Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012767513 Xl3.1-XL435c19ex.5 - 74 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL435c19ex.5                          AAGGTAGCCATTGTAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTTTTTATGTGTCTCTAAAATAAAACCGAAAAAAAAGAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685976                                GCCATTGTAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTxxxxxTTTTTTATGTGTCTCTAAAATAAAAxxxAxAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                               4     7     5    10    18    22    30    37    41    46    27    49    43    51    46    53    45    54    47    56    50    59    48    61    57    63    60    65    59    65    61    65    59    65    61    65    63    66    61    66    61    66    65    66    62    66    64    66    64    68    64    68    67    68    68    69    69    71    68    72    70    73    73    73    69    73    72    73    71    73    73    73    73    73    72    73    73    73    72    73    72    73    70    72    72    72    72    72    70    72    70    72    69    71    67    71    66    71    64    71    61    70    63    69    61    68    61    68    60    68    59    66    54    64    57    64    55    62    55    62    53    60    46    55    42    52    38    48    29    43    27    40    17    39    15    36    14    32    12    30    11    28     9    24     8    20     4    15     4    13     2     7     3     4
                                                                   VAR                                                                                      CACTGAAGCGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACT
                                                                   SNP                                                  -----T-----A
                                                                   SNP                                                              ---------T--
                                                                   SNP                                                                          -------C-T--
                                                                   SNP                                                                                                  CC----------
                                                                   SNP                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                  ------C-----
                                                                   SNP                                                                                                                                                              ---------A--
                                                                   SNP                                                                                                                                                                          T--C--------
                                                                   SNP                                                                                                                                                                                                  ---------C--
                                                                   SNP                                                                                                                                                                                                              ---------G--
                                                                   SNP                                                                                                                                                                                                                          G-----------
                                                                   SNP                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                  ------G--A--
                                                                   SNP                                                                                                                                                                                                                                                                                                  ---GG-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                              ------T--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              C-----T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              C--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---G--------
                                               BLH ATG      77     842                          
                                               BLH MIN      77     132                          
                                               BLH MPR      29     132                          
                                               BLH OVR      77      79                          
                                               CDS MIN      77      54                          
                                               EST CLI      19      54                          
                                               ORF LNG      77       3                          
