Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012767666 Xl3.1-IMAGE:4031283-IMAGp.5 - 205 ESTs
                                                                       .....-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4031283-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCGTTCCGTGCCGACGTAGCACGTTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGGAGCCGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAATAAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCGGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAGCACAAACCCAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685176                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGTGCCGACGTAGCACGTTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAxxCTGGGAGCCGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGGAAATAAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                           4     4     7     7     7     7     8    11    11    13    15    20    24    31    44    59    56    61    61    66    63    68    64    72    64    80    39    80    75    81    75    81    76    82    76    82    77    83    78    84    79    85    79    85    78    85    80    85    84    85    82    85    83    87    85    87    87    88    85    86    87    87    85    87    86    86    88    88    89    89    88    89    90    91    89    90    86    89    84    89    86    88    85    87    85    86    83    87    83    88    82    88    85    89    87    89    87    91    86    90    83    87    85    88    82    86    78    85    77    84    75    82    75    80    72    79    68    80    69    82    68    78    61    77    54    75    55    74    49    72    42    69    41    68    40    65    37    60    36    60    36    57    29    53    34    54    34    54    34    52    33    49    32    48    32    46    30    45    32    43    32    43    31    42    26    40    31    37    32    37    32    37    30    35    30    35    30    35    30    34    28    35    28    37    28    37    30    39    27    38    26    37    30    38    29    39    25    41    36    46    36    46    35    49    37    50    43    54    43    55    43    56    43    61    45    61    49    65    50    66    54    72    59    74    59    74    61    74    61    74    61    74    64    73    62    74    64    73    55    73    65    76    65    77    66    77    67    79    69    80    66    81    70    84    71    86    69    86    76    88    74    87    74    84    73    83    71    82    70    83    70    82    73    82    71    80    70    80    73    80    70    80    73    78    71    78    69    77    69    76    63    73    66    73    62    73    34    70    33    68    32    68    31    66    31    65    31    65    31    64    31    64    31    61    31    60    30    60    30    60    30    60    28    58    29    58    21    49    18    40    17    35    12    28     8    18     4     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATGACCGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTATGGCACTGAAATGTACAAGCTGAACTTCTGTCTTTGTACATAATTAAAAATGTTGCTCTTCAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------GG-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---T---G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---G----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T--C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------GC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C---A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A---------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G-T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A--------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T-G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----G-----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T-----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------GA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T----A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----A-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------A-T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------T-----
                                               BLH ATG     158    2131                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     158     373                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     158      94                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               CDS MIN     158      38                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI      68      38                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     158      10                                                                                                                                                                                                                                                                                                                                                                                                                      
  5   1   2       bld Te2N 5g                         IMAGE:7204965.5p TGACCGGCTGGCTTGGCTGGGGCACCCGGCTTAACACCGGCTCTCAGCATTGCCCACAAGCAATTCAATGAAATTGCCCACTGGGATTTTGCCATTAAAAACATCAGTCTTCAGAATTGAGCTGCGTTTATTGATATAGATCACGTTCTGTGTTTTTCTCAGGCTAAATGTAAAGTAATAAGGGTTACACGTCCCATGTCGGTGTAAGATAAAAGACAAGCTATCTAGCAGAAATAATGCAGCTATTACATATCCAATGTAACTCCAATCCCTTATTGCCCGGGTTGCACTACCGCCACTTCCCTTCGGCAGTTTGAACGCTGTCACAGAAATCACGCGAGATTTCGAATGTGTTGACCAATAAATTTGCAGGAGCAGGTGGTTGAGCCAATTAGGTTCTTTGTTGGGCGTTCCGTGCCGACGTAGCACGTTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACCATCAGCTTACCAAAGATGGCAATGTCTTGCTTCAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7981461.5p                                                                                                                                                                                                                                                                                                                      CGCGGTCACAGAAATTACGCGAGAGTTCGACGGCGATGAACATGTTGACCAATAAAATTGCAGGAGCGGGTGATTGAGCCAATTAGGCGCTTTGCTGGGCGTTCCGTGCAGACAGAGCACGTTAGATTGTTCTAGAATACCGGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073631.5p                                                                                                                                                                                                                                                                                                                                                                    ccacgcgtccgcccacgcgtccgcccacgcgtccgcggacgcgtgggGTTGGGCGTTCCGTGCCGACGTAGCACGTTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAAATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGA
  5   1   2       bld DMZ  5g3  in                         xl309c14.5p                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGGGCGTTCCGTGCCGACGTAGCACGTTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTATTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCA
  5   1   2       bld Kid  5g                         IMAGE:4031283.5p                                                                                                                                                                                                                                                                                                                                                                                                                       GGCGTTCCGTGCAGACAGAGCACGTTAGATGGTTCTAAAATACCGGCCCCTTTTCTTCTCAGGAGCGGCGTGGGGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGANCACCAAATGAACCTATAGATTTGTACTTGGGTTGAAGTTATGGGAGATGAAACCCCAAAACGGATAGGTGATACCTACGCCTGAATAAGAAGAACTTTGTCTTAAAATCATGGGAGCCTCGTCCATCCAAAACTTGAAAGAAAGCGAAGTTGGAAGAAGCCTTTTTATCCCTCCCCTTGCAAAGGGGGGCCTCTCGGGGAATTATGTaaaaaaaaCCGAAAAGGGTAATTTCTG
