Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL195d02.5                            2 END     1           1       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5515392.5                       3 PI      90         35      813                Unknown (protein for MGC:114648) [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012767653 Xl3.1-xlk158a05ex.3 - 95 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                            3     3     3     3     4     4     5     5     8    10     9    11     9    11     9    11     9    11    10    12    10    12    10    12    10    12    10    12    10    12    10    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    11    13    11    13    12    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    11    13    12    13    11    13    13    14    10    14    11    14    11    14    11    14    11    14    11    14     7    11     9    14    10    14     8    13     9    13     9    13     8    12     7    10     9    11     9    11     9    11     9    11     7     9     7     9     6     8     6     8     6     8     6     8     6     9     5     9     5     9     5     8     5     8     6    11     8    11     8    10     8    10     8    10     9    11     9    11     9    11    10    12    11    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    14    15    15    16    15    16    15    17    16    17    16    17    15    17    15    17    16    17    16    17    15    17    15    17    15    17    15    16    15    15    14    15    15    15    13    14    12    14    12    14    12    13    14    14    14    14    15    15    15    15    14    15    14    15    14    14    14    14    14    14    14    14    16    16    16    16    16    17    15    17    17    17    16    21    17    21    17    21    17    21    17    21    18    22    19    21    18    22    18    22    18    22    16    21    17    20    16    19    13    18    13    18    16    19    15    19    16    19    15    20    16    20    14    20    17    21    14    21    17    23    17    25    16    26    18    28    21    29    22    29    21    29    24    29    24    29    24    31    22    31    26    31    25    31    26    33    25    33    26    35    27    35    25    37    29    38    35    43    30    44    34    43    35    43    34    44    34    44    34    44    39    48    38    47    37    47    44    47    43    47    47    51    49    51    50    52    50    52    51    53    49    51    51    52    50    52    50    52    51    52    50    52    52    52    51    52    52    52    50    51    49    50    50    51    48    51    50    50    49    50    48    50    48    50    49    50    48    49    47    51    47    51    48    51    48    51    48    51    48    51    47    52    49    52    47    50    44    49    37    39    31    36    31    33    22    26    12    21     8    11     7    10     5     7     4     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGCCCGGGTGGAGCCGCCGCGGGTGCAGATCTTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --A--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --CA--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----A------
                                               BLH ATG     135    1427                       
                                               BLH MIN     129     357                       
                                               BLH OVR     135      32                       
                                               EST CLI      37      17                       
                                               ORF LNG     135       6                       
  5   1   2       bld DMZ       in                         xl323d13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGTTTCATTAATGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCTCAATACAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGACGATGAGCAGGATGACACGGCAAAAGATCAAGATGATAACATGGAGGACAAGGAAACTCAACCTCTCAGAAAGTTTCCCTCTGATAAAATTTTTGAAGCAATTTCCTCAATGTTTCCAGACAAAGGTACATCTGAAGAACTAAAGGAAAAATACAAGGAATTAACAGAACAGCAACTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGG
