Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8330152.5                      27 PI      91         80      959                (no blast hit)

 This cluster: approximate FL confidence score = 77%

 1012767529 Xl3.1-IMAGE:6867368.5 - 104 ESTs
                                                                       -60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6867368.5                                                             ACTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAACAGAAGAAAAAAATCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGC
                                                  Xl3.1-CHK-1012685577                                                                   TGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAACAGAAGAAAAAAATCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGCAACTTT
                                                      consensus depths                                                                  4     5     4     5     4     6     5     7     6     9    11    18    19    25    28    32    31    36    34    41    34    41    36    42    36    42    36    47    37    49    38    50    38    50    47    51    48    51    49    52    48    51    48    51    49    51    49    51    49    51    49    51    49    51    50    51    50    51    51    51    49    51    51    51    51    52    51    51    51    51    51    52    50    52    50    51    50    51    50    51    49    51    49    51    49    51    49    51    50    51    49    50    48    51    48    51    50    51    49    53    49    53    50    53    48    52    47    53    46    53    47    54    50    59    50    59    49    61    48    59    44    58    44    58    43    57    45    56    35    51    35    52    34    51    35    53    34    54    33    53    34    52    33    52    34    53    31    53    36    55    32    53    31    53    32    55    32    52    36    51    36    50    35    48    33    46    36    45    38    44    38    44    39    46    43    49    42    47    42    47    45    48    43    49    38    49    43    48    45    47    46    47    46    47    46    47    46    47    46    47    46    47    45    46    45    46    44    45    44    45    44    45    44    45    44    45    39    42    39    42    37    41    39    42    39    42    38    42    39    42    39    42    39    42    39    42    36    42    37    41    24    32    22    27    19    20    15    15    10    11     9     9     7     9     8     9     8     9     7     9     7     9     7     9     7     9     5     9     5     9     5     9     5     7     4     6
                                                                   VAR                                                                                                                                                                         TGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAG
                                                                   VAR                                                                                                                                                                                                                         GGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGGAATTGCCCACACCTGCCCATGAAATAGCCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATTACTTTTGAGCCCCTGAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATTTTTATGCAATCTTTTTGTGCAGCCCACGTTCATGCAGTTCGACTGCATCTGAGTTGTTTAATTTCAAATTCATTGCGGTAATGGACAGGACCAAAATTAGAAAAAGTTGTCTCTGTCCAAATATTTATGGGCCTAACTGTACATACTGGACTGGACAGTGACTGTAAATGTATTTGTTATTCATTTATTATTACAGGTAT
                                                                   SNP                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                         AC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                               BLH ATG      82     118                                                             
                                               BLH MIN      58      96                                                             
                                               BLH MPR      55      96                                                             
                                               BLH OVR      82      35                                                             
                                               EST CLI      52      17                                                             
                                               ORF LNG      82       2                                                             
  5   1   2       bld Emb4 5g                IMAGE:5572325-IMAGp.IMAGp GGTTTCCCCGGGAAATTCCCCGGGATATCCGTCGACCCACCGCGTCCGAGCGGCTTCTAAACTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATC
  5   1   2       bld Ov1  5g                IMAGE:6318077-IMAGp.IMAGp                                                 AGCGGCTTCTAAACTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAgaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGA
  5   1   2       bld Ov1  5g                         IMAGE:6318077.5p                                                  GCGGCTTCTAAACTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGGATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGGAGGCATGGTGAGAAGCTGGATCAAGCACATCCCCTTTCTCTCTGGATGGCCCCCACCATTTTCTACTGGACCACCCTATGATTTCCACCCCCCTCAACCAATGAGCCCCCCGATGCCTTGTTGAAGATGGACCAGGGCATTGGGGCCAATATGTTGGATCTCCCTGGGAACATGAGACCGGATTATCACCCCTTGGCTTACTACCCTGGGGACCTAAAACCAAGGGGCGGAAAGGGGAAATCTTTTCCATTTTGGAAAAAAccccccctctcccccACAAAGTTTACACTCTCCCCGGGGGGA
