Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL456b22ex.5                         20 PI      88        130      883                polymerase (RNA) II (DNA directed) polypeptide G; wu:fc18d05 [Danio rerio]
     2   0.0    0Xl3.1-IMAGE:4679788.5                       2 PI      98          1       96                zinc finger and BTB domain containing 3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012767642 Xl3.1-XL512d13ex.3 - 53 ESTs
                                                                       ...-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL512d13ex.3                                            TCGGTGTACGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACATCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGCTACAAACAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686580                                                  TACGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACATCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGCTACAAACAAAAAAAAAAAAA
                                                      consensus depths                                                 2     5     3     8     3    11     4    12     4    12     4    13     4    13     4    13     4    13     5    15     6    17     9    19    11    21    11    22    13    27    25    33    31    39    36    40    38    43    42    44    41    44    41    44    38    44    44    46    46    50    48    50    49    52    49    52    48    52    49    52    50    53    50    53    50    53    50    53    50    53    50    53    50    53    50    53    50    53    51    53    51    53    52    52    52    52    52    52    52    52    52    52    52    52    51    52    50    52    51    52    51    52    51    52    50    52    50    51    48    50    47    50    48    50    44    48    43    48    43    47    41    46    43    46    39    44    38    42    38    42    37    41    24    40    36    39    26    39    23    38    22    37    15    26     9    16     5    12     4    10     3     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----G----G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------C
                                               BLH ATG     209     803                                            
                                               BLH MIN     206     111                                            
                                               BLH MPR     140     111                                            
                                               BLH OVR     209     414                                            
                                               CDS MIN     209       8                                            
                                               EST CLI     154       8                                            
                                               ORF LNG     209      14                                            
  5   1   2       bld Ga15      in                       XL442a20ex.5p CTAGAAGACAGAGCAGTCCCGGATTTGTGTTTAATTTCTCAGCTCGGTGTACGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACATCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATT
  5   1   2       bld Ga18 5g3  in                       xlk54a07ex.5p        AGAAGNNAGAGCAGTCCCGGTTTGTGTTTAATTTCTCAGCTCGGTGTACGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGNNNNNNTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCNTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATNNNNNNAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGNTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGANCCAAATTCTAACCNACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACNGNATGATGAGATCCNGCTCAAAATCGTTGGGANAAGAGNNNTNAAAATGACANTTTTNC
  5  -1   2       bld Egg3                            IMAGE:6867281.5p                   TGAATGTGGTAGAAGTAGCTTTCGGGATGTTACGTAAAGGGACCGGAGGGAATATTTTTGCCCCCACAAGGCATTCCCTTGGGGGAGTACCCGCCGCCTGGGGttttttttGCAGGCCCCGCAGCATGTTTTCCGGGTTAATAGGGGAGGGTAACTCGGAGAGCGCGCTCATTCGGGCATGGATGGAGGCGAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCTCCCAAGGATGTTTTCCCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCTTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGCTCGAACAAAAGGaaaaaaaaaaaGCGCCCCGTGAATCGATC
  5   1   2       bld Egg1 5g                         IMAGE:3301391.5p                         GCACGAGGAATTTCTCAGCTCGGTGTACGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACATCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGGGGTGACCCAAGGTAATAAGGTTGGA
  3   1   2       bld Ga18 5g3  in                      xlk141i13ex.3p                                            CCACGCGTCCGGTCGNTTCTCTNCGTTACCAGGGCACGACNCCGANTCCCTGGATTACCAGGANNGAGCCGGCCCTGCCACACATNGCTNNCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGANNACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTNNTCTCTCTTCNCCCCATGTANA
  3   1   2       bld Ga18 5g3  in                      xlk154b10ex.3p                                                   CCGCGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGANCNGAGCCGGNCCTGCCACACATCGCTGNCTCGACATCATTTCCTGTTCGAAGTGACGTCAACAACAGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGNNNCATCGTGCGGCAAAGAAAGTNGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCANCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCNNNCTCTCTTCNCCCCATGTANNNANNNC
  5   1   2       bld Ga15 5x3                           XL490m11ex.5p                                                      TCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAANATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGC
  3   1   2       bld Ga18 5g3  in                       xlk78g02ex.3p                                                        TCGATTCTCTACGTTACCAGGGCACGACACCGAATNCCTGGATTACCAGNANNGAGCCGGCCCTGCCACACATNGCTGCCTNGACGTCATTTCCTGTTCGAAGTGACGTCAACAACANNGCCNCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGANNACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAANACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTNNTCTCTCTTCNCCCCATGTANNTANTNCC
  5   1   2       bld Ga18 5g3  in                       xlk78g02ex.5p                                                         TCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGNNGNNNTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATNNNNNNCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGNTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGNTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACANTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGNTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGNAAGANCT
  5   1   2       bld Ga18 5g3  in                      xlk141i13ex.5p                                                         TCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCNGNCCTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCNNNNNNAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGNTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAANCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGNGGATAAAAATGACATTTTTGCAATTGNNTCTCTGATGGATGATTATCTTGGNCTGGTGAGCTGATGTNCACCACCCCCTGTCTCTGGNGNAAGANCTGATCTGCTCTNCGGGCATCC