  5   1   2       bld Ga18 5g3  in                      xlk152o15ex.5p TGATTAATAGTAAAGCCGGATGTTCTAAGGTAGCCATTGTAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGNNNNTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTNNGAGTNNCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGNTCATCAAAGATGTATTCATATCTGCTGCTGAGA
  5   1   2       chi Te1                             IMAGE:6928735.5p              GGCGGATGTTCTAAGGTAGCCATTGTAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGACCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTGGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTTCTTGGACAACCAGGATCGGAATTCCAGAAACATTGGCAGAAATGTTGAAGCCACCTTCCCTTCTGGAACATTTGGAAAAA
  5   1   2       bld Te2  5g                         IMAGE:7209664.5p                  GATGTTCTAAGGTAGCCATTCTGGGAGTGAGACAGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAGCATTGTGACTAAGACGGTGTCAGAGAGA
  5   1   2       bld FaBN 5g                         IMAGE:8078928.5p                      GTTCAAGGTAGCCATTGTAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGACCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGC
  5   1   2       bld Emb4 5g                         IMAGE:4680250.5p                       CCCACGCGTCCGCCCACGCGTCCGAGACAGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAAGTGATGACTTTGCTCTCGTGGCATCTGACACAGACTTAATGGAG
  5   1   2       bld FaB  5g3  in                    IMAGE:8069469.5p                       TTCAAGGTAGCCATTGTAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATNCAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGAACTAAGATGC
  5   1   2       chi Tad1                            IMAGE:6938089.5p                        GGGAAGGTAGCCATTCTGGGAGTGAGACAGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAGTCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCCTACCAAGCTGGTGGCTCTGCGAATTGCCCAGTTGCAGCCCTCTTCTTGACAACCCACATTCGAATACAAAGAACCATGCCAGAAATGGATCCAGGCCAGGGTCCCCTCCTGGACACCTTGGGAGGAAAGGGCTTCCTTGAAGACCTCATCTTCAACAGGAATGTGTTTTTTCCCCCTAATATCTGGCCCCTGTCCTTGAAAAAAAGGGGGCGAATGTTTCCCGTTGCCCTCCTCGGT
  5   1   2       bld Eye1 5g3  in                    IMAGE:6948894.5p                                GACCGGTCCGGAATTCTCGGGATCTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAAA
  5   1   2       chi Tad2      in                    IMAGE:6873562.5p                                   ATTCTGGGAGTGAGACAGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAAATCGGATACAAGAACATGCAGAATGCCGAGCAGGTCCCCTCTGAACCCTGGAAGAAGGCTCTTTAAGCCTCCATCCAAAGATGGAATTCCTTATCCTCGCTGGCTTGAAAAAGGGGAATGTCTTAACCCCGGGGCGAATGGCCTTCTGGCCATTATAAGCGCC
  5   1   2       bld Eye1 5x3                        IMAGE:6945871.5p                                     AGGCTGGACCGGTCCGGATTCCCGGGATGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAATGTTCTCGTCCGAATCCATTTTAAGTCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAAGTCGTTTCTCTGANGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTTAGCATCTTCTGAACTCTCTCGGAACATTCTTTGATTTCCGCAATGGGTGATCCTTTTTAAAGTGTCCTCCAAAATAAAAAA
  5   1   2       bld Skin 5g3  in                    IMAGE:8641942.5p                                       TAGGAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGACCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGCGTCAGAGAAGAGTCATTTTTCTCTAGAAGA
  3  -1   2       bld DMZ                                 rxl315e11.3p                                          GAGTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGA
  5   1   2       bld Ga15 5g                            XL429e15ex.5p                                            GTGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCANAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGANAGAGATGTATACACAG
  5   1   2       bld Te2N 5x3                        IMAGE:7203317.5p                                             TGAGACAGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAAGAGTCCGTTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGG
  5   1   2       bld Ga15 5g                            XL412l22ex.5p                                             TGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAG
  5   1   2       bld Ga15 5g                            XL487d01ex.5p                                             TGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGA
  5   1   2      seed Ga15 5x3                           XL512e09ex.5p                                             TGAGACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGT
  5   1   2       bld Emb4 5g                         IMAGE:5515002.5p                                               AGACAGCATTGGTGACTGTCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCATTTCTCTG
  5   1   2       bld FaBN 5g                         IMAGE:8078811.5p                                                GACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCA
  5   1   2       bld Tbd7 5g                              XL054j20.5p                                                 GCAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAA
  5   1   2       bld Te2N 5x3                        IMAGE:7201909.5p                                                 ACAGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAAGC
  5   1   2       bld Ga15 5g                            XL430p06ex.5p                                                 ACAGCACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCA
  3   1   2       bld Tad2      in                    IMAGE:6873562.3p                                                   CGCCTTTGGGATTGCCGGTTTTGACAGGGTCTTTGCACTGAAGCGTCCCAAATGTTCTTTTCCGAATCCTTTTAAATCGCGGGCTCAACAAGAGCATGGACTATCACTACCCTGGAACCTGTCGAGCAGCGCTTTAACCCCTACACCTTTAACGGAGGGACTGTGCGGCCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCATTTCTCTGAGGAAAGATTAGTCTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCNGAACTCTCCCGGAACA
  5   1   2       bld Te2N 5x3                        IMAGE:7205592.5p                                                   AGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCATTTCTCTGAGGAAAGAATAATTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCCTCTGAACTCTCTCGGGAACATTCTTTGATTTCCTGCAATGTTGGAATTCTTTTTTATT
  5   1   2       bld Te2  5g                         IMAGE:7210644.5p                                                   AGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAG
  5   1   2       bld Te2  5g                         IMAGE:7394801.5p                                                   AGCATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGT
  5   1   2       bld Egg1 5g                         IMAGE:3301353.5p                                                    GCACGAGGGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACGACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAAGTCCCTCTGACACTGGA
  5   1   2       bld Te2N 5x3                        IMAGE:7204968.5p                                                     CATTGGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTCNCTCTGAGGGAAAGATTAGTTTGACCATGCAGTCAGTG
  5   1   2       bld Ga15 5x3                           XL435c19ex.5p                                                     CACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATCT
  5   1   2       bld Ga15 5x3                           XL404c16ex.5p                                                     CACTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCA
  5   1   2       bld FaB  5g                         IMAGE:8072160.5p                                                       CTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGACCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGANCACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGG
  5   1   2       bld DMZ  5g3  in                         xl232c13.5p                                                       CTGGTGGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAG
  3   1   2       bld Eye1 5g3  in                    IMAGE:6948894.3p                                                         GGGTTGCCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAAATGTTCTCGTCCGAATCCATTTAAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCGAGAAAATTCTTTGATTTCNGCAATGCGGA
  5   1   2       bld Te2N 5g                         IMAGE:7768710.5p                                                         GGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCNAGATGTATCATATCTGCTGCTGAGAGGGATGCTAACAGGCGAGCTCTGCTATAGCATGTGACTAAGACGTGCAGAGAGAGTCATTCTCTGAGAAGATAGTTGACTGCATCATGACAGCTGAGCTCTCTGACTCCCGACATCTGATCGCAGTGACTTTATGGCTCAA
  5   1   2       bld FaBN 5x3                        IMAGE:8075793.5p                                                         GGTGATTGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCNAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTCTCTGAAGAAAGATAGTTTGAATGCAGTCAGTGAC
  5   1   2       bld Ga12 5g                              XL217j04.5p                                                          CACGAGGCCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTG
  5   1   2       bld Egg4 5x3               IMAGE:3743841-IMAGp.IMAGp                                                            CGTTGCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTATTTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTTTTATTCCCTCtaaaataaaaaccgaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl316m19.5p                                                               GCCGGCTGTGACAGGGTTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACAC
  5   1   2       bld DMZ  5g3  in                         xl284e12.5p                                                                GCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCAT
  5   1   2       bld DMZ  5g3  in                         xl240a18.5p                                                                GCCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAG
  5   1   2       bld Ga12 5g3  in                         XL146n15.5p                                                                 CCGGCTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATA
  5   1   2       bld Te2N 5x3                        IMAGE:7203426.5p                                                                 CCGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCAAAACTTTCTTTGATTTCCTGCAATGTTGATCTTTTTTAGGTGTCTCTaaaataaaaaaaataacccgaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Skin 5g                         IMAGE:8643682.5p                                                                  CGGCTTTGACAGGGTCTTTGCACTGAAGCGTTCCAAATGTTCTCGTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACTGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAGCATTGTGACTAAAGAGGTGTCAGAGAGAGTCATTTCTCTGNAGAAGATAGTTGACTGCATCATGACGAGCTGTAGCTCTCTGACTCTCTCGACATCTTGATCTGCATGTGATCTTTAGTGCCTAAAA