  5   1   2       bld Kid  5g                IMAGE:4031283-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                       GGCGTTCCGTGCAGACAGAGCACGTTAGATTGTTCTAGAATACCGGCCCCTTTTCTTCTCAGGAGCGGCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGGTTCTTTTACAAAAGTGCAGATGAACGCGAA
  5   1   2       bld Ov1  5g                         IMAGE:8330216.5p                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGTGCCGACGTAGCACGTTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAAGTATGGAGATGAAANCAAAACAGAAAGTT
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACACCAAATGAACCTATAGATTGTACATGGTTGAAGTATGGAGATGAACACAAACAGAAGTGATCTCGCTGATAGAGGCTTGTTTAATCATGAGTCGTCTCAGACTGAGAACGTGTGAGAGCTTATCTCATGCA
  5   1   2       bld Te2N 5g                         IMAGE:7764261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAGATTGTTCTGGAATTCCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACACCAAATGACCTATAGATTGTACTGGTTGAAGTATGAGATGAACACAAACAGAAGTGATCTACGCTGATAGAGGCTTGGTAGATCATGAGTCGTCTCAGACTGAGAGCGTGTGAGAGCTTT
  5   1   2       bld Int2 5g3  in                    IMAGE:8823177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCCCATGCTATACAAAATTACATGCTTATAACGAATTCGTCCCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAGATGCTTTTATCTCACTTGCATGTGTCTCTGGAATATGAAAAACAGAGTGATTCTGGGTTCTTTTACAAGTGCAGATGACGCGAAAAACTGCTAAAGCGAAGACGTTTATTGAAGAGAGGGTAATACATCTAGCTGACAAGTGTGTGCGTACTGCAAGGTTTTCACATAT
  5   1   2       bld Ov1  5g                         IMAGE:8330612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTGGAATTCAGCCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAATGTTTTGAAGCATCAAAGGCCAAAACACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACACTAATTAATGTGGCAAGGACTTCAATTCACAACCAAGTTCATGCTGGGTTAGCAAACATTTTAACCGAAACTGTTGTGGACTC
  5   1   2       bld Emb1 5g                         IMAGE:6631013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGCCCTTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCCTAATTAATGTGGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCCGAAACTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGGAGATGAAACCCCAAACCGAAAGTGATACTAACGCTGATAAGAGGGCCTGGTTTTAGAATCATGGAGGTCCGCTCATCCCGAACATGAAAAAAACGGGGTTGAAGAAGGCTTTTTATCCTCCCCCTGCAAAGGGGTCCCCTGGAAATATGGAAAAAAACGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4203102.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGCGTCCGGTTCTAGATCGCGAGCGGCGTGGTGGGTAAAGCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGGTGTGAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGG
  5   1   2       bld Panc 5g                         IMAGE:8737351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTCTTCTCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAAGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTAGCAGACATTTTAACCGGAGGCTGTTGGTGGACTTTTGGTTTTGCTATTCGACACAAATGACTATAGATTTGTACTGCTGAGTTATGGGATGACCGACGAGTGTACTTACGCTGATGAAGGCTTGTTAATCATGAAGGTCTCTATCCCAACTGAGAACGGTAGGCCTTATGCTACTGCAATGTCTGATGGAAACCAAGTGATCTCGG
  5   1   2       bld Brn1 5g3  in                    IMAGE:6950987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCCGGAATTCTCGGGATGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGGAAGAAACGTGTTGAAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGGTCNTTTTACAAAAGTGCAGATGAACGTGAAAAAGCTGGGTAAAGCGGaaaaaaaaC
  5   1   2       bld Emb4 5g                         IMAGE:5570586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGGTATGGAGATGAAACACAANACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAAAAAGCGAGTTGAAAGATGCTTTTTATCCCCCACTTTGCAAATGTGTCCTCTTGGAATATGGAAAAAAACAGCAAGGGG
  5   1   2       bld FaBN      in                    IMAGE:8075749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAAATGCTTTTATCCTCACTG
  5   1   2       bld Tail 5g                         IMAGE:8545264.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGGGAGCGGCGTGGTGGGTAAAGCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTG
  5   1   2       bld Emb4      in                    IMAGE:4959401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGGAGTGGCGCGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCATTCTTGTTCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAAGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCCCACC
  5   1   2       bld Emb4      in                    IMAGE:4959428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGGAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCANGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAAGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAG
  5   1   2       bld Kid  5g                         IMAGE:7012115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCGGCGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACANAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTAGATCATGGNAGTCGTCATCAGACATGAAGAGCGTGN
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCT
  5   1   2       bld Ga15 5g3  in                       XL443e05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTANATCATGGAAGCTCGTCATCC
  5   1   2       bld Ga15 5g                            XL470j23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTANATCATGGAGCTCGTCATCCAGACATGAA
  5   1   2      seed Em10 5g                         IMAGE:8318892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGA
  5   1   2       bld Sp1  5g                         IMAGE:4964060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTGGTGGGGTATATTCGGTAACGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACTATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAACATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAACAAATGGACAGGGAGACCCTAATAAAT
  5   1   2       bld Te2  5g                         IMAGE:7210744.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGTGGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAAC
  5   1   2       bld Sp1  5g                         IMAGE:5506554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGGTGGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTGTTTTAGATCATGGAGGTCGTCATCCAGACAG
  5   1   2       bld Ov1  5g                         IMAGE:6316314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGTGGGGAAATCTGGTAGCGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAAAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAAATCATGGAGGTCGTCATCCAGACATGAAAAAACGGGGTTGAAAATGCTTTTATCCTCACCTGCAATGGGGCTCTGGGATATGAAACAAACCGAAGGGAATTCTGGGGA
  5   1   2       bld Thy  5g                         IMAGE:8548655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGTGGGTAAAGCTGGTAGAGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTACCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAACGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAACAGAAAGTGATACTACGCTGATAAGAGGCTGTTTTAGATCATGAGTCGTCATCAGACTGAAGAGCGTGTGAGATGCTTTATCTCACTGCATGGTCTCTGATAGAA
  5   1   2       bld Em10 5g                         IMAGE:8321974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAACAGATAGTGATACTACGCTGAATAGAGGACTTGTCTAAGATCATGGA
  5   1   2       bld Lu1  5g3  in                    IMAGE:4057266.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGTAAAGCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAACTACTTCAGAAGGGGGCACACTTCATC
  5   1   2       bld Sp1  5g                         IMAGE:5513273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAAGTATGGAGATGAACACAAAACAGATAGTGATACTACGCTGATAAGAAGACTTTGTCTAGATCATGGAGCTCGTCATCAGACATGAAGAGCGAGTTGAGATGCTTTATCTCACTG
