Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL083d09.3.5                         62 PI      93         16      983                (no blast hit)
     2   0.0    0Xl3.1-XL417h05ex.5                          4 PI      85       1169     1467                (no blast hit)

 This cluster: approximate FL confidence score = 79%

 1012767523 Xl3.1-IMAGE:7202912.5 - 94 ESTs
                                                                       .....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7202912.5                                    CAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCACTTGTCATATTGATAATTAGATGATCATTAACGTAAGCATTACAAAATTGGTGTAGTCTGTACCATTTTTGGATATTTGTGTATAATATAGCATGTGATGTGTGTTTTTGTTTTTTGAACAGCCGGCCAGTTAATGCTACCTGCTGATTAGTTGCTATGGGTTATGAGACCAGTAACTGCCTAGACCATTTATTACATAAACCCAATAG
                                                  Xl3.1-CHK-1012685674                                          TTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCACTTGTCATATTGATAATTAGATGATCATTAACGTAAGCATTACAAAATTGGTGTAGTCTGTACCATTTTTGGATATTTGTGTATAATATAGCATGTGATGTGTGTTTTTGTTTTTTGAACAGCCGGCCAGTTAATGCTACCTGCTGATTAGTTGCTATGGGTTATGAGACCAGTAACTGCCTAGACCATTTATTACATAAACCCAATAGTGTTTG
                                                      consensus depths                                         7     7    10    12    25    31    31    36    34    40    37    44    41    48    44    48    44    48    44    48    44    48    45    49    45    49    46    50    45    50    45    49    44    49    45    49    45    49    45    49    45    49    45    49    46    49    46    49    46    49    45    49    45    49    46    49    46    49    48    49    49    52    47    52    48    52    49    52    50    52    50    52    50    52    50    52    50    52    49    51    49    50    48    49    48    49    46    48    46    48    46    49    45    48    45    49    45    50    45    49    44    51    43    51    41    49    39    47    39    47    39    50    43    54    35    47    30    44    28    44    32    47    30    45    29    44    28    42    32    42    33    43    33    43    33    40    33    38    33    38    33    36    33    36    34    36    33    36    33    36    33    35    33    35    32    33    32    33    30    31    32    34    32    33    31    33    33    34    32    34    33    34    34    34    33    34    33    34    32    34    33    34    34    35    34    35    34    35    35    35    35    35    34    36    34    36    36    36    37    37    37    37    37    37    36    37    36    37    35    36    34    36    34    37    29    36    22    35    22    35    24    35    23    35    23    34    18    30    18    27    16    25     8    16     7    11     5     8     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     3     5     3     5     3     5     3     4     2     4     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTG
                                                                   SNP                                                                                                            --A---------
                                               BLH MIN      25     143                                    
                                               BLH OVR      25      69                                    
                                               EST CLI      29      71                                    
                                               ORF LNG      25       6                                    
  5   1   2       chi Te1                             IMAGE:6928762.5p GGGAGTGCGTTGCTGGGCCGTAAGCCGGTGTTGCTCAGTCATTGTGCGGATGGCGCTTAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGAGATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGGAGAGCTACACCTTCTTTATCGACATTCCTGGCTGGATACAATAAAGGGATGGAAATTTGCCCGATTGCCTTTGgaaaaaaacctttatgggaaaaaaaTCCCAATTTTTAAATGGAAGGCCAAACCAAGGGGAAAATTTAATTTCCCTTTTACCCCACCTCCCCCAAAGAAAAAAATTGGACCAAGAAAGTTTATTGGCCCAAAAAGGA
  5   1   2       chi Tad1                            IMAGE:6936815.5p                        GGGGGTGTTGCTCAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGATAGATATATGGCCCAACTTAAATGCTACTACTTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAACCTGATTTCCCACACAAAGCTGGAGAAGGCTACCAGCCCAAAGATATTCCAAACTAAATGGTGTACCATTAAAACACCCCTGTTATCTCCTTGAAGCATATATTTTGCATGGCAGGGGAAAGCCTATTTATAAGGGTTTTTTTCCTGGGCTTTAAAGGGGGAATTATCCCCAACCTTGGAACAACCCACCACCCTTTCCCTTTACTCGAACAATTTATGGCTGGGGGATACCATATTAAGCGGCGATGCAAAATTCGCCCCGAATTTGCCCTTTGGaaaaaaagcctttattgggaaaaaaaCCCCAATCTTTTAATGTATGGCCAAACAAGAGGAATAATTAATTCCGTTTAAACACACTCCCCCAAAGGAAAAAATGGTACCACAAGATCATTGCCCAAAGAGAATCCCCTGAGGGTTTGGGGCATGCCTTCGGGGTCCCACAAN