  5   1   2       bld Ooc1 5g3  in                      xlnoc001a17.5p                                                                     CTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGA
  5   1   2       bld Emb4 5x3                        IMAGE:5514565.5p                                                                     CTGTGACAGGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGACCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAGATTAATCACATGCAGCCAGTAACAGGCTGTGGCATTTCTGACTCTT
  5   1   2       bld Egg4 5g                         IMAGE:3743649.5p                                                                         GACAGGGTTTGTGCTGAACAGAGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTATGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTATGCTCATACCAGATGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTTTTCTTGATCACCAGATCGGATACAAG
  5   1   2       bld Ga12 5g3  in                         XL158m05.5p                                                                             GGGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAG
  5   1   2       bld Ga12 5g3  in                         XL220f13.5p                                                                              GGTTTGTGCTGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGNAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATAC
  3   1   2       bld Ga18      in                        xlk3e11ex.3p                                                                                      CTGNACNNNNANNAAAANNNTCNNNNCCGAANNCNTTTTNAATNNNGNNNTCAACAGGANCATGGATTATCNCTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATNNNCCTTNAATGGAGGGACNGTACNNNCTCTTGCAGGAGATGNCTTNNCTCTCGTTGCNTCTGACACAAGNCTNAGTGANGNTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATNNACAGACAAAACAGTTATTGGTTGCACTGGATTCCATNCCGACTNNCTCACACTCACAAAAATTATTGAANNCAGGCTAAAGATGTACAAACATTCAAATAACAAANCCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTNNNCNGCGAGTGCCATGTTGNAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGNGATCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTANCCAGGCTGTTNNCATCTTCTGNACTCTC
  5   1   2       bld Ga15 5g                            XL495o05ex.5p                                                                                       CTGAAGCGTTCCAAATGTTCTCGTTCCGAATCCATTTTAAATCGCGAGCTCAACAAGAGCATGGACTATCACTACACGGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTA
  5   1   2       bld Ga18      in                        xlk3e11ex.5p                                                                                        TGAACAGTGATTAAAATGTTCTCGTCCGAATCCATTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGTNTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGNGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGNGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGNTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGGANGCATACAAAGCTGGTGGCTCTNNGAGTNCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGNNTCTGAAGCTCATCAAAGATGTANTCATATCTGCTGCTGAGAGAGATGNATACACAGGCGATGCGCTGCATATAAGCNNTGTGACTAAANATGGCGTCAGAGAAGAGTCCATTTCTCTNNGGAAAGANTAANTCACATGCAGCCAGNAACCAGGCTGNT
  3   1   2       bld Ga18 5g3  in                      xlk152o15ex.3p                                                                                                     ANNAAATNNNTCGTCNGATCCATTTNAAATCGNNAGCNNANNGNGCATGGATNATCACTACACGGGGCCGGTGGANNAGCGCTTTAACCCATACACCTTTANNGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGNCTTAGTGAAGGTTATAGCATCCACAGCAGAANCACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGNTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAANCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTNNNNNGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACANNNNNNNCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGANCTCTCTCAGAAAATTCTTTGNTTT
  5   1   2       bld Ooc2                            IMAGE:3746871.5p                                                                                                        GTCCTCGGCCGAATACGTTGTAAATCCCGAGCTCAACATGAGCATGGACTATCACTACACGGGACCTGTCGAGCATCGCTTTAACCCATACACCTTTAACAGACGGACTGTGCTGGATCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTATTGAACGTTATAGCATCCACAGCGAGGACACACCGAAATGTTACAAACTAACAGACAAAACTGATATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAGATCATTGAAGCCGGGCTAAAGATGTACAAACATTCAAATAATAGAACCATGACCATTGGAGCTGTAGCTGCCATGATATCCACCATTCTCTACTCCCGCCGGTGCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCTATGAAGAAGGTAAAGGCGCAGTGTACAGCTATGATCCAGTACGCTCATACCAGGAGGATGCATACAACGCTGGTGGCTCTGCGAGTGCCATGTTGCAAGCTGTTCTTGACGACCAGATCGGATGCAAGAACATGNCACAT
  5   1   2       bld Egg1                            IMAGE:4678563.5p                                                                                                                         TTTTAAATCGTGAGCTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTATATATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGNGCTTGATGAAGAACGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGGCATGGTGCAACCTCTTCTTGACACCAGATCGGATACAAGAACTTGCAGAATGTTGAGCAGCTCCCCTCTGACATTGGAGAAAGGC
  3   1   2       bld Te2       in                    IMAGE:7207092.3p                                                                                                                                   CCGGGAATCCCGGGATATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTGTTATTCCCTTTAAAAAAAAAC