  5   1   2       bld Ga18 5g3  in                      xlk154b10ex.5p                                                            GATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGNNNTGCCACACATCGCTGCCTCGACATCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGNNNNAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAANATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGNCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGNTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGANCNAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGNNAAGAGNGGATAAAAATGACATTTTTGCAATTGGNTCTCTGATGGANGANTATCTTGGTCTGNG
  5   1   2       bld Ga12 5g3  in                         XL174o02.5p                                                                           GCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCC
  3   1   2       bld Ga18                             rxlk151i14ex.3p                                                                                                 GATNACCANGNNNNGAGNNGNCNTNCCANACANNGCTGCNTCGACNNCATTNNCTGTTNGAAGTGACGTCNNCAACAGNNCCGCCTTTTGAAAGAACTTTATNGTNCCCGGAATANNCACATCGTGCGGCNNAGAAAGTNGCTGCGGCGTCNAAGGATGTTTTANCATATCTCACTGGAACATGAANNTCTTCTGNACCCNAGATATTTTGGCCCTANNCTTCTCAANACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTANCCACAATCGATAACATTGGGGCCGGGGTGATCCANCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCNGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTNNTCTCTCTTCNCCCCATGT
  5   1   2       bld Ga12 5g3  in                         XL209k12.5p                                                                                                                                               CACGAGGGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAA
  5   1   2       bld Ga12 5g3  in                         XL155e02.5p                                                                                                                                                    GGTTCGAAGTGACGTCAACAACAGGACGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACANGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGG
  3   1   2       bld Ga12 5g3  in                         XL209k12.3p                                                                                                                                                               GACGTCAACANCAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTCCCATT
  3   1   2       bld Ga18 5g3  in                      xlk153l07ex.3p                                                                                                                                                                   ACCCAACGTCNGCNNNNGTCNGNCCANCGNNNNCCNNNNNCGCCCACGCGTCCGATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTANCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAANCTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCANCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGNTCTCTCTTCNNCCCATGT
  3   1   2       bld Ga15                               XL423c20ex.3p                                                                                                                                                                      CAACAGGCGCCGCCTTTTGAAAGAAACTTTATTGNTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCCATGTACATAATTCCCAT
  3   1   2       bld Ga18 5g3  in                       xlk54a07ex.3p                                                                                                                                                                                CNCNTTTTGAAAGNACTTNATNNNTNCCNGNAATAGANNACATCGTGCGGCAAAGAAAGTNGNTGCGGCGTCCNAGGATGTTTTACCATNTCTCNCTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGNNCCTANCCTTCTCAANACTGTCAAACAGAANNTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTANCCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGNTCTCTCTTCNNCCCATGTA
  3   1   2       bld Ga12 5g3  in                         XL161j13.3p                                                                                                                                                                                    CTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCAT
  3   1   2       bld Ga18 5g3  in                       xlk69g12ex.3p                                                                                                                                                                                        CCNNCGTCCGNCCNNNNTCCGNCCACGCGTCCGATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGNTCTCTCTTCNCCCCATGTANNTANT
  5   1   2       chi Ga12      in                         XL207b11.5p                                                                                                                                                                                                      GAGGGCTCGGTGTACGTCGATTCTCTACGTTACCAGGGCACGACACCGAATCCCTGGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCA
  5   1   2       bld Te2N                            IMAGE:7768415.5p                                                                                                                                                                                                            GACAAGACAGTTCGGTCCGGATTCCGGGAGAAGTCGCTGCGGCGTCAAGGATGTCTTATATATCTCACTGGAACATGAAATTCTTCTGCACCCAACATTTTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCTTCTATGGATTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTNGTTTAATAAATGCTACAAACaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Te2N 5x3                        IMAGE:7768452.5p                                                                                                                                                                                                             GGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATG
  5   1   2       bld Ga15 5g3  in                       XL461d20ex.5p                                                                                                                                                                                                                ATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTA
  3   1   2      seed Ga15 5g3  in                       XL461d20ex.3p                                                                                                                                                                                                                ATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACA
  5   1   2       bld Te2N 5x3                        IMAGE:7205292.5p                                                                                                                                                                                                                   AGCACATCNGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTTATAAAATGCTACAAACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGCCGCTTATTTAACCTCCAAGAGTGGGTCCCTTATGTGAGTCCTTATTATAACCTAGGGCCCTGCCCCTCGGTTTTACAACTTCTTGAACTGGGAAAAACTGCCTAGCCTGGGGGATCTTTTG