  5   1   2       bld DMZ       in                         xl255d17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGTTTCATTAATGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCTCAATACAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGACGATGAGCAGGATGACACGGCAAAAGATCAAGATGATAACATGGAGGACAAGGAAACTCAACCTCTCAGAAAGTTTCCCTCTGATAAAATTTTTGAAGCAATTTCCTCAATGTTTCCAGACAAAGGTACATCTGAAGAACTAAAGGAAAAATACAAGGAATTAACAGAACAGCAACTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGA
  5   1   2       bld DMZ       in                         xl227a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGTTTCATTAATGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCTCAATACAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGACGATGAGCAGGATGACACGGCAAAAGATCAAGATGATAACATGGAGGACAAGGAAACTCAACCTCTCAGAAAGTTTCCCTCTGATAAAATTTTTGAAGCAATTTCCTCAATGTTTCCAGACAAAGGTACATCTGAAGAACTAAAGGAAAAATACAAGGAATTAACAGAACAGCAACTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACNGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCA
  5   1   2       bld Sp1                             IMAGE:5513303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGACAATCAAGACGATGAGCAGGATGACACGGCAAAAGATCAAGATGATAACATGGAGGACAAGGAAACTCAACCTCTCAGAAAGTTTCCCTCTGATAAAATTTTTGAAGCAATTTCCTCAATGTTTCCAGACAAAGGTACATCTGAAGAACTAAAGGAAAAATACAAGGAATTAACAGAACAGCAACTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCAAATATCGAGCCACTGAAATGTGGAATGA
  3  -1   2       bld Ga11                            IMAGE:3475098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTGGAGCTAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAA
  5   1   2       bld Emb4                            IMAGE:5543442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGCCCACGCGTCCGGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATTGAGTTTAGAGTAAAAGAATCCCAGTATTATTTCTCCTGTCATTGGCTTGAGGATGTTTGACACTTCTTCCGAGAAAGAAAAAGAGGAACCCCCGGGCCTTTGGGCAACACCCCTGCAGGAAAAATACACCTGGAAAAAAGAATGGTTCTTTCAAACCATGTTTTACAATTTACCCAGCCCGTGTGAATTACCCCCCGGCCAACCCCTGGGAACAACTTCATGCCCCCTGTGGTCAAAACCCCCAAAAACTTTTTTGGGAA
  5   1   2       bld Ga15      in                       XL412k03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACAGCAACTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAAATACAACTGAAAAAAAGATGGTTCTTC
  5  -1   2       bld Bla2                            IMAGE:7298087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAAATACAGGATTACAGACAGCACTTCAGGGCATTCACAGAGTGCACCCAAATATGATGGCCAAAGCAAATCTGTACAAGAGAGCAGAGTCTCACTCATCCATACCCTGTTTTTAGGCGAGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGTCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGTTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTCAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTAAGATGTGGTTTAAAA
  5   1   2       bld Ga15      in                       XL477k16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAATCTGTACAACGAGAGCAGAGTCTTCACTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCCAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAA
  5   1   2       bld Tbd7      in                         XL079a14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGAC
  5   1   2       bld DMZ       in                         xl237e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTG
  5   1   2       bld Thy                             IMAGE:8547407.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCGATGTTTTAGTATGATTGTTTTTTGCACCCGTTTCATGCCACTCCTAATACTTACAAAAGGAAGAACAATGAAGCGGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTG
  5   1   2       bld Ooc2                            IMAGE:3745987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAAGTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAAGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGGCTTTGGCCGCACCCTGGAGGAAAATACAACTGAAAAAAGATGGTTCTTTCAACCCATGTTAC
  5   1   2       bld Em10                            IMAGE:8319775.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAAATAATAAAGACACCACCAAAGCGACCCAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACAGCAGCAGACCAAGCACCCCAACTGTAAATGTGTTAGAAGCCAAGGACACGGATAGCGACCGAGAAGCTGGAACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCGACAGCTCCTCTGAAGCAAACTCCCGTTGCCAAACACCAATAAAAATGAAGCCAAATATTGAGCCACCTGAAAATGTGGAATGGAGTGGAGCAGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATCAGTACCAAGACATGCCGGCAAGTCTATGAGTTCAGAGTAAAGGAATCCAGTATTATCGCTCCTGTTATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATTCAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGACTGCCAAACAGGGTCCCTGGATGCCGCTGTAAGCACAGTGCAATACAAGCAGTGCCTTGCTCCCTGCTGTACGGAGTGTGACCAAACTGTGCTGACTGTG
