNNAAAA
  3   1   2       bld DMZ                                 rxl250d01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGCCGTTCATCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTT
  3   1   2       bld DMZ  5g3  in                         xl237g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTGCAACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTGTTA
  3   1   2       bld DMZ  5g3  in                         xl262h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTGGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTGTTATCAAAAAAAAA
  3   1   2       bld Ga12      in                         XL200h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATGTTATGTGGGAAGAGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATCATCC
  5  -1   2       bld Bla2                            IMAGE:7297600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTCGTGCAGTGAGTCATAGCCATCTGCGCGTGGCGTCTGCATGAGTAGTGAGGTCCGATCGTGATCAGGCACTAGATCTATGTGGACGCTTGTGCCAGAGGTGCAGAGTTAGAGAGTGACACTTCCAACTACCAAACCCACCAGACAAAAGATGAAGGTGCAGATCTCCCCTGGAAATATAAAAAGGAGTAAAAACCCAAGCAAATTAAAATTGCACATTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCCTTTT
  3   1   2       bld Ga15      in                       XL438d04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTTCACCAGATCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTT
  3   1   2       bld DMZ                                 rxl311k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATNTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTT
  3   1   2       bld DMZ       out                        xl266d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATNTGATGAACTGCAGAGGCNCCTTNGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTG
  3   1   2       bld DMZ       in                         xl262b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTCAACAAACGCAAAAAA
  3   1   2       bld DMZ       in                         xl308g21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATT
  3   1   2       bld DMZ  5g3  in                         xl287b22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAACTGCAGAGGCACCTTAGGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCA
  3   1   2       bld Ga12      in                         XL219n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCCCCTTTCCAAACCATACCAAAACCCACCCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATGTAAGAAAA
  3   1   2       bld DMZ       in                         xl245g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACTCATACTGGTGAGAAACGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATT
  3   1   2       bld DMZ  5g3  in                         xl227g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACTCATACTGGTGAGAAACGCNTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCCAGTTGTTCCTACCATCA
  3   1   2       bld DMZ       in                         xl285n22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTCATACTGGTGAGAAACGCTTTGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCCAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTAC
  3   1   2       bld Gas6 5g3  in                    IMAGE:3438535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGTGAAAAACGCTTTGGTTGCCAGAAGTGTGCAAAGAGGTTTATGAGAAGTGACACTGTCCCNAACCATCCAAACCCCACCCAGAACAAAAAGAATGAAGTGTGCCGACTTCTCCCTGGGAAAATATTAAAAAGGAGTAAAAAACCAAGCCAAACTTAAAATTGCACATTTNACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTAATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCAAAA
  3   1   2       bld DMZ       in                         xl322o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAGAAACGCTTGGGCTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCCAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTT
  3   1   2       bld DMZ  5g3  in                         xl338g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AANCGCTTTGGTTGCCAGGAGTGTGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATT
  3   1   2       bld DMZ  5g3  in                         xl234a20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGGAGTGTGGCANGAGGCNTANGAGAAGTGANCACCTTTCCAAACATACCANAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTNAAATTGCACATTTTACTCAACAAAAGACTCAGCCTNNGAATGTTTAAACATTAGGGNCCCTGAACCTGTTGTATATAGAAAGGTCNTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCNTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGNGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGNGAGGNGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTNGNGCAGCAGGTTTGCGCANGTCTCCTTTGGATATAAAGCTGCTACTGATNGTGAGTGTGTGTATATACTGC
  3   1   2       bld Ga18      in                      xlk156l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCAAGAGGTTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAACAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATNTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATNNNNNNCTTTGTTTATCTAAATACAA
  5   1   2       bld Ga18      in                      xlk156l17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCAAGAGGNTTATNAGAAGNGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGgaaaatattaaaaaggagtaaaaaacccaaacaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGCTTTGTTTATCTAAATACAATAAAATACTTGACTTCTTATTCATTCNNA