  5   1   2       bld Ga15 5g3  in                       XL512d13ex.5p                                                                                                                                                                                                                      CACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGCTACAAACNANAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL512d13ex.3p                                                                                                                                                                                                                      CACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTCCCATT
  5   1   2       chi Lmb1                            IMAGE:8533064.5p                                                                                                                                                                                                                         ATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTGTAAGTACATTGTAAGAATAAGAGATGTGGGTCTCAGGCAATGCTGGGCTCATAAATTGGACAAGCAGCTATAAACAATACGATACACTTCTGCCAAGGACTAGGGCCTCTTTCTGATGGTAGAGACTAAAGCCAAAGCCTCTCCTTGTAANCNNATGGTCGCTCTCTTGTCTCTCTATAGAGACTGCTAACTGGATGGATATGTCCTGTAGTGGACTTCTACTTTCAGAGAAGNTATGTCTGCTCTCTGATCATGTTCGCTATATCTATGGGGtttttttttCACATGTACAGGGATGCGACTATATAAAATATATATT
  5   1   2       bld Ga18 5g3  in                      xlk153l07ex.5p                                                                                                                                                                                                                         ATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGNTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTNNATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTAATAAAATGCTACNAANaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk69g12ex.5p                                                                                                                                                                                                                          ATCGTGCGGCAAAGAAAGTCGCTGCNNNNCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGNTCTCTGATGGATGATTATCTTGGNCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTNGAGTAAGANCTGATCTGCTCTNCNNNCATCCACTGTGTTCTGGTGCCTTNNATAAAAAAGGAAAGGGTCCATTTATGGTGATNCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTGTTTTAATAAAATGCT
  3   1   2       bld Ga18 5g3  in                      xlk147d09ex.3p                                                                                                                                                                                                                               CGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGNCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGNTCTCTCTTCNCCCCATGTANNTANTTCCCANT
  5   1   2       bld Ga18 5g3  in                      xlk147d09ex.5p                                                                                                                                                                                                                                  GCAAAGAAAGTCGNTGCNNNTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGNGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGNATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTNNCCATTTGTTTTAATAAAATGCTACAAACaaaaaaaaaa
  5   1   2       bld Skin 5g3  in                    IMAGE:8640209.5p                                                                                                                                                                                                                                   AAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCATGTACTAATTTCCCATTGTTTTATAAATGCTACAACaaaaaaaaaaaaaaaaaaaaGGGCGGCGCAGCTGATTCCTAACGCGCTCAGCTTCGCCTAATGATCTATACTAATCAACTGAAGATCATGATATTGGACACCACTAATGATGAAATGCTATGGATGGACATGCTATGAC
  3   1   2       bld Skin 5g3  in                    IMAGE:8640209.3p                                                                                                                                                                                                                                     AAAGAAAGTCGCTGCGCGTCCAAGGATGTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCGTTCTCTTTCACCCCATGACAAATTCCCCNGGNNNAAGAANNNNAAAA
  5   1   2       bld Egg1 5x3                           PBX0089A03.5p                                                                                                                                                                                                                                      CACGAGGGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGAT
  5   1   2       bld Ga15 5g3  in                       XL405b10ex.5p                                                                                                                                                                                                                                            CGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGC
  3   1   2       bld Ga15 5g3  in                       XL405b10ex.3p                                                                                                                                                                                                                                            CGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCCATGTACATAATTCCC
  5   1   2       bld Ga15 5g3  in                       XL430a11ex.5p                                                                                                                                                                                                                                                      TCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAANAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGNCTGGNGANCTGATGTGCNCCACCCCCTGTCTCTG
  3   1   2       bld Ga18 5g3  in                       xlk53d10ex.3p                                                                                                                                                                                                                                                            GATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGNCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTNNTCTCTCTTCNCCCCATGTACA
  5   1   2       bld Ga18 5g3  in                       xlk53d10ex.5p                                                                                                                                                                                                                                                            GATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGANTATCTTGGNCTGGNGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGANCTGATCTGCTCTCCGGGCATCCACTGNNNNCTGGTGCCTTGCATAAAAAAGGAAAGGGNCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAANTTCCCATTTGTTTTNANTAAATGCTACA