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764318.5p                         CCGGTGTTGCTCAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCCAGAAAATGACAGAGTNATGCAAGAAGCGTGGTTGGGTGTTGGGTCCNNAACATACTACAGTTTCAGTAGCAGCAGCAGAACCGGAAGATGTCACATTCCATCCACGAGCTAGCC
  5   1   2       bld Em10 5g                         IMAGE:8318645.5p                          CGGTGTTGCTCAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCCCAGAAATGACAGAGTATGCAAAGAAGCG
  5   1   2       bld Spl  5g                         IMAGE:8460021.5p                                TGCTCAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGANAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTTATGGAAAATCCAATTTNATGAGGCAACAAGGATATTATCTTTACCACTCCNNNAGAATGACAGATATGCAAAGAGCGTGGTTGGTGNNTGGTCAACATACTACGTTCAGTAGCAGCACAGACCGGAGAGTCTCATCATCACGAGCTAGCAGCAGTCTCAGTTGCC
  5   1   2       bld DMZ  5g3  in                         xl258k20.5p                                  CTCAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAA
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580792.5p                                    CAGTCATTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATG
  5   1   2       bld Tbd5 5g                         IMAGE:3580754.5p                                     TCATNATTGTGCGGNTGGCGCTGAGTGGAGCTGAAGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAAGGATGAAATTGCCGATTGC
  5   1   2       bld Neu7 5g3  in                         XL042h11.5p                                     CAGTNTTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCA
  5   1   2       bld Neu7 5g                              XL042k13.5p                                     CAGTNTTGTGCGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073739.5p                                           CCACGCGTCCGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCA
  5   1   2       bld Ga12 5g3  in                         XL161h22.5p                                               GGGATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACTTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGC
  5   1   2       bld Emb1                            IMAGE:6632069.5p                                                   GCTGAGTGGAGCTGAAGGGCTGAGGCCGTTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCATCCTGAGCAGATGCGGGGTACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTGCACTCACAAAGCAGCAGCTATTTCTAGCTCGGGATGTTTTAGAGATGTGGCGCACAGCGTGAGTATGCTGATTGATAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAGATGCTACTACTTTGACTACTAGGAGGAACTACCGGAATCTGCTTATAGACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACACTGCTGAGTAGCTGATTTCCACTCAGAGCTGGAGAGGCTACCAGCCAAAGATATTCGAACTAATGCGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGGTTGGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGNAGCTANGCCAGCAAGTCATCNGAGTATGCCCGACAACTANNAGATGATAGTTTTAAATCTATGGTGGGGGCAAATGGGGCTACCTTACCC
  5   1   2       bld Ov1                    IMAGE:5073714-IMAGp.IMAGp                                                     CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGACGCTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCA
  5   1   2       bld Emb4      in                    IMAGE:4202360.5p                                                      CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGG
  5   1   2       bld Em10                            IMAGE:7982711.5p                                                      CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCA
  5   1   2       bld Em10                            IMAGE:8320295.5p                                                      CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCNATTTATGANNGCACAGGATATTATCTTTACACTCCCAGAAATGACAGATATGCAAGAGCGTGGTTGGTGTTGGTCNAACATACTACGTTCATAGCAGCACAGACCCGAGATGCCCATCATCACGACTAGCAGCAGTCTCATTGCGAACTGAATAATTATCAGTGGATGGCTCTCATACTTTCATCTTA
  5   1   2       bld Int2                            IMAGE:8528980.5p                                                      CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAAACAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCNAACATAACTACAGTTCAGTAGCAGCAGCAGACCCGGAGATGTCACATTCATCCACGACTAGCCAGCAGTCTCGAGATGCCGACACTAAATGATGTTATC
  5   1   2       bld Ooc3                            IMAGE:3436960.5p                                                       CTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATTAACCACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCA
  5   1   2       bld Tbd5      in                    IMAGE:3579617.5p                                                       CGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTTCTATTCCTTTTGGCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAA
  5   1   2       bld Te2N      in                    IMAGE:7202912.5p                                                       GCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGAACACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCAATCCCTTTTTTACTGGATGGATCTAATCATTTTACCTTCAACGGGG
  5   1   2       bld Te2       in                    IMAGE:7207462.5p                                                       GCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCCAGAAATGACAGAGTATGCAAGAAGCGTGTTTGGGNTGTTGGTCNNAACATACTACAGTTCAGTAGCAGCACAGACCCGAAGAGTCACATTCCATCACGACTAGCAGCAGTCTCAGTATGCGCACTGAGAGAAGTTATCAGTGGCATGCTATACAGTACTTT
  5   1   2       bld Em10                            IMAGE:7979707.5p                                                       GCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAATGACAGAGTATGCAAAGAGCGTGGTGGGTGTTGGGTCAANCATACTACAGTTCATAGCAGCACAGACCCNGAGATTCACATTCATCACGAGCTAGCAGCAGTCATCGATAGCCGCACTANAATATGTTATCAGTGGCATGCTACTCATACTTCCATCCTTACGAGATAACTATCACGGT
  5   1   2      seed Em10      in                    IMAGE:7980431.5p                                                       GCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAA
  5   1   2       bld Egg1                               PBX0134H06.5p                                                        CTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTAT
  5   1   2       bld Emb1                            IMAGE:6631666.5p                                                        TGACCTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTANAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGGTTGGGTGTTGGGGTCCAAACAATAACTACAGTTTCCGCAAGCCAGCAGCCAAACCCCGGAAGATGCCACCATTCCCTCCCACGGAGCTAACCCAAGCAAGTCATTGAGTAATGCCCCGACAACTAGAAAATGAAAGGTTTAATCCAAgggggggggCAATGGGGGCTACTTTACCAGGTTAACCCCTTTTTCCCCCATTTCCCCCTTNTTTACCTGGGAAGGAACCTAAACCAATTTTACCTTTTCCACGCGGGGGGGttttttttACAAAAAGGGGGT
  5   1   2       chi Thy       in                    IMAGE:8546631.5p                                                        CTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAACTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAGCTTATGGAATAATCCAATTTAATGATGCAACAAGGATATTATTCTGTACCACTCCAATGAAAATGACAAAGTATGCAAAGATAGGTGATTTGAGTGTAGAGTCCTTCTAATAACGAGCACTTTCTATTCCTGCAGCGTAACACTAGAGAATTATAGATTGCATCAGTAGAATCATGGCGATCATCGTATCAATATCTGCGAGTGTCTGATGGTAGA
  5   1   2       bld DMZ       in                         xl243k18.5p                                                        CTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATA
  5   1   2       bld Ga12                                 XL180f04.5p                                                         AGGGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTT
  5   1   2       bld Ga12                                 XL144e01.5p                                                           GGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACT
  5   1   2       bld Ov1                             IMAGE:5073517.5p                                                            CCACGCGTCCGGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATA
  5   1   2       bld Ga18      in                      xlk162g07ex.5p                                                             GAGTGGAGNTGAAGGNNTGAGGNNTTAGCTGCCATGTACGAGCAGCTGNNNNNNAATGNCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGNTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGNTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCNGAAGNNGTCACCATTNCATCCACGGAGCTAGCCAAGNAAGNCATCGAGNNTNCCCGA
  5   1   2       bld DMZ       in                         xl297n18.5p                                                             TGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCA
  5   1   2       bld DMZ       in                         xl297n14.5p                                                             TGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAG
  5   1   2       bld Ga12      in                         XL193k08.5p                                                               ACGAGGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATACAATTTAATGAG
  5   1   2       bld Ov1       in                    IMAGE:8327867.5p                                                                        GGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCNAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAG
  5   1   2       bld Tbd7      in                         XL080i21.5p                                                                             AGGCAATTAGCTGCCATGTNCGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAA
  5   1   2       bld DMZ       in                         xl303a17.5p                                                                             AGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGGTGTTGGGTCCAAACAATAACTACNGTTTCAGTAGCCAGCAGCAGAACCCGGAAG
  5   1   2       bld Ga12      in                         XL180p21.5p                                                                                  TTAGCTGCCATGTACGAGCAGCTGNAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACGATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAA
  5   1   2       bld Ga12      in                         XL192k08.5p                                                                                   TTANCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATACAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGA
  5   1   2       bld Ga12                                 XL175p02.5p                                                                                      GCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACACTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACT
  5   1   2       bld Ga12      in                         XL142k04.5p                                                                                          GCCTGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTT
  5   1   2       bld Tbd5                            IMAGE:3580257.5p                                                                                              GTGCGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTAAAC
  5   1   2       bld Ga12      in                         XL192e21.5p                                                                                              GTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAA
  5   1   2       bld Te2N      in                    IMAGE:7765479.5p                                                                                                  GAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGTGAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTTCCCAGAAAATGATCAAGTATGCAATATCCTGGTTGGGTGTGGGTCTATCATTACTATTTTTTGAATTTTCTCAAATTTGAAGAATCTCTTCCTTCCGGACTAATTCTTTTCCTTTAGCCTACATATGATATTTATTATTGTCATGTattctctcttttctttctttttaaccttattttttatttcactaaattttaatcatctcttaaacttcttcttttctcttcttgtttcttcATTTGTTC
  5   1   2       bld Ga12      in                         XL170h04.5p                                                                                                      AGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTAT
  5   1   2       bld Egg1                               PBX0148E04.5p                                                                                                         CACGAGGCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGG
  5   1   2       bld Ga12      in                         XL153b17.5p                                                                                                            AAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGNTAAACTCACAAAGCANCAACTAATTNTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGNCACAAAACAGAGNAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTT
  5   1   2       bld Neu7                                 XL030h06.5p                                                                                                                                                                   GAAGCTGAAGCTGGCTCTTTNGGAGCAGAACTTTTTGCCTACCACTGATGNTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGNGCACAGG
  3   1   2       chi Te2N      in                    IMAGE:7765479.3p                                                                                                                                                                                              GAGAAAGTGAAAAAAAAGTAAAAAAATAGTAATTGATAGGACGGTTGAAAAAAATATTCATCCTTAATATAACTATAAATGGCAAGGATTAATAGTTTACTCAAAATTGAGAAAAAAGAAAGATTTTTGAAAAATTAACCACGTCAGTTGTTTGATAACTCATTGGTGAATACCGGAAGGATTATAAACACCAAAGCTGGGATTCAACCTCCTTTCCCTTTTTTCTCAAAACAGAGTAGTTGATTTCCCCACAGAGCTGGAGAGGCTAACAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTTTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGGTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTTTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAAACGGTGGTTTTTACAAAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Ga15                               