Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012767546 Xl3.1-xl226h12.3 - 67 ESTs
                                                                       ...-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl226h12.3                                                                                                                            GAAGCCAAGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTTAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686130                                                                                                                                  AAGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTTATAAAAAAAAAAAAAAAAAAAAGGC
                                                      consensus depths                                                                                                                                 3     7    15    19    17    23    18    26    20    29    23    31    28    35    29    37    31    41    35    44    36    44    38    46    41    47    42    47    42    48    44    49    42    49    41    49    47    49    47    51    49    51    48    51    50    51    46    51    49    51    50    52    52    56    54    56    54    55    53    55    55    55    54    54    55    55    54    54    54    54    54    54    53    55    54    55    52    53    54    55    54    55    53    55    53    54    52    54    53    54    52    54    53    54    54    55    54    55    53    55    54    55    53    54    53    54    53    54    52    54    47    48    46    48    46    48    43    45    46    48    46    48    45    47    39    45    38    43    37    43    36    43    37    43    35    43    35    41    26    38    16    23    11    17     7    12     4    10     4     6
                                                                   SNP                                                                                                                                                                            T-----------
                                                                   SNP                                                                                                                                                                                        T-----------
                                               BLH ATG      81     179                                                                                                                            
                                               BLH MIN      15      73                                                                                                                            
                                               BLH OVR      81      50                                                                                                                            
                                               EST CLI       6      59                                                                                                                            
                                               ORF LNG      81       3                                                                                                                            
  5  -1   0       chi Emb1                            IMAGE:6636214.5p CtttttttttttttttttACTTTTGTCATATCTCCAGCCAACTTTATTATATACTGTCCTTATTAGGTCAGTTACACAAAGCATTTCAGAACAAGTTTCATGGTGTAAATCAGATTGTATATTGGATAGAAAGACATGGGCGTGTGAGCAATTAGACTACTAAAGTATTTTGTAGAACAATAATTCCCTGGTGAGATGTTTTAGCAGATGTTGCAGTATTATATTATTACAAGTATTCTAAGGACTTGTGCTAAATGTGTGTTTTGCCAATATTTTAAATAACAATATTTTTAATTATTGTTAATTAAAAGGCAAGGATATTACTTTACTTTCCTAATTCTCTATTTTCTATAACGTGCTGAGTAAGGAGAACCTCAATTGGGGAAGACAATGTTTAGCGATATAACAAAATATGGTAATTCTGTGTACTCTTTCAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGGTATGAATTATAtttttattttttacaaattttttatttatttttatGGTATGCTGTAATTAGTTAAAACTAAGTACTTTAAATGTAATTAAAGGGAAACTTGATTATGAGCTTCATCTAAT
  5  -1   0       chi Emb1                   IMAGE:6636214-IMAGp.IMAGp    tttttttttttttttACTTTTGTCATATCTCCAGCCAACTTTATTATATACTGTCCTTATTAGGTCAGTTACACAAAGCATTTCAGAACAAGTTTCATGGTGTAAATCAGATTGTATATTGGATAGAAAGACATGGGCGTGTGAGCAATTAGACTACTAAAGTATTTTGTAGAACAATAATTCCCTGGTGAGATGTTTTAGCAGATGTTGCAGTATTATATTATTACAAGTATTCTAAGGACTTGTGCTAAATGTGTGTTTTGCCAATATTTTAAATAACAATATTTTTAATTATTGTTAATTAAAAGGCAAGGATATTACTTTACTTTCCTAATTCTCTATTTTCTATAACGTGCTGAGTAAGGAGAACCTCAATTGGGGAAGACAATGTTTAGCGATATAACAAAATATGGTAATTCTGTGTACTCTTTCAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGGTATGAATTATAtttttattttttacaaattttttatttatttttatGGTATGCTGTAATTAGTTAAAACTAAGTACTTTAAATGTAATTAAAGGGAAACTTGATTATGAGCTTCATCTAAT
  5   1   2       bld Ooc1 5x3               IMAGE:3746787-IMAGp.IMAGp                                                                                                   CGTCACACTCTCGCGAGATGAGACTGAAGCCAAGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTG
  5   1   2       bld Egg3 5x3                        IMAGE:6871122.5p                                                                                                                GATTCCCGGGACTGAAGCCAGGTGCTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATAGCAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGGGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTTGGGAAGCTCTCTATAACTGCAAGTGGAAAAAATAAAATCTGGTTTTAACTTTTAAAAANNCNNNCNNNGNNNNNNAGAGCGGGCGCCCACCGC
  3   1   2       bld Ga18                              rxlk81i12ex.3p                                                                                                                     TCCGNGGACGCGTGGGGGANTTTGGTGCTTACGGTGTTGNGGGACNTTTCAGTAGCGGNTCAACAGTGAGGGNAGTNTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTNNAGCAGGAAAGCTGCTCAGCTCANAAGAGAAGNCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAANNNNNNGCNCCTAAGCANNNTTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAANNGTAATAATACAGACTTGNNNCTNTCTATAAC
  5   1   2       bld DMZ  5g3  in                         xl226h12.5p                                                                                                                      GAGACTGAAGCCAAGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAA
  3   1   2       bld Ga18 5g3  in                      xlk117b22ex.3p                                                                                                                        CCNNTGAANCCAAGGAGTTTGGNGCTTACGNTGTTGCGGGACNTTTCAGTAGCGGGTCAACAGTGTGNGCAGTGTCAAACGCCACAATGCCCAAAGNCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAANNNNNNGCNCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGANCTCTCTANAACTGCA
  5   1   2       bld Egg1 5x3                           PBX0071H03.5p                                                                                                                           GGCACGAGGGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATTTTAAAGTGGTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAANAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGC
  5   1   2       bld Ga18 5g3  in                      xlk117b22ex.5p                                                                                                                            GAAGNCAAGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTNCGNCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGNAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGANTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCNATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGNTCTAATGAGGAATCCATGCCTNNTTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGNNNACTAAAAGNGGNNAATTCATTTTTGNATTAAATTTGAC
  3   1   2       bld Ga18 5g3  in                       xlk78l16ex.3p                                                                                                                                 CCAAGGANTTTGGNGCTTACGGTGTTGCGGGNCGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAANCGCCACAATGCCCAAAGTCCANTCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAANNNTNNGCNNCTAAGCATTATTGGTGAAAANCTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGANCTCTCTATAACTGCA
  5   1   2       bld Ga15 5g3  in                       XL458n06ex.5p                                                                                                                                  AAGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACNTGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAAACTTTCTAGCTATGTGAAATTC
  5   1   2       bld Ga18      in                      xlk131b14ex.5p                                                                                                                                   AGGAGTTTGGTGCTTACGGTGTTGCGGGNNGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGNTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGNTAAAAAGTGAAAAAGCTCTNNNNCTAAGCATTATTGGTGNAAAACTGCAGNGGTTTCAAAGCCATCTAAATCCTGNAAAAGCAGAATACACNANGAAGGNAGCCTGTGAACTAATTGAAAGNTACTTACATCGGNTTGNTAATGAATTGGA
  5   1   2       bld DMZ  5g3  in                         xl237e03.5p                                                                                                                                   AGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCTGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGA
  5   1   2       bld DMZ  5g3  in                         xl222c11.5p                                                                                                                                   AGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCTGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAA
  5   1   2       bld DMZ  5g3  in                         xl238e03.5p                                                                                                                                   AGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCTGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAA
  5   1   2       bld DMZ  5g3  in                         xl303e10.5p                                                                                                                                   AGGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCTGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTT
  5   1   2       bld Ga18 5g3  in                       xlk78l16ex.5p                                                                                                                                    AGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGNCACTCAGACCTTTTTAATGAATAACTAAAAAGNGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTG
  3   1   2       bld Ga18      in                      xlk131b14ex.3p                                                                                                                                    AGGAGTTTGGTGCNTACGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAANCNNCACAATGCCCAAAGNCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGNCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAANNNNNNGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGANTCT
  5   1   2       bld DMZ  5g3  in                         xl328p07.5p                                                                                                                                    GGAGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTAGCTGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAA
  5   1   2       bld Ga12 5g3  in                         XL181f03.5p                                                                                                                                     GGGTTTGGTGCTTACGGTGTTGCGGGACGTTTCAGTANCGGGTCNACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAANAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGNAAGACAGAAAGGATAGGTTA
  5   1   2       bld Ga18 5g3  in                       xlk51h07ex.5p                                                                                                                                        TTTGGTGCTTACGGTGTTGCGGGANGTTTCAGTAGCGGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGNTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTNAATNTTNCCGNTNTTTNCNAAAAATGAACTTTCTAGCTATGTGAAANTCAAATGCATATCAAAA
  5   1   2       bld Egg1 5g3  in                    IMAGE:4783354.5p                                                                                                                                             GCTTATGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGCGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGAT
  5   1   2       bld Egg2 5x3               IMAGE:4783354-IMAGp.IMAGp                                                                                                                                             GGCTTATGGTGTTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAAATGTAATAAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAAATAAATCTGTTTTTAACTTTaaaaaaaaaaaaaaaaaaaaaaaaaGATTCGCGGCC
  5   1   2       bld DMZ  5g3  in                         xl262l01.5p                                                                                                                                               CTTACGGTGTTGCGGGACGTTTCAGTAGCTGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTA
  5   1   2       bld Egg3 5x3                        IMAGE:6870583.5p                                                                                                                                                   GATTCCCGGGGGACGTTTCAGTAGCGGGTCAACAGTGTGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATNCAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAAATAAATCTGGTTTTAACTGTaaaaaaaaaaaaaaaaaaaaGGCGGGCGCCCACCGGCGGGTGGGAGCTCCCAGCCTTTTTGTTTCCCCCTTTAGTGGAGGGGGGTAC
  3   1   2       bld Ga18 5g3  in                       xlk51h07ex.3p                                                                                                                                                       GNGTTNNGGGNCNTTTCAGTAGCGGGTNANNAGTNNGGGCANNNNCAAACGCCACAATGCCCAAGTCNAATCAAATAAAAGNAAGNAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTNCTCAGCTCACAAGAGAAGCCCACAAGNAAGACAGAAAGGATAGGTTAAAAAGTGAAANNNNNNGNNCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAANNCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGANCTCTCTATAACTG
  5   1   2       bld Ga15 5g3  in                       XL420d07ex.5p                                                                                                                                                        TTGCGGGACGTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCNAATGCATATCANAATGTAA
  3   1   2       bld DMZ  5g3  in                         xl222c11.3p                                                                                                                                                             GGGACGTTCAGTAGCTGGTCACCAGTGTGGGCAGTGTCNAACGCCACAATGCCCCAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  5   1   2       bld DMZ  5g3  in                         xl341p07.5p                                                                                                                                                                 GTTTCAGTAGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAA
  3   1   2       bld DMZ  5g3  in                         xl226h12.3p                                                                                                                                                                      AGTAGCGGGTCACCAGTGAGGGCAGTGTCAAACGCCACNATGCCCAAAGTCCAATCAAATAAAAGCNAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  5   1   2       bld Ga12 5g3  in                         XL198n04.5p                                                                                                                                                                         AGCGGGTCAACAGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCA
  5   1   2       bld Ga12 5g3  in                         XL208p04.5p                                                                                                                                                                                  AGGGTGAGGGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAAT
  5   1   2       bld Gas3 5g3  in                      xlnga003a03.5p                                                                                                                                                                                   CAGTGTGGGCAGTGTTAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGAT
  3   1   2      seed Ga15 5g3  in                       XL438d09ex.3p                                                                                                                                                                                          GGCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTA
  5   1   2       bld Ga15 5g3  in                       XL438d09ex.5p                                                                                                                                                                                           GCAGTGTCAAACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCNAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTTaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl328p07.3p                                                                                                                                                                                             CAGTGTCAAACGCCCCATGCCCAAAGTCCAATCAAATAAAAGCCAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  3   1   2       bld Ga15 5g3  in                       XL458n06ex.3p                                                                                                                                                                                                    ACGCCACAATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACNTGGGAGCTCTCTA
  3   1   2       bld Ga15 5g3  in                       XL420d07ex.3p                                                                                                                                                                                                           TGCCCAAAGTCCCAATCNAAATAAANGCAAGCAAGAAAAAGTTATTCATCCGTTCCAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCT
  3   1   2       bld Ga15      in                       XL503a09ex.3p                                                                                                                                                                                                               CCCAAAGTCCAATCNANTNAAAGCAAGCAAGAAAAAGTTATTCATCCCGTNCAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCTAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAANAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  3   1   2       bld DMZ  5g3  in                         xl303e10.3p                                                                                                                                                                                                                     AGTCCAATCAAATAAAAGCNAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  3   1   2       bld DMZ  5g3  in                         xl262l01.3p                                                                                                                                                                                                                     AGTCCANTCAAATNAAAGCNAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  5   1   2       bld Ga12      in                         XL182f03.5p                                                                                                                                                                                                                      GTCCAATCGAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGNGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACNTAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCANGCAGCAATGATGA
  3   1   2       bld Ga12 5g3  in                         XL181f03.3p                                                                                                                                                                                                                        CCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCNTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATA
  5   1   2       bld Ga15      in                       XL500j01ex.5p                                                                                                                                                                                                                               AATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTTAGCCTTATTAGATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL500j01ex.3p                                                                                                                                                                                                                               AATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGGAAAAAAT
  3   1   2       bld Ga12 5g3  in                         XL208p04.3p                                                                                                                                                                                                                                ATAAAAGCAAGCAAGAAAAAGTTATTCATCNGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATC
  3   1   2       bld DMZ  5g3  in                         xl341p07.3p                                                                                                                                                                                                                                                       ATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  3   1   2       bld DMZ  5g3  in                         xl237e03.3p                                                                                                                                                                                                                                                           ATCCGTACAGCNGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACNAGCCAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  3   1   2       bld Ga12      in                         XL182f03.3p                                                                                                                                                                                                                                                                 ACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGGAAAAAATA
  3   1   2       bld Ga12                                 XL202k09.3p                                                                                                                                                                                                                                                                                         CAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAANAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAANACTGCAGTGGTTTCAAAGCCATCTAANTCCTGAAAAAGCAGAATACACANAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGACCAAATTGAATTGCNCAACAGTATCAAAGGA
  3   1   2       bld Ga12 5g3  in                         XL198n04.3p                                                                                                                                                                                                                                                                                                              ACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAANCTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATCCACAAAGAAGGAAGCCTGNGAANTAATNGAAAGTTNCTTACNTCGGTTTGATAATGAATTGGAACAAATTGANTTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCANCTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTAGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGGAAAAAATAA
  5  -1   2       chi Bla2                            IMAGE:7299885.5p                                                                                                                                                                                                                                                                                                                            GTGTCAGTCCAGGAGCCCAGCAGCAGAGGATAGTAAAGTGAAAGCTTGCGCTAGCATATGTGAAACTGCAGTGTTCAAGTCTCTAATCTGAAAGCAGATACACAAGAGGAGCTGTGACTAAATGAAGTTACTACATCGGTTGATAAGAATNGGACAAATGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGTACCCAATCGCCTAAGACGGG
  3   1   2       bld DMZ  5g3  in                         xl238e03.3p                                                                                                                                                                                                                                                                                                                                                      AAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGAC
  3   1   2       bld Ga15                               XL501j01ex.3p                                                                                                                                                                                                                                                                                                                                                         ATTNTTGGTGAANTNCTGCNGTTGGTTTCAAAGCCATNTAANTCCTGNAAAAGCAGAATACNCAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTNNCATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACANCAGTATCAAAGGAAGNCAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCANCTATACAANGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTC
  3   1   2       bld Egg1 5g3  in                    IMAGE:4783354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                        GAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTTAAAAAAAAAAA
  3   1   2       bld Ga12                                 XL208o22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTAATTGAAAGTTACTTNCATCGGTTTGATAATGAATTGGAACAAATTGAATTGCNCANCAGTATCAAAGGAAGNCAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATANTGTGANTTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTNAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCNCTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAANGAATAACTAAAAAGTGGGAAATTCATTTNTGAATTAAATTCGACATGATGCNTGTGTTGAATATTNCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTNGGAGCTCTCTATAACNGCAAGGAAAAAA
  3   1   2       bld Tbd7                                 XL062p10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAANTAAAAAATAAA
  5   1   2       bld Ga15      in                       XL503a09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANCAAGACGGCATGAATCTCGTGAGACTGTTATCNAGCAGACCATAGAGCGTGAANGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGANAGTGTTCAGGGATTGGGATTTANATATGAAGAAACTGCCGAATATCAAAATGCNAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCTAGGCAGCAATGATGAAATANAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCNNACCTTTTTAATGAATAACTAANAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGC
  3   1   2       bld Gas3 5g3  in                      xlnga003a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCGAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGGTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAAAA
  5   1   2       bld Ga18      in                      xlk150k23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTAATAATaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk150k23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAAAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGNGNCTCTCTANANCNGCA
  5   1   2       bld Ga18      in                      xlk113m09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGaaaaaataaatctgttttaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk113m09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAAAATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTGAAAGTCACTCAGACCTTTTTAATGAATAACTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGNNNNNTCTANANCNGCA
  5   1   2       bld Ga15      in                       XL410h15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGTTTTAACTTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL410h15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACCTTGGGAGCTCTC
  3   1   2       bld Ga15                               XL411h15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAAAAGTGGGAAATTCATTTTTGAATTAAATTTGACATGATGCTTGTGTTGAATATTGCCGTTGTTTCCAAAAATGAACTTTCTAGCTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGACT
  3   1   2       bld Ga12                                 XL174p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATGTGAAATTCAAATGCATATCAAAATGTAATAATACAGNCTTGGGAGCTCTCTATAACTGCAAGTGAAAAAATAAATCTGNTTTAACTTTAGCCTTGTATGAAAATGAGTAATATGTTAAATTTCCACATATGATTGCTCCAGTTGACCTGAAATTATTATCTCAGAATGGCAAATTGGCACCTAAATTTGGTCACNAACTTTATATTTTTTACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)