  5   1   2       bld DMZ  5g3  in                         xl263h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTG
  5   1   2       bld DMZ  5g3  in                         xl249b24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTG
  5   1   2       bld Egg1 5g                         IMAGE:3301001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACGAGGTCTGGTAGCGGCTACCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCAGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTGTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTAGGTTAGCAGACATTGTAACCGAAGCTGTTGTGGACTC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGTAAAGCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCCTATTGATTGCT
  5   1   2       bld He1  5g3  in                    IMAGE:4409033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCANAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGAT
  5   1   2       bld Emb4 5g                         IMAGE:5537227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGGTGTGGACTCTGTTTTGGCTATTCCACAACCAAATGGAACCTATAGATTTGTACATGGGTGAAAGTTATGGAGATGAAACCCAAAACCGATAGTGATACTACGCTGATAAAAAAGAACTTGGCTTAAATCCTTGAAGCTCGTCCATCCAGACCTGAAGAAAGCCAATTGAAAAATGCTTTTATTCCTCCCCTGGCCAAGGGGTCTCTTGGATTATTGAAAAAACCCGAAGGGGAATTTCCGGGGGTCCTTTTTTAACAAAAGGGGCCAAAGTAACCCCCaaaaaaatgcggtttaaaagcgaaaggaaaaaccctttttttgaaaaaaaagggggcaaataaaaaaaCCTTTAGCGCCCCGCGT
  5   1   2       bld Emb4 5g                         IMAGE:5543671.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAAATTTGTACATGGTTGAAGTTATGGAGATGAAACCCAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTACATCATGGAGCTCGTCCTCCAGACATGAAGAAAGCGAGTTGGAAATGCTTTTTAGCCTCACTTTGCATGTGGTCTCCGGAATATGAAAAAACAGAAATGGAATTCTGGGTTCTTTTACCAAAGTGCAGAAGGAAACGCAAAAAACGGGTTAAAACCAAAAGAACCTTTTATTGAAAAAGAAGGGAAATA
  5   1   2       bld Emb1 5g                         IMAGE:6633509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGANACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATAANAAAACGGAAGTGAATTCTGGGTTCTTTTTACAAAAGC
  5   1   2       bld Spl  5g                         IMAGE:8461474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAANTGAACTATAGATTGTACATGTTGAAGTTATGAGATGAACACAAACAGAAGTGATCTCGCTGATAGAGGCTGNTTAATCATGAGTCTCTCAACTGAGAGCTGTGAGAGCTTATCTCCTGCATGGCCTGATTGAAACGATGATCTGTCTTCAATGCATACTGACTGTACGAAAGTATGAAGATATCACTACAAGTGACGAGTTGA
  5   1   2       bld Ga18 5g3  in                       xlk75p14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGTGGGGANNNTNGGAGCNNNTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGNNNNGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTANNNNNCCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGNAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTTGGCTATNCGACAACCAAATGAACCTATAGATTTGTACATNGGTTGAAGTTATNGGAGATGAAACACAAAACAGATAGNGATACTACGCTGAT
  5   1   2       bld DMZ  5g3  in                         xl321e18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAAATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGA
  5   1   2       bld DMZ       out                        xl233f23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGA
  5   1   2       bld Gas6 5g3  in                    IMAGE:3474020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTAAAGCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGGACCCACATCAATTGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACT
  5   1   2       bld Ov1  5g                         IMAGE:8331536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTG
  5   1   2       bld Emb4 5g                         IMAGE:4684059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGGATATGNAAAAAACGAAGTGGATTCTGGGGTCNTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGGTTAAAGCAGAGAGAACGTTTAATTTGAAGAAAGGGGGAAATAAAATCATAGCCCTGGAAGCACAAAGTGGGGG
  5   1   2       bld Ga15 5g                            XL405l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAAAGCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGGAGGTCGTCATCCANACA
  5   1   2       bld Tail 5g                         IMAGE:8544748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAA
  3   1   2       chi Ga18      in                      xlk144f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAAGGCTGGGAGCNGCTAGCTGATTCATTNTCTGAGTTNCTTNGGATTCNTTTCCCGGGCCTTACTCTACCNTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGNCTCGANNCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGNCCANCCTCNNNCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACANCCNNNCTGATCGCTAAAGTANCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACAATAACCCCCGGCGTCCTTATTACTGAAGGTTCAGTNCAAGCTGCCTCTTAATGAACTGTGATCTCTGCAAAAATCTCACCACCTTCCTGTTACTTATGATACTGGAAAAAGCACCTTTATGGCTCATAGTATGTAAGGACTCCTGTCTGCTGCCAACATTAGTTGGAACCCATAGCAAACACATGTNCCTTTTNCNTTCCTTCACAATTAGCNTNNCAGAAANNC
  5   1   2       bld Ga15 5g3  in                       XL477i14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGGATAAGAGGACTTGTCTTANATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGA
  5   1   2       bld Ga18 5g3  in                      xlk113l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAANCTGGTAGCGGCTANGTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCNNNNNNTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGNNCCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGNCAAAGCACTTGAAGNTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGANCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGANGCTGTTGTGGACTCTGTTTTGGCTATNCGACAACCAAATGAACCTATAGATTTGTACATGGNTGAAGTTATNGNAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGNGGNCTTGTTTAGNNCATGGAGNNCGNCATCCAGACATGANGAAGCGTGTTGANGATNNTTTNATCCNNNCTGCAANGTG
  5   1   2       bld Brn1 5g3  in                    IMAGE:4740274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATCTGGTAGCGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTA
  5   1   2       bld Emb4 5g                         IMAGE:5572841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGGTTGAAGTTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAAAAGGCTTGTTTTAAAATCATGGAGGTCGTCATCCAGACATGAAAGAGNCGTGNTTGAAAGATGCTTTTTATCCTCCACCTGCAATGGTGTCTCTTGGAAATATGaaaaaaaaCAGAAAGTGGAATTCCTGGGGGTCCTTTTTACAAAAAGTGGGCAGATGG
  5   1   2       bld Kid  5g                         IMAGE:7009883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGCTGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGAATAGAAGACTTGTCTTAGATCATGGAGCTCGTCATCAT
  5   1   2       chi Ga18      in                      xlk144f12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAAGNNTGGGNGNNNAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGNNNNNNNGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGNNNCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGNTGAAGNTATGGAGATGAAACACAAAACAGATAGTGATACTACAATAACCCCCGGCGTCCTTATTACTGAAGGTNCAGTGCAAGCTGCCTCTTAATGAACTGTGATCTCTGCAAAATCTCACCACCTTCCTGTTA
  5   1   2       bld Tbd7 5g3  in                         XL092a04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGGTAGAGGCTAGCTGATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTTGTTGTGGACTCTGTTT
  5   1   2       bld Kid  5g                         IMAGE:4030484.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGAGCCGCTAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTTTGGAGATGAAACCCAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAAATCATGGAGCTCGTCATCCAGACATGAAAAAGCGAGTTGAAGATGCTTTTTATCCTCACTTGCAATGTGTCTCTGGGATATGAAAAAAACAGAAGTG
  5   1   2       bld Sp1  5g                         IMAGE:4174870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGCTGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAACTGCTGAAACAAGCAGACCTTTACATCTCCCAAGGTCTTCCACCCCAA