XL476j23ex.5p                                                                                                                                                                                                                                                                AGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGATATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073739.3p                                                                                                                                                                                                                                                                                                                                                                                               CTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGAAAAAAAAAAAAAAAAG
  5   1   2       bld Tbd7      in                         XL103f18.5p                                                                                                                                                                                                                                                                                                                                                                                                 NCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAAC
  5   1   2       chi Ga12      in                         XL189m24.5p                                                                                                                                                                                                                                                                                                                                                                                                         AAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAGCCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAAC
  5   1   2       bld Ga15      in                       XL430l03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                         TCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGA
  3   1   2       bld Te2N      in                    IMAGE:7202912.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTGAGAGAGTACAGTTCTGTAAGATTCCAGTAGAGTCCTTCTATCGCATTGTGATCATAGGATGAATGCGATGCATGAAAGCTATGAAAATCAATTATGAGGCACAAGGATATATTCTTACCACTCCCAAGAAATGACAGAGTATGCAAAAAGCGTGGTGGGTGTTGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTTAGCGGCCCAAGTAGCGCTTAACTCTTATGGCCTGTACACAGACAGCGAATCAGTGCCCTACCGTAACGGATGGCATTCATTTGCAGTCTGGTCTAGGCCTCACTGTAACAAACGC
  3   1   2       bld Ga18      in                      xlk162g07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGCNGNANNCAANAAGGGATGAAATTGCNGATTGCATTGAAAAAGCNTATGGAAAAATCCANTTTAATGAGGCAANANGGATATTATTCTTTNCCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTANNCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTNCCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATA
  3   1   2       bld Thy       in                    IMAGE:8546631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGAGTACCTTCTTTGACTTTGTGGTACATAGGATGAATTGCGTTGCTTGAAAAGTTATGAAATCCCATTAATGAGCAACAGGATATATCTTTACATCCCAAGAAAAGACAGATATGCAAAGAAGCGTGGTGGTGTTGGGTCCAACCATTACTACAGTTTCAGTAGCCAGCAGCAGACCCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTTAAAGAAACACAGTTTTCTTTCACAGTTGCGCCCTAGACACAGACTCCAAATGAATGCCATCCGCTACCTCGCGTAAGCGACACAAAGCATTCATTCGCAGTCTGGTCTGGCCTCAACTTAACAAACTT
  3   1   2       bld DMZ  5g3  in                         xl258k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCATTGAAAAGCNTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGAACTG
  5  -1   2       bld Sp1                             IMAGE:5506697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGCATGAAAAAGCTATGGAAAATCCATTTATGAGGGCACAANGGATATATTTCTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATAtttttttttattttatttttttaAAGAAACCCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACGAAACAATGTTATACCCCAACGTAACAAACTCCNN
  3   1   2       bld Te2       in                    IMAGE:7207462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGACCCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATTTTTTTTTTTATTTTATTTTTTTAGCGGCCCCAGTAGCGCTTAACACTTGATGGCCTGGACACAGACAGCAAACAGATACCACTACGGTAACGGATGGCACTCATTCGCAGTCTGTGTCTAGGCCTCAACCTGTAAACAAAAA
  3   1   2       bld Ga12      in                         XL180p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAAT
  3   1   2       bld Ga12 5g3  in                         XL161h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld Ga12      in                         XL170h04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGTTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAAT
  3   1   2       bld Ga12                                 XL195b06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATA
  3   1   2       bld DMZ       in                         xl243k18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACNGCAAATGAATGCCATCCG
  3   1   2       bld DMZ       in                         xl297n18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTAT
  3   1   2       bld DMZ       in                         xl297n14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAAC
  3   1   2       bld Ga12      in                         XL192e21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld Ga12      in                         XL193k08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld DMZ       in                         xl303a17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAGAAAATGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCCGTTA
  3   1   2       bld Em10      in                    IMAGE:7980431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACAGAGTATGCAAAGAAGCGTGGTTGGGTGTTGGGTCCCAAACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATTTTTTTTTTTATTTTATTTTTTTAACGACCCCAGTTGCGCTTAACACTTGAGGCCTAGACACAGACAGCAAACAATGCCATCCGTTACGGATGGCATTCATTGCAGTCTGTGTCTAGGCCTCAACTGTAACAAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCAAAAAAAAAA
  3   1   2       bld Ga12      in                         XL192k08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld Tbd7      in                         XL103f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTNTGTTTANCAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATGCCGCTACCTTGTGTAACTGAAACAATGTATATA
  3   1   2       bld Ga12      in                         XL142k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTACAGTTTCAGTAGCCAGCAGCAGAACCCGGAAGATGTCACCATTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAANCCAGTTTTGCGTAACAGTTNAGGCGTAGACACAGACTGCAAATGAATGCCATCCG
  3   1   2       bld Ov1       in                    IMAGE:8327867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCAGCAGCAGAACCCGGAAGATGTCACCATCTCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCTTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd7      in                         XL080i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTTTTAAAGAANCCAGGTNNGTTTAACAGTTGAGGCCTAGACACAGGCNGCAAATGAATGCCANCCGTTACCNTGTGT
  3   1   2       bld Neu7                                 XL047a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCATCCACGGAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACNATATATATTTTTTTTTATTTTTTTANCGGAACCAGTTG
  3   1   2       bld Neu7 5g3  in                         XL042h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTTTTA
  3   1   2       bld Ga12      in                         XL189m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTAGCCAAGCAAGTCATCGAGTATGCCCGACAACTAGAGATGATAGTTTAATCTATGTGGGGCAATGGGCTACTTACCAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3580792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTTACCCTTTTCCCATTCCCTTTTTACTGTATGATCTATACATTTACTTCAACGGTGGTTTTTACAAAGTGGTCTGGGCTGATTTTCTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCAAAAAAAAAAAAAA
  3   1   2       bld Ga12                                 XL167a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGTGGTNTTTACAAAGTGGTNTGGGCTGATTTTNTTTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTNTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAA
  3   1   2       bld DMZ                                 rxl246k18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTTGTACAACAATCCATTGTTTGCTTCATCACATTTCNGACGGATTTCCAACCCCTTATTTTTNNGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTNTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACNTGGAGTGTTGCCGTNTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATNGTCACTGTGAGGCAGGGTNTTATATTTGTCCTCAGCCAGAGCTGTAACTNATATATATTTTNTTTTATTNNATTTTTNTAAAGAAACCAGTNTTGTNTAACCAGNNGAGGCCTAGACACAGACTGCAAATGAA
  3   1   2       bld Tbd5      in                    IMAGE:3579617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTACAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGNGTTTTATATTTGTCCTCAGCCAGAAGCTGTAACTATATATATATTTTTTGTTTATTTGTATTTTGTTTTAAAGAAACCAATTTNTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCAAAAAAAA
  3   1   2       bld Unk4                                AGL_19D07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACAATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACGGGGGGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTCCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCTGCACTTGTCATATTGATAATTAGATGATCATTAACGTAAGCATTACAAAATTGGTGTAGTCTGTACCATTTTTGGATATTTGTGTATAATATAGCATGTGATGTGTGTTTTTGTTTTTTGAACAGCCGGCCAGTTAATGCTACCTGCTGATTAGTTGCTATGGGTTATGAGACCAGTAACTGCCTAGACCATTTATTACATAAACCCAATAGTGTTTGATTC
  3   1   2       bld Emb4      in                    IMAGE:4202360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCCATTGTTTGCTTCATCACATTTCTGACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCCTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCACTTGTA
  3   1   2       bld Ga12                                 XL186l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGGATTTCCAACCCCTTATTTTTTTGTATGACCTAGAATGCCAAGGGGAAATTTTTCCTGTTTTATACAAGTGATGCGTTGGCNTGGAGAAGGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGATGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCACTTGTCNNCCCAATCTAGGGAAGAGAAAAGCCAATTCAACTGAACTTGCTTTATTTATTNTTTTNTCATCCAAGTAGCTTTCACAATTTGACTTATCACCATAGATATACAATGACCTGAATGAAAGAGAACCTTCTAATGCACTATAATCTGCCTTTCAGTTATCCTTNTCAGTT
  5   1   2       bld Gas8      in                    IMAGE:3517732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTCTCCAGGCCAACGCATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATAtttttttttatttttttAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATG
  3   1   2       bld Gas8      in                    IMAGE:3517732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCAAGTTTAATGGACTTCACACACAGATATATCTCTACACTGGTGGTGACATCACGGCGCTAGTAGTACACCTGGAGTGTTGCCGTTTTATGTGTCATACTTGTCACGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATATTTTTTTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAAAAAAAAAAAAAAAA
  3   1   2       bld Ga12      in                         XL153b17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGNACACCTGGAGTGTCCCCNTTNTATGTGTCATACTTGTCACGGCCCTCCCTANTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGA
  5   1   2       bld Emb4                            IMAGE:5572419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGACGCGTGGGCGGCCCTCCCTACTGGATGGTGGCATTGTCACTGTGAGGCAGGGTTTTATATTTGTCCTCAGCCAGAGCTGTAACTTATATATAtttttttttattttatttttttACAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTACTTTGGCCGCACTTGTCATATTGATAATTAGATGATCATTTACGTAAGCATTACACAATTGGTGTAGTCTGTACCCTTTTTGGATATCTGCGCATAATATAGCATGTGCGATGTGTGTCTTTGTTTTTTGAACAGCCCGGCCAGTTAATGCTACCTGCTGATTAGTTGCTATGGGTTATGAAGACCCGTACCTGCCTAAAACATTTATTACCTAAACCCCCAAGTGTTTGATTCATCGGCTGGTGTCTGATATCACCCATTTTGATCCCCTATGGAAAAGCTAATGACTTGATTCGGGAACCCCTCCACAGAGCCCGTGGATCGCAATTTCCACTTTGACGGTTGGCCTGAACTCTGTTGGGGGCTCCTGCCCTCCCTAGCTTGGACCCCACTGCGGGCGTTGAACGGGGGGCGTTTTTTTCCTCTTATCACAGTCGAGCTTTTTGCTGGCAGCTCTTAATAGGGCCAGATCGGCGGGGGTGGGAACTTGCAGCTTTCATGAACTGGTGCCGAGTGTTTCAACTTCCCCCCGCAGTGGCTCCGCGCGGGATGAGCCGCGCTATTGTACACCCCCTCCCTCCCGACAAGGCGCATGTTGAAGAATTTATAAGCGCACCGCGGCGCGCCTCATGCGCAccccccccTCTTTTCCGCCGCGTCATCCCTCGGGCCATCATTTTACTTTTTCGCCAGCTGGTGGTAACGATCAGTAACCGAGATGCCGTGTAATATAGTCGGGCACGCTTG
  3   1   2       bld Ga15      in                       XL430l03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ANANATATTTTTTTTTTTTATTTTATTTTTTTAAAGAAACCAGTTTTGTTTAACAGTTGAGGCCTAGACACAGACTGCAAATGAATGCCATCCGTTACCTTGTGTAACTGAAACAATGTATATATACAGACAATAAGAATAAAGCGCTAATTTGGCCGCACTTGTCATATTGATAATTAGATGATCATTAACGTAAGCATTACAAAATTGGTGTAGTCTGTACCATTTTTGGATATTTGTGTATAATATAGCATGTGATGTGTGTTTTTGTTTTTTGAACAGCCGGCCAGTTAATGCTACCTGCTGATTAGTTGCTATGGGTTATGAGACCAGTAACTGCCTAGACCGATTTATTAC
  5   1   2       bld Ga12                                 XL143m12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAATGCTACCTGCTGATTAGTTGCTATGGGTTATGAGACCAGTAACTGCCTAGACCATTTATTACATAAACCCAATAGTGTTTGATTCATCTGCTGCTGTCTGATATTAATCATTTGATTTCGTTGGAAATGCTCATCAATTGATCGGGAACCATCCACAGAGCCATGTATCACAATTCAACTTGAGGTTGGCTGTAGTTGTTAGGGATCTGCCCACTAGCTTGAGCCAATGTGGTTTAAACGGGCCATTTTTCTTTAGCAGAGCAGTTTTGTTGCAGCACAATATGTCCATCATTGAACTGGATAGAGTTGATGATGAACAATTTTCTCTTCTGCAAGTGTTCTTTGAAATACAGGTATGGGACTGTTATGCAGAATGCTTGGGACCTGGACTTTTCTGGATATGGGATCTTTCAGTAATTTGGATCATCATACCTTAAGTCTGCTaaaaaaaaTAATTTAACCATTAGATAAGCCAAATAGGATTGTTTGGCCCCCAAAATGGATTTGTGCATCTAAGTAAGGATCAAGTAAAAGGTGCTCTTTTGTTATTACAAAGAAAAAGCAAATACATGTAAACAATTTTAATTACTTGATTACAATAGAGTCTATGGGAGCTGCCCATCCCATAATTCAGAGCTTTCTGGATAACAGATCCCATACCTGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)