  5   1   2       bld Egg3                            IMAGE:6871432.5p                                                                                                                                     GATTCCCGGGGGAGCATGGATTATCACTACCGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTTTTATTCCCCTCTAAATaaaaaaccgaaaaaaaaaaaaaaaaaaaaaGCGGGCCGCCCACCGCCGGTTGGAAGCTCCCAGCTTTGTGGTTTCCCCTTTAGNTGGAGGGTTTAATATTTCGAGGCCTTGGGCGGGTAATCAATGGGTCCATTAGCCTTGTGTTTCCCTGGTGGTGGGAAAAC
  3   1   2       bld DMZ  5g3  in                         xl284e12.3p                                                                                                                                       CTCAACAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTT
  3   1   2       bld DMZ  5g3  in                         xl316m19.3p                                                                                                                                          ANCAGGAGCATGGATTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTTATC
  3   1   2       bld DMZ  5g3  in                         xl232c13.3p                                                                                                                                             AGGAGCATGGANTATCACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCT
  5   1   2       bld Te2       in                    IMAGE:7207092.5p                                                                                                                                                     GATTATCACTACACGGGGCCGGTGTGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATAATTCACATGCAGCCAGTAACAGGCTGTTGGCATCTCTGACTCTCTCAGAAATTTCTTGATTCTGCATGCTGATCTTTTTATCCNTCTAN
  3   1   2       bld DMZ  5g3  in                         xl240a18.3p                                                                                                                                                             ACTACACGGGGCCGGTGGAGCAGCGCTTTAACCCATACACCTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCT
  5   1   2       bld Egg6      in                    IMAGE:4435786.5p                                                                                                                                                                    TGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCATGTGATGACTTTGCTCTCGTGGCATCTGACACAATACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGATGTGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCATTTTTATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATACAACCATGACCAGCGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGCATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGCAAGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACGACCGA
  5   1   2       bld Te2N                            IMAGE:7766795.5p                                                                                                                                                                    TGGACCTGTCGAGCAGCGCTTTAACCCATACACCTTTAACGGAGGGACTGTGCTGGCTCTTGCAGGTGATGACTTTGCTCTCGTGGCATCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGGGACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCATTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCGGAACATTCTTTGATTTCTGCAATGTTGATCTTTTTTATGTGTCTCTaaaataaaaaaaataacccagaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Ga12 5g3  in                         XL146n15.3p                                                                                                                                                                               AGCAGCGCTTTAACCCATACACNTTTAATGGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTNACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTAACTCTCTCAGAAAATTCTTTATTTCTGCAATGCNNATCTTTTTATTCCCTCTAAATAAAACCGAAAAACC
  3   1   2       bld Skin 5g3  in                    IMAGE:8641942.3p                                                                                                                                                                                     GCTTAAACCCATACACCTTTATGTGAGGGACTGTACTTGCTCTTGCAGGAGATGACTTTGCTCTCGTTGCTTCGGACACAAGACTTAGTGAAGGTTATAGCATCCACAGCAGAAACACACCGAAATGTTACAAATTAACAGACAAAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTGATTTCTGCAATGCTGATCTCNTATCCCCNNANNNCCAAACCNNNNTTTT
  3   1   2       bld FaB  5g3  in                    IMAGE:8069469.3p                                                                                                                                                                                                                                                CTTTGCTCTCCGTTGCTTCTGACACAAGACTTAGTGAAGGTTATAGCATCACAGCAGAAACACACGAAATGTACAAATTAACAGACAAAACAGTTATGGTGCACTGGATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTTTTTTAGGAAAGATTAATTCACATGCAGCCAGAAACCAGGTTGTTGGCATTTTCTGAACTCTTTCAGAAAATTTTTTGATTTCTGCAATGTTGATTTTTTTTTTTCCCTCTAAAATAAAAACTGAAAAACCGAATTTCACTACAAATTTATTTTTTTTAAGGTTTTTTTTTTTTGATGATCCAATATTCTTTGTTTTTGTAACTTTTTTTAAGATTTCGTTACGGGACCTGTAACCCAAAATGCTCGGGACTTAGGGTTTTCGGATAATGGATATTTTTGTAATTTGGAATCTTCTCTATTCTTTTTTTTTTTTTTTTTATTTCTATGATATCCTTGAAGTC
  3   1   2       bld Egg1                            IMAGE:3302198.3p                                                                                                                                                                                                                                                                  ACAAGACTAAGTGAAGGTANTAGCATCCACAGCAGGAACACACCGAAATGTTACAAACTAACAGACAAAACTGTTATTGGTTGCACTGGATTCCATGCTGATTGCCTCACACTCACAGAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCAGAACATTCTTTGATTTCTGCAATGTTGATCTTTTTTATGTGTCTGTAAAATAAAAAAAATAACCAAA