  5   1   2       bld Tbd7 5g                              XL078n13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTGATTNTTGTCTGAGTTGCTTCGGCATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAA
  5   1   2       bld Neu7 5g                              XL011i11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGATTNTTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTAAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATG
  5   1   2       bld Emb1 5g                         IMAGE:6862663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAANGAAGCGAGTTGAAGATGCTTTTTATCCTCACTTGCAATGGTGTCTCTGGAATATGaaaaaaaaCAGAAGTGAAATTCTGGGGTNTCTTTTTACAAAAGTTGCAGGATGGAACGCGGAAAAAACTG
  5   1   2       bld Spl  5g3  in                    IMAGE:8463562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGATTCTTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAG
  5   1   2       bld Neu7 5g3  in                         XL042h19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTCATTGTCTGAGTTGCTTCGGATTCGTTTCCCGGGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTCATTGTCTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATT
  5   1   2       bld Emb1 5g                         IMAGE:5157277.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAATTACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATNGAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGGTGAAGATGCTTTTTATCTCACCCTGCATGTGTCTCTGGGATATGAAAAAACCAGAGTGAATTTCTGGGGTCCTTTTACAAAAGTGCAGATGAAACCGTGAAAAGCTGGGTTAAAGCCGGAGGAGAAAGGTTTATTTGAAGAAGAGGGGGTAATTAAAAAATCCATAAGCCCCTGGAAAACAGAAAAAGGGGGGTGGGGAA
  5   1   2       bld Neu7 5g3  in                         XL038f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACTTCGGATTCGGTTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCCAAGGTTCATGCCTGGGTTAGCAGACATTTTAACCGAAGCTTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAG
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402739.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGCGTCCGCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTA
  5   1   2       bld Emb4 5g                IMAGE:4959402-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCCGGGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGT
  5   1   2       bld Ga18 5g3  in                       xlk53h15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNTTCCGGNCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGNNNNNTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAANGNNCCATGAAAATGCTTGNNTCTGGNGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGNCTTCACCCAAGAATAGTGACTGAAGGNTTTGAAGCAGCAAAGGNCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGNGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGNTCATGCTGGGNTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGANAACCAAATGAACCTATAGATTTGTACATGGNTGAAGTTATNGAGATGAAACACAAAACAGANAGNGATACTACGCTGATAAGAGGNCTTGTTTTAGATCAT
  5   1   2       bld Ov1       in                    IMAGE:5073155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGCCCACGCGTCCGATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACACCAAATGAACCTATAGATTTGACATGGT
  5   1   2       bld Ga12 5g3  in                         XL209l24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTT
  5   1   2       chi FaBN      in                    IMAGE:8076015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGACTTTGCCGTCAACACTATGTCCGCTCTCTTAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGTGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCTCACCAAGGTTCATGCTGGGTTAGCATACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCAACACCAAATGAACCTAAGATTGTACATGGTGAAGTTTGGACGAGAACACAAACAGATATGTTACTCGCTGAAAGAAGCTGTTTAGATCAGGAGTCGTCTACAACAGAAAGCTGTGATATCTCTTCCCACTGATGCTCTCTGAAATAAAACCAATGATCTGGTCTTATAATGCAATATTAAATTG
  5   1   2       bld Ga12 5g3  in                         XL196b13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGAT
  5   1   2       bld FaBN 5g                         IMAGE:8076740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCCATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATT
  5   1   2       bld Emb1 5g                         IMAGE:6630817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTTACTCTACCGTCAACATCATGACCGCTGTCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAANAGTGCAGATGAACGCGAAAAACTGGTTAAAAGCAGAGNAGAAACGTTTATTTGAAGAGAGGGTAAATAANAATCATAGNCC
  5   1   2       bld Emb4 5g                         IMAGE:4724932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTTGATAAAAGGGCTTGTTTTAAATCATGGAGGGCGTCATCCAGACATGAAGAACCCTGTTGAAAATGCTTTTATCCTCCCCTGCAATGTGGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTTACAAAGGGCAGAATGAACGTGAAAAGCTGGGTTAAAACCGGaaaaaaaaatttattgaaaaaaaggggaaataaaatccttaccccttaaacccaaaaatgggtggggaaaatactgggaaaaGGGTTCCATTGGGGGTCAAATCCAAAACAGCAAATTGAACCCN
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3436502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTCTTTGCCGTCAACACTATGTCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAAATTGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATNGCTGGGTAGCAGACATTNTAACCGAAGCTGTTGTGGACTCTGGTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATGAGAAGGCTTGTTTTAGATCATTGGAGTCGTCATTCAGACATGAAAAAGCGTGTTGAAGATGCTGTTATNCTC
  5   1   2       bld Tail 5g                         IMAGE:8543309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAGACATATAACTATTCGTCCCGCTATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCGGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGCGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATTGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAA
  5   1   2       bld Int2                            IMAGE:8531106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAAAGCCCTCAATCCGAAAGCCGAGGTGGCTCGAGCTCAGGCGGCGCTGTCGGTGAACATCAGTGCGGCACGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCATGTGTCTCTGGATATGAAAAACAGAAGTGATTCTGGGTCTTTTCAAAGTGCGATGACGTGAAAGCTGGTAAGCGAGAGAAGTTATGAGAGAGTAATAATCTAGCTGAGCAAGTGGTGAATACTGCAGTCATGGAATCAAGGAT
  3  -1   2       bld Bla2      in                    IMAGE:7297173.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAAAGCCGAGGTGGCTCGAGCCCAGGCGGCGCTGGCGGTGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTTGTCTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCATGTGTCTCTGGATATGAAAAACAGAA
  5   1   2       chi DMZ       in                         xl241i07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGCTTTAGCTTTTGCAGTAGCCATTGCAGTCAGACACCATGCAAAATTAAATTTCATTTGTACCTTTTATCCTGATGGAACCATACTTTACTGGGTGTCATCAGAATTACATCTGAATACAGTTTATGCTCTCAATGCTTTAGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGAC
  5   1   2       bld Neu7      in                         XL031j05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACATCAGTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTNTGGTGCTGGAGAANTTNTTNTTACCAAAGATGGCAATGTCTTGCTTCATGAAAT
  5   1   2       bld Tbd3      in                    IMAGE:3548731.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGCGGCAAGGGGGCTCCAAGACGTGCTGCGGACCAACCTCGGGCCTAAAGGCACCATGAAAATGCTTGTCTCTGGTGCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTATGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTAATGGACATCTCACATCAAACGCATAGTGATACTACCCTGAAACGT
  5   1   2       bld Tbd7                                 XL068g23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCTGCAGGNAATTCGGCACGAGGAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGC
  5   1   2       bld Tbd7      in                         XL067l06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGGAGAAATCAAGCTTACCAAAGATGGCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATC
  5   1   2       bld Tbd7      in                         XL099c02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAATGTCTTGCTTCATGAAATGCAAATTCAACATCCAACAGCCTCGCTGATCGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTAC
  5   1   2       bld Lmb2                            IMAGE:8637480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAATGCAAATTCAACATCCAACAGCCTCATTGATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGANTAATCAAAGGGAATTGACCATTTTCCTGGATGCCTTTGCAAGAAGGNATGTGCACTCGTAAGCAAGAGAGAAATATGAAGACGACTTNNGCTGTGTGCATGCATGATCTGTGAGATCCCACTGATGCTAGATGNGTCTGCATA
  5   1   2       bld Thy                             IMAGE:8551055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTGCTAAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTCAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGNCAAGGTTCATTGTGATAATCAAAGGGATTGACCCATTTCCTGGATGCCCTGCCAAGAAGGATGTGCACTCGTAAGCAAGAGAGAATATGAAGACTGACTTGCTGTGTGCATGCATGATCGTGGAGATTCCCTGATGCTAGATGCGGTC
  5   1   2       bld Kid                             IMAGE:7011463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGTAGCTACAGCACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCANAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGNGGGCAG
  5   1   2       bld Emb4                            IMAGE:5537263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAAGATGACATTACTGGAGATGGAACCACATCAAATGTTCTGATCATCGGAGAGCTACTGAAGCAGGCAGACCTTTACATCTCTGAGGGTCTTCACCCAAGAATAGTGACTGAAGGTTTTGAAGCAGCAAAGGCCAAAGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCANAGAGAAGAAATATGGAAAGACTGACTTTTGGGCTTGGTGGTGGCAATGCCATGAATTTCTGGTGGATGATCTCACACCTGAATGCTTAGGAACATGCGGGGTCTTGTCTATGAATACCCCCCTGGGGGGGAAGAAAAATTCACTTTTTATAAGAACAGTGGGGAAGAACCCCACGGTTCTGGTGACACCTAATTAATCCAAAGGGGGCCCAAATTAAGCCCCCCCAATAAACCCCCAATTTAAAAGATA
  5   1   2       bld He1       in                    IMAGE:4406820.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGCGTGGGACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTC
  5   1   2       bld Skin                            IMAGE:8643603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACCACATCAAATGTTCTGATCATCGGAGAGCTGCTGAAGCAGGCAGACCTTTACATCTCCGAGGGTCTTCACCCAAGAATAGTTACTGAAGGTTTTGAAGCAGCAAAGGTCAAGGCACTTGATGTTTTGGAGAAAGTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAAAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGAATTGTGGCACTTCGTAGAGCAAGAGAAGAATATGGAGAACTGACTTGGCTTGGGGGGCATGCATGAATCTGTGATGATTCACGCAGATGCTAGGCTGCTGTCTGTCATGATCCACTGGGAGAAATCACTCATGACATGGAACCCGTCGGACCTTATAGGGCATACCACTACNATAGATGCTAGTGC
  5   1   2       bld Ov1       in                    IMAGE:5049226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGTTTTGAAGCAGCAAAGGCCAAAGCACTTTGAAGTTTNTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGCATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTT
  5   1   2       bld Int2                            IMAGE:8528991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGATACATCGATTAAATTCGTCCCGCACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATCACACTGGGGGAAGAAAAATCACTTTATAGACAGTGTGAGACCCACGTCTGTGACCTATTATCANGGGCCNATAGCCACATACACAATTAAGAGCATAGGATGACTCAGCTGTAGATGCATGAGATTGCTGGTC
  5   1   2       bld Neu7      in                         XL048n08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTTGAAGTTTTGGAGGAAATAAAAGTGTCCAAAGAAATGGACAGGGAGACCCTAATTAATGTGGCAAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTT
  5   1   2       bld Em10                            IMAGE:7979849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTAAAGTGTCTAAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCATAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACCACTGGGGGAAGAAAATTCACTGTCATGAACAATGTGAGAACCCCGTTCTGTGAAACATTATCAAGGGCCAATAACCTCCTATTCAAATAAGAAGCATAAGGATGACTCAACTTTAAAAGCATTGAAAGGTTTTGGTCAGCCAGGTCTGGAATCAACATAATCTTTGACCAC
  5   1   2       bld Spl                             IMAGE:8460736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCTAAGAAATGGATAGAGAGACTCTGATTAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATCACACTGGGGGAAGAAAAATCACTTTCATTGACATGTGAGAACCACGTTCTTGAGCTATTATCAAGGGCAAATAACACACATACACAATTAAGATCATANGGATGACTCGACTTGAGATGCATGAGATGTCTGTGTCAGCCAGTCATGAATACATCCTAGCCTGGACCAACATGTAGATGCACTG
  5   1   2       bld Brn2                             Brn2-za63c04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGTTGCAAGGACTTCACTTCGCACCAAGGTTCATGCCGAGTTAGCTGACATTTTAACTGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTG
  5   1   2       bld Skin                            IMAGE:8643723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAATTCACTTTTATAGAACAGTGTGAGACCCACGTTCTGTGACACTATTAATCAGGGGCCAATAAGCCACAATAACCAAATTAAGATGCATAGGGATGACTCGAGCTGTAAGATGCATTGAGATGTGCTGTGTCAGTGCAGTGCATGAGTACATCCTATGCTCTGTGACCAGCTATGGAAGACTGCACTGTGTCAGCTTGTAGCTC
  5   1   2       bld Brn2                             Brn2-za98a11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCACTTCGCACCAAGGTTCATGCTGGGTTAGCAGACATTTTAACCGAAGCTGTTGTGGACTCTGTTTTGGCTATTCGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGAAAGTGATACTACGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCT
  5   1   2       bld DMZ                                  xl308e16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGACAACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCATAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGAT
  5   1   2       bld Em10                            IMAGE:8319224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACCAAATGAACCTATAGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCATAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGATGCAATTGAAGATGGGTCTGTGGTCCAGGCGCGGTGCATTGGAGTAGC
  5   1   2       bld Ov1       in                    IMAGE:5072909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGGATTTGTACATGGTTGAAGTTATGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGCTAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGATGTTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGTAGAGACTGACTTTGGCTTGTGG
  5   1   2       bld Tad1                            IMAGE:6940823.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGATGAAACACAAAACAGATAGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCATAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCCAGGCGCAGTGCATTGGAAGTAGCAATCGCTGATGCTCCTGTGAAGCACAAACCCCATTGTGAAAAGACGTGCCCCAACCTGGGG
  5   1   2       bld Ga15      in                       XL471n15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCA
  5   1   2       bld Tad1                            IMAGE:6938320.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTGATACTACGCTGATAAGAGGACTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGGTTCTGTGGTTCCAGGCGCAGGTGCATTTGGAAGTAGCAATCGCCTGATTGCTCTTGTGAAGCACAAAACCCAATGTGAAAAGGACGTGCCCCAACTTGGGTGGTTCAAGGCCCTTTGCCTGGAGGCACCTCCCTTAATCATTTCCCAAAGGTTGGCTTTGCCC
  5   1   2       bld Brn3                            IMAGE:8537625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTGATAAGAGGGCTTGTTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTNGAAGGACGTGCCCACTTGGTGTTCAGCTTTGCTGATGCCTCTGATCATTCCAGGTGCTTGCCAAACTCTGGTATGACCTCAGAGACCNTGTAAACTCAGACGATTGCAGATCAGCACTCATGTGTGATTACCTGTGACATGATCTCGAGCG
  5   1   2       bld Eye1                            IMAGE:6945035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGCTTGGTACNNCGGTCCGGAATTCTCCGGGATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACCTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCCAAGGTGCTTGCCCCAAAATTCTGGGTTATGACCCCTCAGGGAGACCCTTTGTAAAAATTTCAGAACAGAATTTGCAGAAATCAGGGCCGGCTCCTTGGGGGGTTGAATTTAAACCCCGTGGTGAAACCAATGGATTTCCATC