  3   1   2       chi Ga12      in                         XL207b11.3p                                                                                                                                                                                                                                                             GGATTACCAGGAGCCGAGCCGGCCCTGCCACACATCGCTGCCTCGACGTCATTTCCTGTTCGAAGTGACGTCAACAACAGGCGCCGCCTTTTGAAAGAACTTTATTGTTCCCGGAATAGAGCACATCGTGCGGCAAAGAAAGTCGCTGCGGCGTCCAAGGATGTTTTACCATATCTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCAT
  5   1   2       chi Eye1                            IMAGE:7020194.5p                                                                                                                                                                                                                                                                           CTCACTGGAACATGAAATTCTTCTGCACCCAAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTGTAAGTACATTGTAAGAATAAGAGATGTGGGTCTCAGGCAATGCTGGGCTCATAAATTGGACAAGCAGCTATAAACAATACGATACACTTCTGCCAAGGACTAGGGCCTCTTTCTGATGGTAGAGACTAAAGCCAAAGCCTCTCCTTGTTAACCAATGGTTCGCTCTCTTGTCTCCTCTATAGAAGACTGCTAAACTGGATGGAATATGTCCTTGTAGTGGTACTTTCTACTTTCCAGAGTATAGTTTATGTCTGGCTTCTCTGTATCCATGTTTCGCTTTATATCATAATGGGGGTTNtttttttttttttcaacaatgtacaaggggggatgggcagaactataaatttaaaaaaatttataatatacctttgggggtaaaatattaaatagggctgaattaatctttttccttttttttCCCCTTACCAGTN
  3   1   2       bld Ga12 5g3  in                         XL155e02.3p                                                                                                                                                                                                                                                                                                                             TTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATNGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCATAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGAGTGTGCACCACCCCCTGTCTCTGGAGTAAGATCTATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTNGGTAGGCTGTTCTCTCTTCACCCCACGCACACAATTTCCCA
  3   1   2       bld Ga15 5g3  in                       XL430a11ex.3p                                                                                                                                                                                                                                                                                                                              TNTCAACACTGTCAAACAGAAANTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTCCCATG
  3   1   2       bld Ga15      in                       XL485g20ex.3p                                                                                                                                                                                                                                                                                                                                         TCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTCCCAT
  5   1   2       bld Ga15      in                       XL485g20ex.5p                                                                                                                                                                                                                                                                                                                                         TCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGCTACAAACNANANA
  5   1   2       bld Ga18      in                      xlk164l20ex.5p                                                                                                                                                                                                                                                                                                                                         TCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTNNATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTGTTCTCTCTTCACCCCATGTACATAATTTCCCATTTGTTTTAATAAAATGCTACAAACaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk164l20ex.3p                                                                                                                                                                                                                                                                                                                                         TCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCANCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTGATGCTNNTCTCTCTTCNNCCCATGTA
  3   1   2       bld Ga15      in                       XL442a20ex.3p                                                                                                                                                                                                                                                                                                                                                               GTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTGGGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGANGGATGATTATCTT
  3   1   2       bld Ga12 5g3  in                         XL174o02.3p                                                                                                                                                                                                                                                                                                                                                                GTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATCGCAGTAACCACAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGACAAGAGTGGATAAAAATGACATTTTTGCAATTGGCTCTCTGATGGATGATTATCTTGGTCTGGTGAGCTGATGTGCACCACCCCCTGTCTCTGGAGTAAGATCTGATCTGCTCTCCGGGCATCCACTGTGTTCTGGTGCCTTGCATAAAAAAGGAAAGGGTCCATTTATGGTATGCTGTTCTCTCTTCAC
  5   1   2       bld Ga12 5g3  in                         XL161j13.5p                                                                                                                                                                                                                                                                                                                                                                                                                 CAATCGATAACATTGGGGCCGGGGTGATCCAGCCAGGCAGAGGGTTTGTGCTGTATCCTGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTCGATGCTGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCTATGTCCTGCTTCATATCGAGACACTCAATCCCATCGGAAATGGAATTTGACCCAAATTCTAACCCACCATGTTATAAGACAGTGGACGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATCGTTGGGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)