  3   1   2       bld Ooc1 5g3  in                      xlnoc001a17.3p                                                                                                                                                                                                                                                                                                                 AAATGTACAAATTACAGACANAACAGTTATTGGTTGCACTGGATTCCATGCCGACTGCTCAACACTCACAANAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACANAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCCGGCCATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTTTTATTCCCTCTAAAATAAAAACCGAAAAACCGAAA
  3   1   2       bld Egg6      in                    IMAGE:4435786.3p                                                                                                                                                                                                                                                                                                                        AAACTTACAGCCAAACTTGGTATTGGTTGCACTGAATCCCATGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACAAAGGAGNGGGCTCTGAAGTTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCATTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCGGAACATTCTTTGAGTTCTACAATGTTGATCTTTTTTATGTGTCTCTAAAATAAAAA
  3   1   2       bld Ga12 5g3  in                         XL158m05.3p                                                                                                                                                                                                                                                                                                                                                           ATTCCATGCCGACTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAACAAANCCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCCTGAACTCTCCTCAGAAAATT
  5   1   2       bld Tbd7      in                         XL107j11.5p                                                                                                                                                                                                                                                                                                                                                                 GGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCAGAACATTCTTTGATTTCTGCAATGTTGATCTTTTTTATGTGTCTCTaaaataaaaaaaataaccagaaaaaaaaaa
  3   1   2       bld Tbd7      in                         XL107j11.3p                                                                                                                                                                                                                                                                                                                                                                 GGCTGATTGCCTCACACTCACAAAAATTATTGAAGCCAGGCTAAAGATGTACAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTCGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCGTTTCTCTGAGGAAAGATTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCAGAACATTCTTTGATTTCTGCAATGTNATCTTTTTTATGTGNACTCTAGAATAAAAAAAAT
  3   1   2       bld Ga12 5g3  in                         XL220f13.3p                                                                                                                                                                                                                                                                                                                                                                                  TCACAAAAATTATNGAAGCCAGGCTAAAGATGTACAAACATTCAAATANCAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTATGTTTACAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAACCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTTGAGCAGCTCCCTCTGACATTGGAGAAGGCTCTGAAGCTCATCAAAGATGTATTCATATCTGCTGCTGAGAGAGATGTATACACAGGCGATGCGCTGCATATAAGCATTGTGACTAAAGATGGCGTCAGAGAAGAGTCCATTTCTCTTAGGAAAGATTAATTCACATGCAGCCAGTAACCAGGCTGTTGGCATCTTCTGAACTCTCTCAGAAAATTCTTTGATTTCTGCAATGCTGATCTTTTTTAT
  3   1   2       bld Egg6                            IMAGE:4412676.3p                                                                                                                                                                                                                                                                                                                                                                                       AAAATTATTGAGGCCAGGCTAAAGATGTCCAAACATTCAAATAATAAAACCATGACCAGTGGAGCTATAGCTGCCATGTTATCCACCATTCTCTACTCCCGCCGGTTCTTTCCTTACTACGTATATAACATCATTGGAGGCCTTGATGAAGAAGGTAAAGGGGCAGTGTACAGCTTTGATCCAGTAGGCTCATACCAGAGGGATGCATACAAAGCTGGTGGCTCTGCGAGTGCCATGTTGCAGCCTCTTCTTGACAACCAGATCGGATACAAGAACATGCAGAATGTCGAGCAGGTCCCTCTGACACTGGAGAAGGCTCTGAAGTTCATCAAAGATGTATTCATATCTGCTGCTGAGAGGGATGTCTACACAGGCGATGCTCTGCATATAAGCATTGTGACTAAAGACGGTGTCAGAGAAGAGTCCATTTCTCTGAGGAAAGATCTAGTTTGACATGCAGTCAGTGACGAGGCTGTAGGCATCTTCTGAACTCTCTCGGAACATTCTTTGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)