  5   1   2       bld Thy                             IMAGE:8549592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGTCTTAGATCATGGAGCTCGTCATCCAGACATGAAGAAGCGAGTTGAAGATGCTTTTATCCTCACTTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCATGTGAAAGGACGTGCCCAACTTGGTGTTCAGCCTTTGCTGATGCACTCTTATCATTCCCAGGTGCTTGCCCAAACTCTGTTATGACCCCAGAGACGCTTGTAAACTTCGACAGATATTCGAATCCGGCAGTCA
  5   1   2       bld Lmb1                            IMAGE:8535694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTTTAGATCATGGAGGTCGTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTTGTGAACACAAGCCTAGTGTGAAAGGACGTGCTCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAGGTGCTTTGCCAAACTCTGGTATGACCCNTCAGAGACCTGTAAACTCAGACGATTTGCAGATTCAGCACTCATGGTG
  5   1   2       bld Spl                             IMAGE:8460862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNTCATCCAGACATGAAGAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAAACACAGCCTAGTGTGAAAGGACGTGCCCCACTTGGNTGTCANGGCTTTGCTGATGCACTCCTGATCATTCCCANNGGTGCTGCCAAACTCTGGTATGACCTCAGAGACCNTGTAAACTTCGACGATTNGCAGATCAGCAGCTCATGTGTGATTAACCTGTGAACATGATTCTCGAGCAGATTTGGATATACTGCAGACC
  5   1   2       bld He1       in                    IMAGE:4407897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGCGTGTTGAAGATGCTTTTATCCTCACCTGCAATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAAC
  3   1   2       bld Ga18 5g3  in                       xlk75p14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ANNANNGANTTGANNNTGCTTTTANCNTNNCTTGCANTGNNTNTCTGGANTNTGAAAAAACAGAAGTGANTTCTGGNTTCNTTTNNAAAAGTGCAGATGAACNNGAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATNNCCTTGCCAAAGAAGGAATTGTGNNNNNNGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGNAGTGCCATGAATTCTGTGGATGNTCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTNCTCTTTNCTTCTACTGATTTGCTGAAGTNNT
  5   1   2       bld Ga15      in                       XL506p19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTTGAAGATGCTTTTATCCTCACTTGCNATGTGTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGANAGAACGTTTATTGAANAGAGGGTAAATANAATCATANCCCTGAANCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCANAGAAGGAATTGTGGCACTTCNTACAGCAAAGAGAAGAAATATGGAGAGACTGACTNTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTANTCAAGGGGCCAAATAAACACACCATAACACAAATTAAANATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCNATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCNCTGATGCTCTTGTGAAA
  5   1   2       bld DMZ       in                         xl229o17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGA
  5   1   2       bld DMZ       in                         xl260m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCTGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTC
  5   1   2       bld Te2       in                    IMAGE:7206996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAATATGAAAAAACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCANGAGACCCTTGTAAAACTCAGACAGAATTGCAGATCANGCAGCTCATTGTGTTGATTAACACTGTGAACNATGATTTCATCGAGCAGATTGGATACTCATGTCAGAGCACTGCTCATCTGCATGGATGCACATATCTGTGTGATAATAGAACAGAGCTCCTAG
  5   1   2       bld Neu7      in                         XL017j24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAACAGNAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAAAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTTGTGGTTCCAGGCGCAGG
  5   1   2       bld Oo1                             IMAGE:6642607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAGAAGTGAATTCTGGGTTCTTTTACAAAAGTGCAGATGAACGTGAAAAGCTGGTTAAAGCGGAGAGAAAGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCAGAAAGTGTGTGGAGATACTGGCAAAGGTTTCATTGTGATAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGGTGAACCAATGATTTCATCCGAGGCAGGAATTTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCCTGTTGGGGGGATGGAGATTAATGAGAAGCCAGGAATGGTCTTTCTCCTAAAAGGAAGGAATAATAAGCCCATG
  5   1   2       bld Tad2      in                    IMAGE:6875515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCTTTTACAAAAGTGCAGATGAACGCGAAAAACTGGTTAAAGCAGAGAGAACGTTTATTGAAGAGAGGGTAAATAAAATCATAGCCCTGAAGCACAAAGTGTGTGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACCTTGGTGTTCAGGCCTTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAAACTCCTGGTTATGACCCCCCANGAAGACGGCTTGGTAAAACTTCAGAACAGAATATTCCAGAATCCGGCCAAGCTTCATTGGGTGGTTGGAATTTAAAACCACTGGTGGAAACCCAATGGATTT
  5   1   2       bld Brn3                            IMAGE:8538236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCGATACTGGCAAAGGTTTCATTGTACTAAATCAAAAGGGAATTGACCCATTTTCCTTGGATGCCCTTGCCAAAGAAGGAATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAGCCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCTGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTTGCAGCAATAT
  3   1   2       bld Spl                             IMAGE:8464345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGAAGGGATAATCAGCTAGCCAATGGGGGTCTGCAAGTTCTGTATAATCAAAGGATGACATTTCTGGAGCCTTGCAAGAGGATTGGCACTCGTGACAAGAGAGAAATATGAGAGACGACTTGCTTGTGGGGCAGTGCATGATTCTGTGATGATTCACGCCAGATGCTTAGGCATGCTGGCTTGTCTATGAATACACACTGGGGGAAGAAAAATCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACCTTT
  5   1   2       bld Skin                            IMAGE:8643819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATTTTCCTTGGATGCCCTTGCCAAAGAAGGGATTGTGGCACTTCGTAGAGCAAAGAGAAGAAATATGGAAAGACTGACTTTGGCTTGTGGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAANGATGATATAGCCATGTGTGACACTTTTCTACNNGTCATTAGAAGTTATTCAATCTGAATCATTGCTCTTGCTCCACGATTGCTGAAGTGCTATAACTCTGTAATCTATCCCAGTGTAACGAACCC
  3   1   2       bld Brn1 5g3  in                    IMAGE:6950987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGGGATTGTGGCACTTCGTAGGGCAAAGGAGAAGAAAATATGGAAAGACTGACTTTGGCTTGTGTGGCAATGCCATGAATTCTGTGGATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATTACAAGCTTACC
  3   1   2       bld Int2 5g3  in                    IMAGE:8823177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCTGATGCCTGCAAAGAAGATTGGGCCTCGTAGAGCAAAGGAAGAATTGGAGGGACTGACTGCTTGTGGGGCAGTGCCATGATCGTGGATGATCTCACGCCAGATGCTAGGGCATGCTGGTCTGTCTATGAATACACACTGGGGAAGAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTATGGCGACGCGAACAATTTTTAATTATGTACAAAGACAGAAGCCAGCTGTTTCATAC
  3   1   2       bld Ga18 5g3  in                      xlk113l19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNNNTTCGNNNNGCAAANNGANNAANNANGNAAANGNCTGACTTTNNCTNGNNNNNGNAATNCCATGAANTCTGTGGANGATCTNNNACCTGAATNCTTAGGACATNNNGGTCTTNTCTATGAATACANNCTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTANTCAAGGGNCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAANNGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAANCT
  3   1   2       chi Tad2      in                    IMAGE:6875515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAATTTGGAGAGACTGACTTGGGCTTGTGGGGGCAGTGCCATGAATTCTGGGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCATGATTTATTTATTCAATTTTTTTTAGCGCGACGCAACATGTTCAAGCAGGAACTACAGACAGAGAGCTCCAGCTTGTACATTTCAG
  5   1   2       bld Te2N                            IMAGE:7206568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAATATGGAGAGACTGACTTTGGCTTGTGGGGGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAAGTTGCTTAATAACTTTCTGTAAAACTTATTCCCACCGCTGTTAAACCATAGCACCCTATCGAAAACCTTCCCATGGTTCAAAATTTTATTTTATTCAttttttttttAGGGGACTTTAAAATGGTACAAGCTTGAAACTTCC
  3   1   2       bld Ga18 5g3  in                       xlk53h15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AANNATGNNNGACTGACTTTNNNNNTNNTGNAATNCCATGANTTCTGTGGATGNTCTCACNCCTGAATGCTTAGGACATGNGGNTCTTGTCTATNNNNACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGNACCCACGNTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAANNGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTNGTGTTGATTTAAACACTGGTGAACCAATGATTTCNTNCGAGGCAGGNATTTGGGATANCNANAGTGTCAAGAAGCAGCTNCTTNATTCCTGCACNGTGNTNGCAAGNAANANCCTNTTGGTNGATGAGNTTATGAGAGCAGGAATNTCNNCTCNNANAGGATGNATATAGNNNTGNNNAGNNACTTTTCTT