  5   1   2       bld Egg3 5g3  in                    IMAGE:3377569.5p                                                          TAAACTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGATTAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTTAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATTGTTGTTTATAGCCGATAT
  5   1   2       bld Int2 5x3                        IMAGE:8825272.5p                                                           TTAAAAGCACTACAAACTACAGATTGTACTCAGTATTCGTCCCATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAACAGAAGaaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTGTGAGATGACGAGCATGGGGCAGTATGTTGATCTTCTGTTACATGAGGAATTCACACTGCTACTACCTGGACTAGCAGGCGATGGATCTCATGGAACCACCTCACTGAAGTTAACCTCAGGAGTAGGAATCCGGGGGATTC
  5   1   2       bld Lu1  5g                         IMAGE:4632686.5p                                                                               CACGCGTCCGCGGACGCGTGGGCCAATTGGCGTATGCGTGTAGTAGTCCGAAAGTAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTTTTTCGGGACAGAGTGATGACTCTGATATGTGGGATGACACGGTTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaaGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGTATATGGGAAAANAACTCAGCTACCATTT
  5   1   2       bld Kid                             IMAGE:4032873.5p                                                                                             GTGGAGTGCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGGAGAAGCTGGATCAAGCACATCCCTTTTCTCTCTGGATGGCCCCCACCATTTTCTACCTGGACCACCCTATGAATTCCACCCCCCTCCAACAATGAAGCCCCCAATGCTTGTGGAAGAAGGACGAAGGCATTGTGGGCAAGTATGGTGGATCCTCCGGGGAACATGAGCCGGGATTATCCCCCTGGGTTTACTAACCTGGGG
  5   1   2       bld Te2N 5x3                        IMAGE:7204574.5p                                                                                                      GTCCCCGGGAATTGNCCCGGGATCCGAAAAGTAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaaTAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCTGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAGGGGCGAATGGAATCTTCCANTTGGAAANCAACNTCACAGAAAGTACATCCAGGGAGGTAGGTATCGGGTGGTTAACATGGAAGCTCCCACACTGGGGCGCTGGTAAGGGCCACA
  5   1   2       bld DMZ  5g3  in                         xl274h17.5p                                                                                                             GTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACC
  5   1   2       bld Egg3 5x3                        IMAGE:6325200.5p                                                                                                              GATTCCCGGGGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGATTAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTNTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTTGGGCAGTATGTTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACACCTCACCCAGAGTAACATCCAGGAGTTAAGGTATCC
  5   1   2       bld Em10                            IMAGE:8318590.5p                                                                                                              CGGATTCCCGGGATGTCCGANAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGATCATTCAACAGATGAGAGTGATAGATCTTCAAGATCGCATCAGAGTCAAGATCCTCAAATCCGGGAGACGCCTAATTCCTCACAGTGGAATGGCCAGTCCCTCCTGTTCCCTCTCCATTTTTGCCTGGTTTTGGAAGGCATGGTGAGAAGTTGGATCAACTAATCCTCTTTTCTCTGGAGGGCCCCACTTTTCTACTTGACCACTTTG
  5   1   2       bld Egg3 5x3                        IMAGE:6867368.5p                                                                                                                AATTCCCCGGGAGTCCGAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGGAAAACACCCTCACAGAAGTAACATCCAGGAGTAGGTATCCGGGTGTTTACATGGAAGCTCCACAC
  5   1   2       bld Egg3 5g                         IMAGE:6327274.5p                                                                                                                 CGATTCCCGGGGTCCGAAAGCAGTGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAgaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGATTAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTANAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACAGAAGTAACATCCAGGAGTAGGTATCGGGGTGTTTACATGGGAGCTCCACACTTGTGCGCC
  5   1   2       bld Ga15 5g3  in                       XL435a23ex.5p                                                                                                                 CGTGTAGTAGTCCGAAAAGCAGCGCTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAgaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGATTAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACC
  5   1   2       bld DMZ                                  xl309b11.5p                                                                                                                 GGCAGTGTAGCGGCTTCTAAACTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAgaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATNCCAC
  5   1   2       bld DMZ  5g3  in                         xl278o16.5p                                                                                                                 GCGTGTAGTAGTCCGAAAAGTAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAgaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCTGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCAC
  5   1   2       chi Eye1                            IMAGE:6947431.5p                                                                                                                     GTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAAcagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCCTACCTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCCTTTTCCAGATACTTTCTGAAGCGGAAAAGTGCCAAAGGGGCCCCAGACGCAGGGAGATACAATGGAGGATGCAGCATTTCAACCAAATGGAAAGGTGTATTAGATTTTTTCAAAGAATCCCCACTCAAAAGCCAAAAGAATCCCTTCCGAAAACCCAGGGAAAAACGGCCCAAAAATGTCCTTCCACAAGTTAGGGATAAATGGGGGCCTGGGGTATCCCCCTTTCGCTTGGTTTTTCCACCCCCTCTAGCATATTTTTTATGGCCCCTCGGAGGCTTTTTCTGGGCACAAAAGAGGCAATTTGTGGAATGTCTAAGAATTAGGCTCTTGGGAGAATCTCTGAGAAGACACGCTCCACATATCTACCGCCGCAGTTGTTTCCCTCGCCCTCTCTCTTTGTGGGACAATGAGAGGGCTCTCTCCGCCCCCGCCTACACCCGAGATCTGTATTTGCTGNACATACAGCGTGTCAGGGTGACATACCACAAGCCTACTCGATAAAGTGTAACATATACTCGCTAAATACTATCCAAGTCCGCTTGTGACTCGTATTCGCGAGAAATAGGGAGATGATCGCCCGACCCACACCGATTTTAGTNCCACGTATGTGTGAGCCGATAATACACGAATCTTAGAACGGGANAAGTCACCGCACCTCCTTGGGTGCGAGGGACCACGAAAGAGGTCATGGTTATGTGGGTATTACTACCTCCGCTCGCGGCGCGGTTTCCACCCCCGTGTGCGATACATACCTCGGGGTTATGACTCTAATCGGTACCAATANAGGAGGGGGGCGATTATGTACCATATCCACCCACCGGATGTGGAGAGAGCACACCTACCTGCAAATATATCGCGTACGTATGGCGACCCGCCAAACAAGTCAGGGAGGAGCGACCGTCCTACTCTACTCCTCTCACTCTTTATGGAGGAATCGAAACATG
  5   1   2       bld Emb4                            IMAGE:5542088.5p                                                                                                                        GTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGGAAAGATCCCTCAGAACCGGGAGACGCCAAAGTCCTCCCAGTGGAATGGGTAGCTCTCCTCCTGTTCCCCCTCCCATCTATGCCTGGCCTTCTGGAAGGCATGGCGGATAAGCTCGGATCAAGCACATTCCCCTTTCTCTCTTGGGATGGGCCCCACCCATTTCTAACCTGGGACCACCTTATGATTCCCCCCTCCCTCCCACAATGGAGCCCCCGAATGCTTTTGAAGGATGACCAGGGCATTTGGGCAGGTATGCTAATTCCCCTGGGACCCCGAGGCGGTCATCACCACTGGGCGTCCCAACCGGGGGAATCTAATCCAAGGGGCGGACAGGGAACTCTTCCCCCGCGGGAAAACCCCCGTCTCTCCAAGAAGGGCACATTTCCCCGGAAGACAATCCCTCCGTCGCTGGGGAAATTTG
  5   1   2       bld Egg1                               PBX0125A06.5p                                                                                                                          AGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGC
  5   1   2       bld Egg3 5x3  out                   IMAGE:3377793.5p                                                                                                                          CCGGGCCCGGGGAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATA
  5   1   2       bld Ooc3                            IMAGE:3473020.5p                                                                                                                          AGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTNCAGATCGCATCAAAGCAAAGATCCTCAGAACCGGNAGACGCCA
  5   1   2       bld Emb1 5g                         IMAGE:6633405.5p                                                                                                                           GTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGACCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGNGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGNGACTAAAGCAAAGGGCGAAATGGAATCCTTCCATTTGGAAAAACCCCCTCACCCAGAAAGTAACCATCCAGGGAGGTAGGTTAA
  5   1   2       bld DMZ  5g3  in                         xl239j04.5p                                                                                                                              CGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCC
  5   1   2       bld Ga15                               XL418b24ex.5p                                                                                                                                    TCCGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaaTAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCCAGTATGCTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328469.5p                                                                                                                                    GCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGAATGGCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCACCAATGAGCCCCGATG
  5   1   2       bld Ga12      in                         XL197j13.5p                                                                                                                                      CTCGATGGTAAATGACAGAAAACGGAAGCCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGCAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATG
  5   1   2       bld DMZ  5g3  in                         xl318m16.5p                                                                                                                                         GTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCC
  5   1   2      seed DMZ  5g3  in                         xl317k20.5p                                                                                                                                         GTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAA
  5   1   2       bld DMZ  5g3  in                         xl317m16.5p                                                                                                                                         GTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACC
  5   1   2       bld DMZ  5g3  in                         xl253p21.5p                                                                                                                                           GTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCAC
  5   1   2       bld Ga15      in                       XL518j12ex.5p                                                                                                                                            TCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGCTGATCTCCTG
  5   1   2       bld Tbd7                                 XL073h22.5p                                                                                                                                                 TGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGATTAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCT
  5   1   2       bld DMZ       in                         xl230g04.5p                                                                                                                                                  GCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAA
  5   1   2       bld Egg1                               PBX0046D12.5p                                                                                                                                                      GTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAA
  5   1   2       bld Emb4                            IMAGE:5570459.5p                                                                                                                                                      GGACGCGTGGGGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAACAGaaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGGCTTTGGAAGGGCATGGGTGAGAAGCTGGATCAAGCACATCCCTTTTCTCTCTGGATGGccccccccATTTCTACCTGGAACCCCTATGATTCCAACCCCCTTCCACCATGAACCCCCGAATGCTTTGTGAAGAATGACCAAGGCATTGGGCCAAGAAAGCCTGAATCTCCCTGGGAACATGAAACGGAATATCCACACTGGGCTTAACTACCCGGGGGACTTAAAACCAAG
  5   1   2       bld Egg3                            IMAGE:6323253.5p                                                                                                                                                       TTTGGAGGATCGCGGGGAAGTGCTTTTCAGACGTGGAGCGCGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCAGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCCTCCTGTTCCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGGGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGccccccaccatttcctacctggaaccccctaatgattccacccccctccaccaATGAAGCCCCGAATGCTTTGTGAAAGAATGACCACGCATTTGGGGCAGTAATGTTTGATCCTCCTTGGTACCTTGAGCCGGATATTCACCACTTGGCTACCTACCCTGGGGGACCTAAAAGCAAGGGGGCCGAAATGGGAATATCTTTTCCATTTGGGAGAAAACCAACCCCTCCACCCAGAGAAGGTTATAACCCTCCCACGGGAAGTACAGGTAATCCCGGGGTGGTTTTTACCAATGGGAGAACGTTTCCACCCACTTTGGTGGGCGGCCTGGTTTTAAAAG
  5   1   2       bld Oo1                             IMAGE:6643222.5p                                                                                                                                                              GACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCTGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGNGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGGAAAACACCTCACCAGAAGTAACATCCAAGAAGTAAGGGTATCGGGGTGGTTTACATGGAAGNCTCCACACTTTGTGCGCTGT
  5   1   2       bld Em10                            IMAGE:8317425.5p                                                                                                                                                                CGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGAGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTA
  5   1   2       bld DMZ       in                         xl295a10.5p                                                                                                                                                                CGGTGGGGAANTGCTTTTCANACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACNCGGCTCTAATTANNGCATATGATAAAGCAGTGTCTTCTTTTAAGANAGCTCTGAANAATGAGGATTGTACAATTGGTGC
  5   1   2       bld Ga15      in                       XL414i14ex.5p                                                                                                                                                                  CCTTGAGTGTCCAATTGGCGTATGCGTGTAGTAGTCCGAAAAGTAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTgcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaATAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGCTGATCTCCTGGTACATGAGCNGGATATCACACTGGCTACTAC
  5   1   2       chi Oo1                             IMAGE:6643905.5p                                                                                                                                                                    GGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGTGATGACTCTGATATCTGGGATGACACGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaaTAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCTGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGCTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAGGGGCGAATGGAATCTTCCATTTGAAAAACCACCTCACCCAGAAGTAACATCCCAGGAGTAGGGGGCTcaaaagtaaattggaataaattaaaaaaactgaaaaataaaatGGTTAATTTTCTAATAACTN
  5   1   2       bld Egg3                            IMAGE:6323365.5p                                                                                                                                                                                                GGGAGTCCGAANAGAGCGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGNGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGGAAAGTAACTGTCACCATCTAAGCATGTGTT
  5   1   2       bld Tad1                            IMAGE:6939874.5p                                                                                                                                                                                                              GGGTGTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaaGCAGGAAGAAGTGTAATGCTGCTCCGCTTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTTCCTGGACCACCTATGATTCCACCCCCTCCCCCAATGAGCCCCGATGCTTTGTGAAATATGACAAGGCATTTGGGCAGGAATGCTGAATCTCCCTGGGTCAATGGAGCCGGAGTATTCACACCTGGGCCTACCTACCCTGGGGGAACTTAAGACACAGGGGCCCAAATTGGGAAAATCTTTCCACTTTGGGAAAAAT