  3   1   2       bld Ga18 5g3  in                        xlk3o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTTTATGAGAANNGNCCACNTTNCNAAACATNCCAAAACCCACNAGNACAAAAAGATGAAGTGTGNAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGANCCTGTTGTATATAGNNNGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATNCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGNTCCTNCCATCATNCAACNCANNTNAG
  3   1   2       bld DMZ  5g3  in                         xl314c05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTATGAGAAGTGACCACCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCAT
  3   1   2       bld Ga18      in                       xlk63f19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGAAGTGNNCNNCTTTNCNAANNATNCCAAANCCCNNNGNACAAAAAGATGAAGTGNGCAGNCTCTCCCNNGGAAAATATTAAAAAGGAGTAAAAAAnCCAAGnAAACTTAAAATTGCACATTTACTCAnCAAAAGNCTCAGCCTATGAATGTTTAAACATTAGGGNNCCTGANCCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAANCCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGNTCCTNCCATCANNCAACANNNNNNAGA
  5  -1   2       bld Bla2                            IMAGE:7297419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGTTATGGAAGAGCGACCCTTCCNACATCCCAACCACCAGACAAAAAGATGAGTGTGCAGACTCTCCCCTGGaaaatataaaaaggagtaaaaaacccaagcaaacttaaaattGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAAGaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCCTGCCCATATCC
  3   1   2       bld Ga12      in                         XL197h23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAANNTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGT
  3   1   2       bld Ga12      in                         XL175c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCNTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACANGTAAGAAAATAAAAGGAA
  3   1   2       bld Ga12 5g3  in                         XL151g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCCAAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGG
  3   1   2       bld Neu7                                 XL021f09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACATACCAAAACCCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATGTAAGAAAATAAAAGGAATTTAA
  3   1   2       bld Neu7 5g3  in                         XL032a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACATACCAAAACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATGTAAGAAAAAAAAGGAATTT
  5  -1   2       bld Bla2                            IMAGE:7300418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTTTCCAACATACCAAACCCCCAGACAAAAAGATGAGTGTGCAGATTTCCCCTGGAAAATTTTAAAAGGAGTAAAAACCCAGGCAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCCTTTGaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCCCTTAGGATGG
  5  -1   2       chi Bla2                            IMAGE:7299950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTCAGATGGCAGAGTATGGAGGACACTNCNACTACCAACCACAGACAAAGTGAGGGCGCTCTCCCTGAATATTAAAGGAGTAAAACCCAGCAACTTAATTGCCATTTACTCACAAAGACTCAGCCTAGAAGTTTAACATTAGGGACCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCACCCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCCTTTGTaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCGCCCAAGACGCCG
  3   1   2       bld Neu7      in                         XL049o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAAAACCCACCCAGAACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTCAACAAACGCAAAAAAAATAAAAGGAATTTAA
  3   1   2       bld Ga15                               XL425g18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCACCAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTCAAC
  3   1   2       bld DMZ                                 rxl309f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNCCAGAACAAAAAGATGAAGTGTGCNGACTCTCCCCTGGAAANTATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTNTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTCAGTATANAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATNTTTCCTAAGTTNGTCTCCATCCCCCAAAAAAGCCAAACNTGATACATTTAAAAAGGGACATGCCTTGGGGTATTGATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATNAANCCNNGCNTGTTTCAAATGAGTGTGCGTGGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCANCCCTGTTGNGGTATCGCTCNCCAGTCACAGGAGTCAATANTTATTCATNTCCTTTGGGATTAAATGCTTTTATAGGACATCTATNTNTTGGATGAGAGGTGCCCANCCNGTCANGGGGGATTCTGGGAGCTGTAGGGCAGCAGGNTTGCGCANGTCTCCNTTGGATATAAAGCTGCTACTGAGTCGTGAGTCGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACCTTGACTTNTTATTCATTCCATTCATGCAATTG
  3   1   2       bld DMZ       in                         xl276f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAACAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTNGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCAT
  3   1   2       bld Neu7      in                         XL027c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAAAAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACGCAAAAAAAAAAAAGGAATTTA
  3   1   2       bld Ga18      in                       xlk58m01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGATNNAAGTGTNNAGNCTCTCCCCCTGGAAAATATTAAAAAGGAGTAAAAANNNCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGNCCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGNCTTCTTATTCATTCCATTCATGCAATTGTGTTCAGTTNNCCTNCCNT