  3   1   2       bld Ga15 5g3  in                       XL443e05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGNGGGGGCCAGTGCCCATGAATTCTGTGGATGATCTCACGCCTGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACNCACTGGGGGAAGAAAAATTTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAAGATTTATTTATTCATTTTTTTTTATGGCACTGAAATGTA
  5   1   2       bld Egg1                               PBX0049F10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAGTGCCATGAATTCTGTGGATGATCTCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATC
  3   1   2       chi Spl  5g3  in                    IMAGE:8463562.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGTGGCATGAGCAGGAGATAGAGCGACTGCTGGTGCATGCAGATCGTGAGATTCCACTGAGCTAGACAGCGTCTGTCTAGATCACATGGGGAGAAAAATCACTTTTAGACAGGTGAGACCCACGTCTGTGACACTATATCAGNNGGCCAAATAGCACACAATACACAAATAAAGATGCATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCCTCGACAGAAGGTCAGCTGCTCAGTT
  3   1   2       bld Eye1      in                    IMAGE:6957298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGATGATCTCACCACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTGAGTCTTG
  5   1   2       bld Eye1      in                    IMAGE:6957298.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGATCTCACACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTNGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGGCACTGAAAATGTACAAAAGCTGAAACCCTTTCTGGTCTTTGGTACAATAATTTAAAAAACTTTTGCCTCCTTTCAACTTTAAAAAN
  5   1   2       bld Emb1                            IMAGE:6635378.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCACGCCAGAATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCAttttttttATGGCACTGAAATGTACAAGCTGGAACTTTCTGGTCTTTGTACATAAATTAAA
  5   1   2       bld Ga12      in                         XL161l13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCTGAATGCTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGA
  5   1   2       bld Ga12      in                         XL202h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGGATGCTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTC
  5   1   2       bld Ga12                                 XL193b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTAGGGCATGCTGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTC
  3   1   2       bld Te2       in                    IMAGE:7206996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTAGGACATGCGGGTCTTGTCTATGAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTGTACATAATAAAA
  3   1   2       bld Ga15 5g3  in                       XL477i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGGGCATGCTGGTCTTGTCTATGAATACACNCTGGGGGAAGAAAAATTCACTNTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTANTAATCAAGGGGCCAAATAAACACNCCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGNCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCGAAATTGAA
  3   1   2       chi FaBN      in                    IMAGE:8076015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGGACATGCGGGTCTGTCTATGAAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAACTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTCAACCATGTGGAGAACCAATGATTTCATTCAGAGGCAGGAATATGGGATAACGTACAGTGTCAAGAAGCAGCGTGTTTCATTCGTGCAATTTGATTGCAACGCAATATCTTGTTTGGCGGCTGCGATTATGAGAGCAGGAACTTTTTTCTTTAAATGGATGAATATAGCTCAACTTGCGACATTTTTTTTATGGTTCAATTTACGAAAGCTTTATTTAAATTCAGACCTTCATTTTGTTTTCAGTTCCCACTTGATTTTATGACAGCCGCTTAACAAACTTTTTCTAAAATTTACTCCCACAGATGTAAACTGCTAGCACTTATCGCAAACGTTCAACAAATACCAGCCACGTACAGAGCACGAAACGCCAAGNGGACCCNCNCCNTGCTGAAGTAGTTTTTTT
  5   1   2       bld Te2N      in                    IMAGE:7203071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTCTATGAATACACACTGGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTG
  3   1   2       bld DMZ  5g3  in                         xl249b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TANGAATACACACTGGGGGNAGAAAAATTCACTTTCATTGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTTATGGCACTGAAAT
  3   1   2       bld DMZ       in                         xl229o17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATACACACTGGGGGAAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATGTGCNGANTCAGGCCAGCT
  5  -1   2       chi Lmb1                            IMAGE:8532390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAATGACTATGTGGGCACTATnnnnnnnnTCTGATTACCGAGTGCAGGTTGTAATCACTGGAGAATCATTTGACGTGGACCAGTCTGCATTATCAGGCGATAGCCACATACCTATGAGGAGCATAGGGATGACTCGACTGTAAGATGCATTGAGATGTGCGTGCTCCAGGTGCTGTGCATAGCAGCAGCATCGCTATTGTCATGTGAAACACAAGCATAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCGATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACTGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCaaaaaaaaaaaa
  3   1   2       bld DMZ  5g3  in                         xl309c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAAAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGC
  3   1   2       chi FaBN      in                    IMAGE:8075749.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTAGCAGGGTTGTTATGATCACATGGGAGAAATTCATTTAAGACAGGGGAACCAGTTCTGGCATATTATCAGGGCCAAATAGCACCAATACCAAATAAGATGCAATAGGGAGGATTCGAGTGTAAAGAAGCAATGAAGAGGTGCTGTGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACAGCGGTGAACCAACGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCATCCACTGTGATTGCAAGCACTATCCTGTTGGTGGACGACATTATGAGAGCAGGAATGTCTTCTATAAAAGGATGAATATAGCCATGTTGCGACACTTTTCTTCCGGTTCAATTAGAAAGTTTACTTCAAATATGATATCCTTTGCTCTTTGCTACACCTGCTCTGCATGAAGTCGTCCACTCAACTTTATGTAACATGTAATCCCACAGCTGTAAAACGCTAGCACCTTCTTGAACACGTTCAACACCCATATTTCATCCTCTAAGCAAGCAAAGACCACCAGGACCAACACACCATGNATAGACTTATATTT
  3   1   2       bld DMZ       in                         xl260m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGANTGTGCNGNTTCAGGCCAGCTCAT
  3   1   2       bld Te2N      in                    IMAGE:7203071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTCACTTTTATAGAACAGTGTGAGAACCCACGTTCTGTGACACTATTAATCAAGGGGCCAAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATTACAAGCTGAACCCTTCGTCTTGTCAAATAAATTCGAT
  3   1   2       bld DMZ  5g3  in                         xl263h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTTATGGCACTGAAATGTAC
  5  -1   2       bld Bla2                            IMAGE:7296187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAATGTGAGAACCCACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAAGATTTATTTATTCAtttttttttatggcactgagaaaaaataaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCGCCCAAGA
  5   1   2       bld Lmb2      in                    IMAGE:8636232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGTCACGGTTGAAAGATCCAGAAGTTTCGATTCGTCCCAATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAGaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Em10 5g3  in                    IMAGE:7981461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCCTTCCCTGACATGGGGACCCCCGTTTTGGGCGCTTTTATCAAGGGCAATTAACACCCTAAACAATTAAGATGCAAAAGGATGACTTCGAGCTTTGAAAATGCAATGAAGATGGTTCTGTGTTCCAGGCGCAAGGTGCATTGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTATGGCACTGAAATGTACAAGCTGAACTTTCTTCTTTGTTCCCAGACTTTTACCA
  5   1   2       bld Skin      in                    IMAGE:8640354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCATGTTCACATTTATTTATCATTTTTTTATGCACTGAATGTACAGCTGAACTCTGTCTTGTACATATTAAATGTGCTCTTCaaaaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAGCTGATCTTAACGCGCTCACTTCCCTAATGACGATCTAATCGATGTAGACTGTGATTGAACCATGATGTGAATGTATGAA