  5   1   2       bld Egg6      in                    IMAGE:4435315.5p                                                                                                                                                                                                                TGATATCTGGGATGACACGGCTCTAATTTGAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACTATTGGTGCagaaacagaagtaaaaaatcccaggaccaaaaggaaaaataataagaagaatataagcaggaagAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCGGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAATAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCTTAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATATATCTTCAAGATCGCATCATAGCAAAGATCCTCAGAACCGGGAGACGCCAAATTCCTCACAGGGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTCTCTCTCTGGATGGGCCCCATCATTTCTAGCTGGACCACCTATGATT
  5   1   2       bld Ga12      in                         XL144p24.5p                                                                                                                                                                                                                 GGGCTGCAGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAgaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATG
  5   1   2       bld FaBN      in                    IMAGE:8075760.5p                                                                                                                                                                                                                   GTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAAcagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCATGAGCCCCGATGCTTGTGAGATGACGAGGCATGGGCAGTATGCTGATCTCTGGTACTGAGGGATATCACACTGCTACTACTGGGATAAGCAGGGCGATGGNATCTCATNNGAACACTC
  5   1   2       bld DMZ       in                         xl252d14.5p                                                                                                                                                                                                                   GTCTATGGCAGGTTTGGAGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGCAGAAAcagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGG
  5   1   2       bld Egg3                            IMAGE:6325238.5p                                                                                                                                                                                                                           GATTCCCGGGGGACGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaagTGTAATGCTGCGCCGCTGAAAAAGTGGAGATTAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCNCCTCCCACAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGNNGACTAAGCAGGGCGAATGGAATCTTCCATTGGAAAAACACCCTCACANAAAGTACATCCNAAGAGTAGTATCGGGTGGTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACCCATGAAAATTCAGCTTTCTGGACATCTGAAAACATTTCTGGAAAGTACCTTGTCCCATCCTAAGCATTGGGGGTAATAGCTTTATATGGATTTTAGACTGGTTTCCAAA
  5   1   2       bld Em10                            IMAGE:8321808.5p                                                                                                                                                                                                                                 CGGCTCTAATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTTCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAATATG
  5   1   2       bld Int2                            IMAGE:8822751.5p                                                                                                                                                                                                                                        CGGTGGGGAAGTGCTTTTCAGACGTGGAGCGGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaaTAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGCTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGTAAACCACCTCACAGAAGTAACATCCAGGAGTAGTATTCGGGTGTTTAACATGGAAGCTCCCACACTTGTTGCGGCTGGTTAAAGGCCGCACCA
  5   1   2       bld Emb1                            IMAGE:6865881.5p                                                                                                                                                                                                                                                                      GGGACAGAGAGCTCTGAAGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaaTAGAAGCAGGAAGAAGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCAGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTTACATCCAGGAGTAGGGTATCGGGTGGTTTACTGGGAAGCCTCCACACTTTGTGCGGCTGTTAAAGGGCCACCCAATGGAAAAATTCGCTTCCTGGGAAATTCTGAAAACCATTCCTGAAAGTAACTGGTCCCCCA
  5   1   2       bld Bone                            IMAGE:8741420.5p                                                                                                                                                                                                                                                                                       AGAATGAGGATTGTACAATTGGTGcagaaacagaagaaaaaaatcccaggaccaaaaggaaaaataataagaagaatagaagcaggaagaaGTGTAATGCTGCGCCGCTGAAAAAGTGGAGAATAGGAGACACGTGTAATGCCGTTTGGTCAGAAGATGGGAATATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGTATCGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTAAAGGCCACACAATGAAAATTCAGCTCTGACTCTGAAACATTCTGAAGTACTGTCACCATCTAGCATTTGTGTTTAATAGCTTATATTGAATTT