  5   1   2       bld Brn3                            IMAGE:8539485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGTTTGCTGCAGCTTTGACAGCAGAAAGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGGCCAAGCACACCAACTGTAAATGTGTCAGAAGCCAAGGACACGGATAGCGACAGAGAAGCTGGCACGGAAACTGGCGGGGAAAGCAATGATAAGGAGGAGGAAGAGAAAAAAGATGAGACCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTCAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCAGGATGCCGCTGTAAGCACAGTGCAATACCAGCAGTGCCTTGCTACTGGCTGTACGGAGTGTGACCAGACTGTGCTGACTGTGGGCTGCTGATACTGGACATAGATGGTCTGCAGACTGACATCACGCGTT
  5   1   2       bld Int2                            IMAGE:8527289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATNNNNCCCATCTATNCNNNGAGGATCCNTCNATTGAATTCGTCCCCTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGA
  5   1   2       bld Tbd7                                 XL062d05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAATGATAAGGAGGAAGAAGAGTAAAAAAGATGAGACCGACAGCTCCTCTGAAGCAAACTCCCGTTGCCAAACACCAATAAAAATGAAGCCAAATATTGAGCCACCTGAAAATGTGGAATGGAGTGGAGCAGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATCAGTACCAAGACATGCCGGCAAGTCTATGAGTTCAGAGTAAAGGAATCCAGTATTATCGCTCCTGTTATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATTCAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGACTGCCAAAACAGGTTCCCTGGATGCCCGCTGTAAAGCACAGTGCAATACAAAAGCAGTGCCCTTGCTACCTGGCTG
  5   1   2       bld Int2                            IMAGE:8527314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCAGCTCTTCTGAAGCAAACTCCCGCTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGNGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTG
  5   1   2       bld Bone      in                    IMAGE:8739679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGTTGCCAAACACCAATAAAAATGAAGCCAAATATTGAGCCACCTGAAAATGTGGAATGGAGTGGAGCAGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATCAGTACCAAGACATGCCGGCAAGTCTATGAGTTCAGAGTAAAGGAATCCAGTATTATCGCTCCTGTTATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATTCAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGACTGCCAAAACAGGTTCCCTGGATGCCGCTGTAAAGCACAGTGCAATACAAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCCGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGCTCCAAGAAGCATTTGCTATTGGCTCCTTCTGATGTTGCTGGCTGGGGGATATATATCAAGATCCTGTACAGAAAACGAGTTCATCTCGGATACTGTGGAGAGATCATATTCCAGATGAGCTGATCGAGAGGGAGGTGTATGATAAATATATGTGGTAGCTCCTCTCCACTGACCATTGATTTTGTAGTGAATGCCAACGGATGCACGATCGAATGGCAACATTCTCTGGATCCACTGTCTATGCCAAAGATGAAGGTTATG
  5   1   2       bld Ga15      in                       XL447c11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCTGAGGCCTCCCTATTTCGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAA
  5   1   2       bld Ga18      in                      xlk158a05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTNCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGNGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGANTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGANTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGANCATAGAATAGGGANTTTTNNGAAGAGAGNCATTCAGACGGGNNAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATNNNCTGAAANATGTGGNNTTGAGAGAGAANGGAAATCCCCTGATNCTAGCTACCTCCTTATGAAANCCAT
  3  -1   2       bld Bla2      in                    IMAGE:7297213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGATTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTCAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCAGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAACGTGTCCCTGCAGAACTGCAGCATTCAGCGCGGTTCCAGAAGCATTNGCTTTGGCTCCTCTGATGTGCTGGCTGGGGATCTTATCACGACCTGTACAGAAACGAGTCATCTCGATACTGTGAAGATCTTCCCAGAGAGCTGACGAGAGGAAGTGATGATATACTGTGACTCTCTCACTGACATGATTGTGTAAGCACCGAAAGACAATC
  5   1   2       bld Neu7      in                         XL005p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTGCAATTGCAAGATTGATTGGTACCAAGNACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGA
  3   1   2       bld Ga18 5g3  in                      xlk145m01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ANNCATNCNGNAAGTCTATNNNTNNNNNTAAAGGAATCNANTNNNNNNNCCTGTCATTGCTGAGGATGNTNACACNCNNCCGAGAAAGAAAAAGNGNAAACACAGGCTTTGGGCANNACACTGCAGGNAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTNANAATTNCCAGCNGTGTGATCACCCCCGCNAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAANCCGNTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGNAGTGNCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTNCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACANCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTNCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTA
  3   1   2       bld Ga18      in                      xlk158a05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGCNGGCAAGTCTATGANTTTAGANTAANNGAATCCAGTANTNNNCNCCTGTCATTGCTGAGGATNNTNACNCNCNNCGAGAAAGAAAAAGNGNAAACACAGGCTTTGGNCAGCACACTGCAGGAAAATNCAACTGAAAAAAGATGGTTCTTCAAACCATGTTTANAATTNCCAGCCGTGTGATNNNCCCCNCCAGCCCTGTGACANNTCATGNCCCTGTGTCATANCCCAGNACTTTTGTGAGAAGTTCTNNCAGTGCAGCTCTGAATGCCAAANCCGNTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACANCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATNCCCNNC
  3   1   2       chi Ga18      in                      xlk133d13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATGCNGNANTCTATGANTTAGANNNAAGGAATCCANNATNTTNCTCCTGTCNTNCTGAGGANNTNANACTCCTCCNNNNAAGAAAAAGAGGAAACNCAGGCTTTGGGCAGCACACTGCANNAAAATNCANCTGAAAAAAGATGGTTCTTCAAACCATGTTNACANTTNCCAGNNGTGTGATCNNCCCCNCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTNNCAGTGCAGCTCTGAATGCCAAANCCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCANCGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTNCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTNCCAGTTGCAATGTATTTTGTNCCTAGGAACGTTTGGCAATAATGTTATTCAGGT
  5   1   2       bld Tad2                            IMAGE:6932381.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTTCTCCTGTCATTGCTGAGGATGTTGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGGTCCCAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCCCTGAGTACTGTGGGAGAGATCATATCCCAGGGATGAAACCGATTCGAAGAGGGGAAAGTGTATTGATAAAATACATGGGGTAAGCTTTCCTCCTTCAACTTGAAACAAATGAATTTTTGTGGGTAGAATGCCAACCCGGAAAAAAGGCCAACAAAAATCCGGATTTTGCAAACCCATTTCCGGTTGAATCCCCAA
  5   1   2       bld Ga15      in                       XL508b23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGGCTTTGGGCAGCACACTGCAGGAAAATACAACTGAAAAAAGATGGTTCTTCAAACCATGTTTACAATTACCAGCCGTGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCANACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGANA
  3   1   2       chi Tad2      in                    IMAGE:6875136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCCCCCGGGGGGGGCCACCAAGTGTCTTTTTATGTGAAAAATTTGCCCCCCAAAAAAACAACCGCGGGTTTTTTTTTTCCTGTGTTGACATTGCCTCGTGCCTCGGATTAATTGGGCCCTCACAGTCTCCCCAAATTATTCCCCAGGGGCCAAGGTGCCCCCCTGTTGGTTTAATCCCTCGGGCTTTGTTAACCGGGGGAAGGTTGATGAACTCCCAGGAGCCCCTGGTGGCTTTTGAACCTTGTGTGGGGCGATTTGCTTGAAATCCCCCTTGGGGAGCCGGTTAAGGCAATTGGTGTCCTCTGCCAAAGAAATTTTGCTAGCATTTTCAGGCCGCGGGTTCCCAAGAAAGGCATTTGGCTTTTTGGCTCCTTTACTGACGTTGGCTGGCTTGGGGGATTCTTCCATCAACGACCACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATGTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACATAGGAGCAATTGGCACTTTTTTCCCCCTTTTTTGGAATATGTTTGGGCCTCGGGCGGCGCGGGGGGAGGTGGGGCGAGCCTGGCGCGCCGGGGGCCnnCnCCGCGCCCCCCA
  5   1   2       bld Gas6      in                    IMAGE:3438267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGCCAGTGCAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTGTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTATGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAA
  3   1   2       add Bone      in                    IMAGE:8739679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTACCAATTACCAGCCATTGATCACCCCCGCCAGGCCTTGACAGGTCATGGCGTGTCCTAGCAGACTTTGAGAGTCGTCAGTGCAGCTCGACTGCAAACAGTCTGATGCCGCTGTAAAGCACAGTGCATACAAAGCAGTGCCTGCTACCTGGCTGTACGGGAGTGTGACCAGACTGTGCTGACTTGTGGGGCTGCCGATCACTGGGACAGTAAGAATGTATCTGCAAGAACTGCAGCATTCAGCGCGGCTCCAAGAAGCATTTGCTATTGGCTCATTCTGATGTTGCTGGCTGGGGGATATATATCAAAGATCCTGTACAGAAAAACGAGTTCATCTCGGAATACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAGGTGTATGATAAATATATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACACGGAAAGGCAACAAGATCCGATTTGCAAACCATTCTCTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAATGGAGACCATAGAATAGGCATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCCCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTGTGAACCCCATGCCTTACCTTCTTCAGGAATTTCTTATGCGCAACTTTAGATACAAAGATGGGAAGAAAATTCAAGCTGAAGTTACAGAGTACTGTAACCTTTAATTTATAGTGATCTGACCACAATGCAAGTCTTTCCTTTGCCGGTTGTAATTGTCTTTTGTACAATGATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATATTCTGTACTATTCATTTGTCAGGCCAACCAC
  3   1   2       bld Ga18                              rxlk55n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANGNCCNNNNNTCNNNAGCCNNNANTTTTNNNNNANTNTGCNAGTGCAGCNCTGAATGCNAANCCGNTTTCCNGGATGCCGCTGTAAAGCACAGTGNAATNCCAANNAGNNNCCTTNCTACCTGGCTGTACGGGAGTGTGACCCAGNNCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGNAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTNCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACANCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGNACNNNCNCNNNNCAAAA
  5   1   2       bld Tad2      in                    IMAGE:6875136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTCTGAATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGGAAAAAAATGTGGGAAAGCTGAAGTTTCTGAGGTTACCGAGTACTGGTAACCAGTAATTTTATAAGTGAATCTGACCATTAAACGCCAACGAACTTTTCCTTTTGCCCC
  3   1   2       bld DMZ       in                         xl227a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGNATGCCAAAACCGGTTTCCTGGATGCCGCTGTAAAGCACAGTGCAATACCNAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTGGCAATAATGTAT
  3   1   2       bld DMZ  5g3  in                         xl224n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTCCTGGATGCCGCTGTAAGCACAGTGCAATACCNAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTGGCAATAAT
  3   1   2       add DMZ                                 rxl253m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTGGATGCCGCTGTAAAGCACAGTGCAATACAAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCCGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGCTCCAAGAAGCATTTGCTATTGGCTCCTTCTGATGTTGCTGGCTGGGGGATATATATCAAAGATCCTGTACAGAAAAACGAGTTCATCTCGGAATACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAGGTGTATGATAAATATATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACACGGAAAGGCAACAAGATCCGATTTGCAAACCATTCTCTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAATGGAGACCATAGAATAGGCATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCCCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTGTGAACCCCATGCCTTACCTTCTTCAGGAATTTCTTATGCGCAACTTTAGATACAAAGATGGGAAGAAAATTCAAGCTGAAGTTACAGAGTACTGTAACCTTTAATTTATAGTGATCTGACCACAATGCAAGTCTTTCCTTTGCCGGTTGTAATTGTCTTTTGTACAATGAT
  5  -1   2       bld Bla2                            IMAGE:7299211.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCTCCGTTCTCCGCCGTAGaaaaaaaaaaaCATATTCTACGTCCCCGATCGTACATGGATGCGCATNCAACGTCGACGTACCAGCATCACGCCTTACGNTAGAGTGACAACTTGTGATGTGCTGTACATGACAGTAGATTTCTGCAGACTCAGCATCAGGCGTCCAGAGCATTGCTTTGCTCTTCTGAGTGCGGTGGGGGATTTCATCAAGACACTGTACAGAAAACGATTCATCTTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTAAACAAGAAAAAGAAGaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGTACCCAATCGCCTAAGAGCGT
  5  -1   2       bld Thy       out                   IMAGE:8549215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATCCGACCCCACTGACCCCGGNACCCNNNNNATNNNNNGAGAACNCCNTNNNNCNNNNGCCGGCATCAGCGGCCTGTACTGCTCGGGATGCCAGACTGCTGATTGTGGTGCGATCACGGACGTAGAAGTGTCTCAAGAATGCAGCATCAGCGGGTCCAAAAGCATTGCTTTTGCTCCTCTGAGTTGCTGCTGGGGATCTCATCAACGACACTGTACAAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCAACGTCAAATAAAATATACTGAACTTCaaaaaaaa
  3   1   2      seed Ga12 5g3  in                         XL215f24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTGCAATACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATA
  3   1   2       bld Ga15      in                       XL412k03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGCAGTGCCCTTNCTACCTGGCTGTACGGGAGTGTGACCCCAGACCCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACT
  3   1   2       bld DMZ       in                         xl323d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGT
  3   1   2       bld DMZ       in                         xl255d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTAT
  3   1   2       bld DMZ       in                         xl237e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGTACGGGAGTGTGACCCAGACCTGTGCTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTGGCAATAATGTAT
  5   1   2       bld Ga12      in                         XL217e01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGACTTGTGGGGCTGCTGATCACTGGGACAGTAAGAATGTGTCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGNGNACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCNACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAAC
  5  -1   2       bld Bla2      in                    IMAGE:7297213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGGATTGACAGACTGTCTACTGTGGCTTGACATGACAGTAGACGTTCTGCAGACTGAGCATCAGGCGTTCCAAGAGCATTGTTTTGCTCCTCTGATGTGCTGGTGGGGGACTTTATCAAGACACTGTCAGAAAAACGAGTTCATCTCCGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGAAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGaaaaaaataaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATGCCCATGATGCGT
  3   1   2       bld Ga15      in                       XL508b23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCANTGGGACAGTAAGAATGTGTCCTTGCAAGAACTGCAGCATTCAGCGNGGGTTCCAAGAAGCATTTGCTTNTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTNTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATNGAAGAGGGAAAGTGTATGATNAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGG
  5   1   2       bld Tbd5                            IMAGE:3579580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTNTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTG
  5   1   2       bld Ga15                               XL472k13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTTTTGGCTCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTaaaaaaaaaa
  5   1   2       bld Sp1       in                    IMAGE:4965624.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGCGTCCGCGGACTCGTGGGTTGCGTTTTGGCTCCTTTTGATGCTGCTGGCTGGGGGATCTTCATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGA
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3199921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCGGTTCCCGCAGCCATGGCTTTCTGGCTCCTCTCGATGTTGCGGCTGGGGCATCTTTATCTCTCGACACTGTACAGAAAACGAAGTTCAACTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGACAGTGTATGATACATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACTCCAAAAGGCCCCAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGTTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTT
  3   1   2       bld Emb9                            IMAGE:7975814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNANGGATATAATTGCATTNCTGGAAGGGGATNNTTCNTCNNCCACCCATTACAGAAAAAATAGTTCATCTCTGAGTAGTGTGGAGAGATCATATCCCAGGATGAAGATGATCGAAGAGGGAAAGTGTATGATAAATACACGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCTACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATATGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCTTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTCTCAGTTGCAATGTATTTTGTACCTACGTCTG
  3   1   2       bld Neu7      in                         XL005p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTTCTGATGTTGCTGGCTGGGGGATCTTCATCAACGACCACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATA
  3   1   2       bld Ga15 5g3  in                       XL433d07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCTGGGGGATCTTCATCANCGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCT
  5  -1   2       bld Em10                            IMAGE:8318454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCTTCATCAACGACACTGTACAGAAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTTTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTTTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAACTTTAGATATTAAATAGATATGaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL217e01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCAACGACACTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAACTT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAAG
  3   1   2       bld Ga15 5g3  in                       XL519m16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGAANAGGCGAGTTCATCTNCTGAGTGCTGTGGAGAGATCATATCCCNGGATGAAGCTGATNGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATNNTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAA
  3   1   2       chi Gas8                            IMAGE:3516253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACAGAAAAAGAAGAACATCTCACAGAACTGTGAGGAATTCATATCCCATGATTAACTTGAACATATAGGGACAGCGTATGATCAATACATGTGTAGCTTCTTCTTCAACTTGGGCAATGATTTTGTGGTAGATGCAACACGAAAAGGCATCAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTNTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas6      in                    IMAGE:3473410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGTCGCCGGCGCTGGGTCAGTccgcgggggctaggccgcgacgagtaggagggccgccgcggtgggcgcggaagccccgggcgagggcccgggtggagccgccgcgggtgcagatcttggtggtagatgcaaCACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCA
  5   1   2       bld Gas6      in                    IMAGE:3473411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGTTGCCGGCGCTGGGTCAGTccgcgggggctaggccgcgacgagtaggagggccgccgcggtgggcgcggaagccccgggcgagggcccgggtggagccgccgcgggtgcagatcttggtggtagatgcaaCACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTNTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCA
  3   1   2       bld Gas6      in                    IMAGE:3438267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACCAGTTCATCTCTGAGTTCTGTGGAGAGATCATATCCCAGGATGAAGCTGTCGGAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAA
  3   1   2       bld Ga15      in                       XL477k16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGGGAAAGTGTANGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAA
  3   1   2       bld Sp1       in                    IMAGE:4965624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGAAGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAAGGTAAATAAACTTCTGT
  3   1   2       bld Sp1  5g3  in                    IMAGE:4964674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTGATCGAAGAGGGAAAGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAA
  3   1   2       bld Gas6      in                    IMAGE:3473411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCCCGGGCGAGGGCCCGGGTGGAGCCGCCGCGGGTGCAGATCTTGGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACAAA
  3   1   2       bld Gas6      in                    IMAGE:3473410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGGCGAGGGCCCGGGTGGAGCCGCCGCGGGTGCAGATCTTGGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACAAA
  3   1   2       bld Ga12      out                        XL195d02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNATCCCCnCCCCCCCCCTTTTTTTTTTAAAGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAA
  3   1   2       bld Emb4      in                    IMAGE:4959944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACACGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAACTTTAGATATTAAATAGATATG
  5   1   2       bld Ga15      in                       XL436l10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL436l10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATG
  5   1   2       bld Ga15      in                       XL405e07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAACTTTAGATATTAAATAGATATGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL405e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACT
  3   1   2       bld Ga18      in                      xlk131o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACANCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTANNNNCNCNNCTCA
  5   1   2       bld Ga18      in                      xlk131o14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGTGAATCCAAACTGCTNTNNNNAGTAATGATGGTTAACGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGNTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCNATGTATTTTGTACCTAGGAACGNTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCaaaaacaaaaanaaaaaaaaaa
  3   1   2       bld Tbd7      in                         XL079a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTATGCAAAAGTAATGATGGTTAACGGANACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAGACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATA
  3   1   2       bld Ga15      in                       XL447c11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GNCCATAGAATAGGGATTTGTGCGAAGAGANCCANTCAGNCGGGTGAAGAACTCTTCTTNGATTACAGATACAGCCAAGCAGATGCGCTGAAATATGTGGGTATNGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTAGGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCNGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAA
  5   1   2       bld Ga18                               xlk71p21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAATCCCCTGATTCTAGCTACCTCCTTATGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACTCGCAATTTTAGATACAAAGAGGGGAAGAAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAACTTTAGATATTAAATAGATATGNANNNNaaaaaaaa
  5   1   2       bld Ga15      in                       XL445p23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTTCATTTGTCAGGCTACAACTTTAGATATTAAATAGATATGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL445p23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAATGTGGGAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGT
  3   1   2       bld Tbd7                                 XL065b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACCGAGTACTGTAACAGTAATTTATAGTGATCTGACCATAACGCAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTGTACTTTCATTTGTCAGGCTACAACTTTAGNATATTAAATAGNATANAAAAAAAC
  5   1   2       bld Ga15                               XL515d13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACGACTTTCCTTTGCCAGTTGCAATGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCaaaaaaaaaa

In case of problems mail me! (