  3   1   2       bld Ga18      in                       xlk71h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAACAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATNTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGC
  5   1   2       bld Ga18      in                       xlk58m01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAGANGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGNNTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATNGTAAGAAATAAAANGNATTTAATGATCACaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl267m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGATGAAGTGTGCAGACTCTCCCCTGGAAAATATTAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCAT
  5   1   2       bld Ga18      in                       xlk71h17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGATGAAGTGTGCAGACTCTCCCCTGgaaaatattaaaaaggagtaaaaaacccaaacaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATGAGAGGNGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGNTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAATGTGTGTATATACTGCTTTGTTTATCTNAATACNATAAAATACTTGACTTCTTaaaaaaaaaa
  5  -1   2       bld Bla2                            IMAGE:7296769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGATGAAGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCaaaaaaaaGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCaaaaaaaataaaaggaatttaatgatccttt
  5  -1   2       bld DMZ       out                        xl250j16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGTGCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCaaaaaaaaGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTCATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCNGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGACTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCANGCAAATGNGTTTCAGTTGTACCTACTGTCCNTTCAACAAACTGCaaaaaaaataaaaGGAATTTAAT
  5   1   2       bld Ga15      in                       XL451c10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAGACTCTCCCCTGGaaaatattaaaaaggagtaaaaaacccaagcaaacttaaaaTTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCaaaaaaaaaa
  5   1   2       bld Emb1                            IMAGE:5156008.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGGGTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCaaaaaaaaGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTGTACCTACCGTCCTTTTCACAAACTGCaaaaaaaaaaaaaaGG
  5  -1   2       bld Em10                            IMAGE:8318760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCaaaaaaaaGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTTTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCaaaaaaaataaaaggaatttaatgatccttaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGC
  3   1   2       bld DMZ       in                         xl274p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCCCTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACT
  3   1   2       bld Tbd7      in                         XL098l23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCACATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACGCAAAAAAAATAAAAGGAATT
  3   1   2       bld Ga12      in                         XL159k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAAATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCACATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACGCAAAAAAAATAAAAGGAATTTAA
  3   1   2       bld Tbd7                                 XL081n04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATTAAAAAGGAGTAACAGAAACTTGCGCATTTTATTCAACAAAAGACTCAGCCTATGAAATGTTTGAACATTAAATAGTGACCCCGAATCTGTTGTATATAAAAATGTCCTTAGGTGTCACTCATGATGCAAAATTTTCTCCTAGGTTTGTCTCCATCCCCCAAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGTTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATANATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTGTACCTACCGTCCTTTCAACAAACGCAAAAAAAATAAAAGGAATTTA
  3   1   2       bld Tbd7      in                         XL107n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAAAAGGAGTAAAAAACCCAAGCAAACTTAAAATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTA
  3   1   2       bld Neu7 5g3  in                         XL012a02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTGCACATTTTACTCAACCAAAAGACTCAGGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGGTTTATCTAAATAAAAATANTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATNATTTCAACACATGTAAGAAAATAAAAGGAATTTAA
  3   1   2       bld Ga12 5g3  in                         XL142p13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGCACATTTTACTCAACAAAAGACTCAGCCTATGAAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGNAAAATAA
  3   1   2       bld Ga12      in                         XL191n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAAT
  3   1   2       bld Ga12      in                         XL192n07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAGACTCAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATGTAAGAAAATAAAAGGAAT
  3   1   2       bld Ga15      in                       XL451c10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGACTCAGCNTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGNGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGG
  3   1   2       bld Em10      in                    IMAGE:7982158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAATTCAACAAAGATTTAAGCCCTTGAATTTTTGAACATAAAATAGTGACAAGGAATCGTTGTATATAAAAATTTTATTAAGGTGTCAACTCAATGATGAAAAATTTTTCCTAGGTTGTCCTCCCATCCCCCAAAAAAAAGGCCACATGTGAAACATTAAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCACATTCATGCAAATGTGTTGTACCTTACCGTTCCTTTACC
  5   1   2       bld Ga12      in                         XL191n07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCCTATGAATGTTTAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCCTTTGTaaaaaaaaaa
  3   1   2       bld Ga12                                 XL167b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCNTATGAATNTTTAAACATTAGGGACCNTGAACCTGTTGTATATAGAAAGGTCNTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTNTAATATAAAACCTNGNTTGTTTCAAATGAGTGTGTGTNGTATATAAGGGAGTATTTGTGNGAATATTGGNGATANTGCATCCCTGTTGTNGTATCGCTCACCAGTCACTGGAGTCAATATTTANTCATTTCCNNTGGGATTAAATG
  5   1   2       bld Ga12      in                         XL192n07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCA
  3   1   2       bld Neu7      in                         XL026n01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATTAGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCGACCATCATTTCAACNCATGTAAGCAAA
  5   1   2       bld Ga18      in                      xlk121i02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGACCCTGAACCTGTTGTATATAGAAAGGTCCTTAGGNGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGNGTGTGTTGNATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATACCTGTCGNGGNATCGCTCACCAGTCACTGGAGNCAATATTTATTCATTTCCTTTTATAGGACATCTATTTTATTGGATGnnnnnnnnCCNACCTGTCAGGGGGGATTCTGGGAGCTGTAGG
  3   1   2       bld DMZ       out                        xl309k24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTATATAGAAAGGTCGTTNGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGT
  5   1   2       bld DMZ       in                         xl308k20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATANAAAGGTCCTTAGGTGTCACTCATGGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACNTTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTNCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGNTTGCGCATGTCNCCTTTGGATATAAAGCTGCTACTGATTGTGANTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGT
  3   1   2       bld DMZ       in                         xl241a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCCAGTTGTTCCTACCATCATT
  5   1   2       bld DMZ       in                         xl307k20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCCTTTGTaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl241a12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGATCCTTTGTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl307k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTCAA
  3   1   2       bld DMZ       in                         xl308k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGAAAGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCTCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTAATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGNAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATAGCTGCTTTGTTTATCTAAATAAAAATAGCTTGACTTCTT
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3200084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGTCCTTAGGTGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCGAACGTGATACATTTAATAAGGGACATGCCTTGGGGTATTTATAGACATTTCTGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCCATTGTGTTTCAGTTGTTCCAACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTT
  3   1   2       bld Neu7 5g3  in                         XL040b20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCACTCATGGTGCAAAATGTTTCCTAAGTTTGTCTCCATCCCCCAAAAAAGCCAAACGTGATACATTTAAAAAGGGACATGCCTTGGGGTATTTATAGACATTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTGGATATAAAGCTGCTACNATTGTGAGTGTGTGTATATACGCTTGTTATCTAAATAAAAATAC
  3   1   2       bld Ga18      in                      xlk104n24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAAAAAGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATNCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATANA
  5   1   2       bld Ga18      in                      xlk104n24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           aaaaaaaaGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTNaaaaaaaaa
  3   1   2       bld Gas3      in                      xlnga003i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTTTATAAAAAAAAA
  3   1   2       bld Emb1                            IMAGE:3401114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCACATGTGATACATTTAAAAGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTTTAAAAA
  3   1   2       bld Ga18      in                      xlk121i02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNAAGCCNNNCGTGATACATTTANANAGGNACATGCCTTGGGGTATTNATANACATTTCGAAATTGGAATATNNCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTNTGTGTNGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATNCCTGTCGTGGTATCGCTCNCCAGTCACTGGAGTCAATATTTATTCATTTCCTTTTATAGGACATCTATTTATTGGATNAGANGTGCCCANCCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTNNCNCATNT
  3   1   2       bld Neu7      in                         XL050g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGTANNNATAGACANTTNANAATTGGAATANGNNGAGCTTTTNTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTANANATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTAC
  3   1   2       bld Neu7 5g3  in                         XL050k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNCNNNNGGGNANNNANANACNTTTNGNNNTTGNAATANNNNNAGCTTTTNTAATATAAANCCNNGCNTGTTTCAAATGAGTGTGTGTTGTANATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGNTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCNANCTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTNCTTATTCATTCCATTCATGCAACTGTGTTTCAGTTGTTNCCTACC
  5   1   2       bld Gas5      in                    IMAGE:3750663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCATGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTGTACCTACCGTCCTTTCAACAAACTGCaaaaaaaataaaaGG
  3   1   2       bld Emb1      in                    IMAGE:3402553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTTTAAAAAAAAAAAAA
  3   1   2       bld Emb3      in                    IMAGE:3400038.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGACACACCTTTGGGTATTTATAGACATTTTATAATTGGAATATGCCGAGCTTTTCTAATTTACACCCTTTGTTTGTATTAGTGGGAATACTGGTAATCTAGCTGCCTCCCTATCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTAGACATCTTATTTATTGGGTGAAAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTGTACCTACCGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTTTAAAAAAAA
  3   1   2       bld Gas5 5g3  in                    IMAGE:3749528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCGAAATTGGAATATGCCGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAAAGATGATTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATAAACTGCTTTGTTTATCTAAATAAAAAAACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas5      in                    IMAGE:3750663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGAATATGCCGAGCTTTTCTAATTTAAACCCTTTGTTTGTTTAAAGTGAATGTGTGTTATATATAAGTATTAGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACATCAGTAGCTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCAGATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTGCTGAACTGGATAAAAGCTGCTACTGATTAGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTGTACCTACCGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTTTATAAA
  3   1   2       bld Unk3                                546_11P17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCTTTTCTAATATAAAACCTTGCTTGTTTCAAATGAGTGTGTGTTGTATATAAGGGAGTATTTGTGGGAATCTTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTGCCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAGAAAATAAAAGGAATTTAATG
  3   1   2       bld Emb1      in                    IMAGE:3403238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAAGTGAGTGTTTGTGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTTTGGGAGTCATAGGGCAGCAGGTTGCGCATTTTTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAAAAATAAAAGGAATTTAATGATCCTTTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas3      in                      xlnga003e24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGAATACTGGTGATACTGCTGCCTCCCTGTCGTGGTATCGCACCTCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCaaaaaaaaTAAA
  3   1   2       bld Gas4                            IMAGE:3421235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGGGAATATTGGTGATACTGCATCCCTGTTGTGGTATCGCTCACCAGTCACTGGAGTCAATATTTATTCATTTCCTTTGGGATTAAATGCTTTTATAGGACATCTATTTATTGGATGAGAGGTACCCAACCTGTCAGGGGGGATTCTGGGAGCTGTAGGGCAGCAGGTTTGCGCATGTCTCCTTTGGATATAAAGCTGCTACTGATTGTGAGTGTGTGTATATACTGCTTTGTTTATCTAAATAAAAATACTTGACTTCTTATTCATTCCATTCATGCAATTGTGTTTCAGTTGTTCCTACCATCATTTCAACACATTGTAAG
  3   1   2       bld Ga12      in                         XL200h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCGTGGTATCGCACATCAGTCACTGGAGTCAATATTTATTCCTTTTATTTGGGANTGAATGCCTCTATTAGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTT
  3   1   2       bld Gas3      in                      xlnga003e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGTGGTATCGCACCTCAGTCACTGGAGTCAAATATTTATTCCTTTTATTTGGGACTGAATGCCTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCAAAAAAAATAAAAGAAATATTAATGATCCTTTAA
  3   1   2       bld Ga15                               XL401b16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTATTGGACATCTATTTATTGGGTGAGAGGTGCCCAACCTGTCAAGGGGGATTCTGGGAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTG
  5   1   2       bld Ga18      in                      xlk154f16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTCATAGGNCAGCAGGTTNNNCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGTACCTACTGTCCTTTCAACAAACTGCaaaaaaaataaaaggaatttaatgatccttaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk154f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTCATAGGGCAGCAGGTTGCGCATCTCTGAACTGGATAAAAGCTGCTACTGATTGTGAGTGTGTGTATATATACTGCTTTGTTTATCTAAATAAAATACTTGACTTCTTATTCATTCCATTCATGCAAATGTGTTTCAGTTGNNCCTANNNNCTTNCAACAAACNGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)