  5   1   2       bld Thy                             IMAGE:8547922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTACTCAGCTACCATCTCTTCCATTGATGCTAAAAGAGGGACTTGCATAGTTGTTTATAGCGGATATGGCAATAGTGAGGAACACAGCTTGGCTGACCTGCGTTTTCCAGATACTTCTGAAGCGGAAAGTGACCAAAGGGACCAAGAGCAGGAGATAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGCTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAACCGAATGCGTATCGTTAGCATACATTGTCATTTAGCAATAA
  3   1   2       chi Ga18                              rxlk73n21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATNCTAANNNGGNCNTNCANNGTTNTTNNNNGCGGNNTATGGNAAANANTGANGANNNNAGCTNGCTGACNNNNTTTNCNAGNNNCTTCTGAAGNGGAAAGTGNCCAAAGGNNCNAAGAGCAGNAGATAAATGGAGATGAGCNTTCNACAGATGAAAGTGATAGATCTTCAAGATCGCATNAAAGCAAAGNTCCTCAGANCCGGGAGACNNCAAAGNCNNCANAGTGGAATGNCCANNTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGNTCAAGNACNTCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGNCCACCTATGATTCCNNCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAANCCNCCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAATCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGNCCGAACTATACTGAACTATCATTTTGNNCCAA
  3   1   2       bld DMZ  5g3  in                         xl317m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAGCCTTTCAACCAGATGAAAAGTGATAGATCTTCAAGATCGCATCAAAGCAAAGATCNTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTT
  5   1   2       bld DMZ                                  xl335l11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTGAA
  5   1   2       bld DMZ                                  xl307l16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGA
  5   1   2       bld DMZ       in                         xl245a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCAAGATCGCATCAAAGCAAAGATCCTCAGAACCGGGAGACGCCAAAGTCCTCACAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTG
  5   1   2       bld Tbd7                                 XL068a23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGCTTTTATCTGCTTCATTCATAATGAAGGAATTGCCCACACCTGCCCATGAAATAGCCTTTGAGTCAGTGTCCAATTACTTTTGAGCCCCTGAAATGAAGTGAAAATGCATTTTTATGCAATCTTTTTGTGCAGCCCACGTTCATGCAGTTCGACTGCATCTGAGTTGTTTAATTTCAAATTCATTGCGGTAATGGACAGGACCAAAATTAGAAAAAGTTGTCTCTGTCCAAATATTTATGGGCCTAACTGTACATACTGGACTGGACAGTGACTGTAAATGTATTTGTTATTCATTTATTATTACAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGGTTTAGACTGCTCCCAAAACCGAATGCGTATCGTCAGGCATAACATTGTC
  5   1   2       bld Tbd7      in                         XL073p04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCTTTTATCTGCTTCATTCATAATGAAGGAATTGCCCACACCTGCCCATGAAATAGCCTTTGAGTCAGTGTCCAATTACTTTTGAGCCCCTGAAATGAAGTGAAAATGCATTTTTATGCAATCTTTTTGTGCAGCCCACGTTCATGCAGTTCGACTGCATCTGAGTTGTTTAATTTCAAATTCATTGCGGTAATGGACAGGACCAAAATTAGAAAAAGTTGTCTCTGTCCAAATATTTATGGGCCTAACTGTACATACTGGACTGGACAGTGACTGTAAATGTATTTGTTATTCATTTATTATTACAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGGTTTAGACTGCTCCCAAAACCGAATGCGTATCGTCAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAAT
  5   1   2       bld Tbd7      in                         XL066p04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAGGAATTGCCCACACCTGCCCATGAAATAGCCTTTGAGTNAGNGTCCAATTACTTTTGAGCCCCTGAAATGAAGTGAAAATGCATTTTTATGCAATCTTTTTGTGCAGCCCACGTTCATGCAGTTCGACTGCATCTGAGTTGTTTAATTTCAAATTCATTGCGGTAATGGACAGGACCAAAATTAGAAAAAGTTGTCTCTGTCCAAATATTTATGGGCCTAACTGTACATACTGGACTGGACAGTGACTGTAAATGTATTTGTTATTCATTTATTATTACAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGGTTTAGACTGCTCCCAAAACCGAATGCGTATCGTCAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTA
  3   1   2       bld DMZ  5g3  in                         xl317k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCATTTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTT
  3   1   2       bld Ga15 5g3  in                       XL435a23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTATGCCTGGGCTTTGGAAGGCAGGGNGAGGAAGCTGGATCAAGCACATCCCTTTCTCTCNGGATGGCCCCCACCATTTCTACCGGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAGGCCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAATCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTCCAAA
  3   1   2       bld DMZ  5g3  in                         xl318m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTGGTCCAAAGT
  3   1   2       bld DMZ  5g3  in                         xl278o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATGCCTGGCTTTGGAAGGCATGGTGAGAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTCCAAAGATCCTAAC
  3   1   2       bld DMZ       in                         xl230g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTATGCCTGGCTTGGAAGGCATGGTGAGAAGCTGGATCCAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTT
  3   1   2       bld DMZ       in                         xl245a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GANGGCATGGTGAGAAAGCTGGATCAAGCACATCCCTTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTG
  3   1   2       bld DMZ  5x3  out                        xl324l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATGGTGAGAAGCTGGATCAAGCACATCCNTTCTCTCTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTCCAAAGATCC
  3   1   2       bld DMZ  5g3  in                         xl253p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGGATGGCCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATT
  3   1   2       bld DMZ  5g3  in                         xl239j04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGATGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTGGTCCAAAGATCCTAACTC
  3   1   2       bld Ga12      in                         XL144p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATGATTCCACCCCCTCCACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGGGCCGAACTATACNAACTATCATTTGGTTCCAAAGATCCTAACGTCTGTCAATA
  3   1   2       bld DMZ       in                         xl252d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATTAAAGCTGAGGGTCTGCAGTTCGNCTGCATCTGAGTTTTCATTTCAAATTCATTGCGGTAATGGACAGAACCAAGGTTGGAAAAGGTTGTCTCTGTCCAAATATTTATGGGCCTAACTGTATATACTGGACTGGACAGTGACTGAAAATGTATTTGTTATTAATTTGTTATTACAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCAT
  3   1   2       bld Tbd7      in                         XL105p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTCTGCAGTTCGACTGCATCTGAGTTTTCGTTTCAGATTCATTGCGGTAATGGACAGAACCAGGATTGGAAGGGGTTGTCTCTGTCCAAATATTTATGGGCCTAACTGTATATACTGGACTGGACAGTGACTGAAAATGTATTTGTTATTAATTTGTTATTACAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAATCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGGGCCGAACTATACTGAACTATCATTTGGTTCCAAAGATCCTTAACGTC
  3   1   2       bld Ga12      in                         XL197j13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAATGAGCCCCGATGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTG
  5   1   0       chi Tbd7      in                         XL105p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAGCCCCGNTGCTTGTGAAGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTGAGTATTCTATGCCAGTAAATCATTTTATGGGGCTGATTTATCAAAATTTAAGTTTGCATTTTTTGCACGATTCCAGGgaaaaaaacgcagcaagaaaaaaaaaTTGCAAACGTGAATATACTTGAGAATGTTCTTCAGAACCTTGAATAGTCAGTATTTATTaaaggaaaaaaaaagtcgccagaaaaaaaTCTCCCCCAAGGTTCAGTAAAAGCCCATGGGAATTATCTCTTAACAACTTTATTCAGTTATTTATTTTCTATGTTTCCATAATCTGTCAGGTTTTTTCTTAGATACGCTAATGTTCGAGAAAAAACGATTTGTCGCATTTCTTTGTGTGCGTTTATATATCTCAAGAATTTGCATTGTGTTTTCGTTGTGATTATATTGTCCCAGCATTTTTAGATTAGTCTATAAATAATGAAGGCATGCATGGTTTAAAGGGGTGGTTCACCTTTAACTTTTAATATGTTATAAAAACTTATTCTTAAGCTT
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCAAAAAAAAAAAAAAAG
  3   1   2       bld DMZ       in                         xl287k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTGGTCCAAAGATCCTAACT
  5   1   2       bld DMZ       in                         xl287k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATGACGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCNAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl274h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGGCATTGGGCAGTATGTTGATCTCCTGGTACATGAGCGGATATCACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATT
  3   1   2       bld DMZ       in                         xl295a10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTACATGAGCGGNTATCACACTGGCTACTACCTGGGANTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAANCCACCTCACCAGAAGTNACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGNAACCATTCTGAAAGTAACTGTCACCATCTANCANNGTGTTATAGCTTATATGNTTTNGACTGCTCCCAAAACCGANTGCGNGTCGNTAGGCANGACATTGTCNCTTTAGCNAATAAAAGCATCTAGTTTATATGCCTGNTTCAAGGTGCTGCAGCGAATTAAGTATTATCCACTCATTNCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATANTGATCTCNGAAGTTCAAAGCTCCAATCTTCCTTGTNCCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATNGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACNGAACTATCAT
  5   1   2       bld Bla1      in                    IMAGE:3380372.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACACTGGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCG
  3   1   2       bld Ga18                              rxlk79i11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANNCTGGNTNCTACCTGGGACTAAANNANGGNCGNANGNAATCNTCCATNGNAAACCACCTCNCCAGAAGNAACANCCAGGAGTAGGTATCGTCTGTTTACATGNAANCTCCACANTTGTGCGCTGNNNAAGGCCGCANNATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCANTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAANCCGAATGCGTATCGTNAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCACCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAANTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCCAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGANCTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATANAGTTCACCNTGGTTTAAATAACCAGTCCAANAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAANGTGNNGTGACATGAAATGNATTTCCACNAACACAAGTACATTTTCTGTTTATTTTGATATA
  3   1   2       bld Ga15      in                       XL518j12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCTACTACCTGGGACTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGTCTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTATCGTTAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCACCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCCAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGCAACTTTTG
  3   1   2       bld DMZ                                 rxl255o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGGGANTAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACNGTTGTGCGCTGTTAANGGCCACACAATGNAAATTCAGCNTCNGGACATCNGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCNTATATGATTTAGACTGCTCCCAAAACACGANTGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCT
  3   1   2       bld Ga12                                 XL181f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAGCAAGGGCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTNTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGNCTGCTCCCAAAATCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTGTCAATAC
  5   1   2       bld Egg1                               PBX0034E08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAATGGAATCTTCCATTGGAAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCACACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCAT
  3   1   2       bld FaBN      in                    IMAGE:8075760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCATNGGAAACCACCTCACCAGAAGTAACATCCAGGAGTAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTAAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTATCGTTAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCACCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCCAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATAATGCAAC
  3   1   2       bld Ga15      in                       XL414i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACCAGAAGTAACATCCAGGAGTAGGTATCGTCCTGTTTACCATGGAAGCTCCACACTTGGTGCGCTGTTAAAGGCCGCNCAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATAGGATTTAGACTGCTCCCAAAACCGAATGCGTATCGTTAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCACCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCCAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGCAACTT
  3   1   2       bld Tbd7      in                         XL066p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTATTCATTTATTATAACAGGTATCGGGTGTTTACATGGAAGCTCCACACTTGTGCGCTGTTAAAGGCCGCACAATGAAAATTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGGTTTAGACTGCTCCCAAAACCGAATGCGTATCGTCAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCTAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACCATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTANTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAAGACATTTCCACNCAACACAAGTACATTTTCTGTT
  5   1   2       bld Ga12                                 XL141l21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCCACAATGAAAATTAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAATCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCA
  3   1   2       bld Bla1      in                    IMAGE:3380372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCAGCTTCTGGACATCTGAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGT
  3   1   2       bld Tbd7      in                         XL073p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAACCATTCTGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGGTTTAGACTGCTCCCAAAACCGAATGCGTATCGTCAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCTAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTAAATGACATTTCCACACAACACAAGTACATTTTC
  3   1   2       bld Egg3      out                   IMAGE:3378162.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATTCTGAAAGTNACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTT
  5   1   2       bld Egg1                               PBX0077H01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGTAACTGGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTT
  3   1   2       bld Egg3 5x3  out                   IMAGE:3377795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTG
  3   1   2       bld Ov1                             IMAGE:4055302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAAGTAACTGTCACCATCTAGCATTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCA
  5   1   2       bld Ga15      in                       XL430a04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTATCGTTAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCACCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCCAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTaaaaaaaataaaaTACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGCAACTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL430a04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTGTTATAGCTTATATGATTTAGACTGCTCCCAAAACCGAATGCGTATCGTTAGGCATAACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCACCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCATAGCTCCAATCTTCCTTGTGCCTGTTCAGAAGCAGAATTACTATTGAAGTAGCTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCGTTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCTAAAAAAAATAAAATACAGTTCACCTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGCAACTTTT
  3   1   2       bld Gas8                            IMAGE:3516355.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATGATTTAGACTGCTCCCAAAACCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCAAAAAAAAAAAAAAAA
  3   1   2       bld Egg3 5g3  in                    IMAGE:3377569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTGCTCCCAAAATCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGT
  3   1   2       bld Ga12      in                         XL156a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGAATGCGTGTCGTTAGGCATGACATTGTCACTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATC
  5   1   2       bld Ga12      in                         XL156a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCGAATGCGTGTCGTTAGGCATGACATTGTNCTTTAGCAAATAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATGCAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCaaaaaaaaaa
  3   1   2       bld Egg6                            IMAGE:4412739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAAGCATCTAGTTTATATGCCTGTTTCAAGGTGCTGCAGCGAATTAAGTATTATCCAATCATTTCCTTGGGAAGAGGACAGAGTTCAGATACAGTGATTTGTAATTGAACTACAGTGGTTTTATAAAAGCCTTCTCTTTAGTGCAAGGATACAGGCACTTAGAGTGAATTTGTTATAAAATATTGATCTCTGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAAAGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCC
  3   1   2       bld Egg6      in                    IMAGE:4435315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGTTCAAAGCTCCAATCTTCCTTGTACCTGTTCAGAAGCAGAATTACTATTGAAGTAGGTATAGTATTCAGCAACATAAGGATTAACGATGTGGCCGAACTATACTGAACTATCATTTTGGTTCCAAAGATCCTTAACGTCTTGTCAATTACTTTGGTTATTCAAAAAAAAAAAAAAAAAATACAGTTCACTTTGGTTTAAATAACCAGTCCAAACAATTTGCAGTAGGCCTTTTGTGTTATTTTTCTATTATAATCGTGTATGTGACATTGAAATGACATTTCCACACAACACAAGTACATTTTCTGTTTATTTTGATATATATGCAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)