  3   1   2       bld Skin      in                    IMAGE:8640354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGATGGGCAATGAACAGTATTCTTGCAGTCCATGATGATGTCCACGTCGGACGTATATCAGGCCAATAACCACATACCAATAAGATGCATAGGATGACTCGACTTGAGATGCATGAAGATGTTTGTGTTCCAGCGCAGTGCATGGAGTAGCATCGTGATGCTCTGGAAGCACAACCCAATGTGAAGGACGGCCCAACTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTATGGCACTGAAATGTACAAGCTGACTTCTTCTTGACCAGCTACTCCGNCCCC
  5   1   2       bld Sp1       in                    IMAGE:4173487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTTCTGTGACGCTATTAATCAAGGGGCCAAATAAACACACCATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGGTGTTCAGGCCTTTTGCTGATGCACTTCTTTATAATTCCAAAGGTGCTTGCCAAAACTCTTGGTATGACCCCCAGGAGACGCTTGTAAAACTCAAACAGAATATTTAAAATTCGGGCAGCTTATTGGTGGTGATTTAAACCATGGTGAACCAAATAATTCCTTCCAAGGCAGGAATTGGGGATAACTACAGGGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGT
  3   1   2       chi Tbd3      in                    IMAGE:3548731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCTTACGCTCTTTATCAACGGCCTCAATAAACACACCATACCACAAATTAAAGATGCAATAAGGGATGGACTCGAAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGTTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCCACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGGTTTTGGACTTGGAATGCTCTTGAGTTTTTTCCGGATTTCAATAATTTGGATTTTCATGCCTTAGGTCTACTATAAAATTATTTAAACATTAAATATAAA
  3   1   2       bld Neu7      in                         XL048n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGACACTATTAATCAAGGGGGCCAAATAAGCACNCAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTATAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGAC
  5  -1   2       bld Bla2      in                    IMAGE:7297173.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACCAGTCTGGAGCTATATCAGGGCAAATAACACACATACCAAATAAAGTGCATAAGGATGACTCGAGCTGGAAGAAGCAATGAAGATGTTCTGTGGTCCAGGCGCAGGTCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCAttttttttATGGCACTGAAATGTACAAGCTGAACTTCTGTCTTTGTACATAATTAAAAATGTTGCTCTTCaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCATCGCCCATGATGCGT
  3   1   2       bld Gas6 5g3  in                    IMAGE:3474020.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAATAAGCACCCAATAACCCAAATTTAAAGATGCAAATAAGGGAATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAGCAAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCAAA
  3   1   2       bld Lmb2      in                    IMAGE:8636232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTTCCTCTTGTCCCTAGCTTTC
  3   1   2       bld DMZ  5g3  in                         xl321e18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAGCACACAATAACACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAG
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCACACATACACAAAATTAAAGATGCATAAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAA
  3   1   2       bld Ga15      in                       XL471n15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCNAAGATTTA
  3   1   2       bld Ga12                                 XL163l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCNCTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAANGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCANTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAACGTAAGAAAAGA
  3   1   2       bld Ga12 5g3  in                         XL209l24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAATTAAAGATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACACTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATAAAAAC
  3   1   2       bld Neu7      in                         XL017j24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAAGATGCAATAAGGGATGGACTTCGAAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTTAGGCACGNAATGTACAAGC
  3   1   2       bld Ga12      in                         XL161l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAAAGATGCAATAAGGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAACGAAGAAAAGAAAAG
  3   1   2       bld DMZ       in                         xl241i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGATGCAATAAGGGATGGACTTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACNGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGNGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTNTACTGATTTGCTGAAGTTGCNTAATAAACTTTCTGTAAAACCTATTCCCACAGCNGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTNTTCATTTTTTTNTATGGCACTGAAATGTACAAGCT
  3   1   2       bld Ga12                                 XL162l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGCAATAAGGGATGGACTTCGAGCTGTAAAGAATGCAATTGAAGATGGTGCTGTGGTTCCAGGTGCAGGTGCATTGGAAGTAGCAATCGCTAATGCTCTTGTGAAACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTNTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAACGTAAGAAAAGAA
  3   1   2       bld Ga12 5g3  in                         XL196b13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAATAAGGGATGGACTTCGAGCTGNGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTNTTNTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGGNGATGCACTCCTTATCATTCCCAAGGNGCTTGCCCAAAACTCNGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGNTCATTGGTGTNGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTNTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTNGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACATGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAAGATTTATTTATTCATTTTTTTTTATGGCACTGAAATGTACAAGCTGAACTTCTGTCT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCGAGCTGTGAAGAATGCAATTGAAGATGGTTCTGTGGTTCCAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAGCCTAAAAAAAA
  3   1   2       bld Ga15      in                       XL506p19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGAATGCAATTAAAGATGGTTCTGNGGTTCCAGGNGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTNTGAAGCACAAACCCAANGNGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGAGTGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGANGAATATAGCCATGTTGNGACACTNTTTTTCCTTATGTTTCAATTAGGAAGTTTATTCAAA
  3   1   2       bld Sp1       in                    IMAGE:4173487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGGTTCCAGGCGCAGGGGCATTGGAAGTAGCAATCGCTGAAGCTCTTGTGAAGCACAAACCAAATGTGAAAGGACGTGCCCAACTTGGTGTCCAGGCCTTTGCTAATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAAAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAG
  3   1   2       bld Egg2                            IMAGE:5278887.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGCGCAGGTGCATTGGAAGTAGCAATCGCTGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAACCACTGGTGACCCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCCCCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTAT
  3   1   2       bld Ga12      in                         XL202h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAGTAGCAATNGNNGATGCTCTTGTGAAGCACAAACCCAATGTGAAAGGACGTGCCCANCTTGGTGTTCAGGCCTTTGNNGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTNTGNCCCCCAGGAGNCGNTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCANTGGTGTTGATTTAANCACTGGTGAACCAATGATNTCATCCGAGGCAGGAATNTGGGATAANTNCAGTGTTAAGAAGCAANTGNTTCATTCCTGTACNGTGATTGCAAGCAATATCCTGTTGNTGGATGAGATTATGAGAGCAGGAATNTNTTCTNTAAAAGGATGAATATAGCCATGTTGCGACACTTTTCTTNTTATGTTTCAANTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTNTANTGATTTGCNGAAGTTGNTTAATAAACTTTCTGTAANACNTATTCCCNCAGCTGTAAAACAATAGCNCNTATCGAAAACCTCCAANGTTCAAGATT
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3436502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTAACTATCGCTAATGCTCTTGTGAAACACTAGCTGAGTGTGCAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGAGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAACTTTGCTCTTC
  3   1   2       bld He1       in                    IMAGE:4406820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGTGAAGCACGAACCCAATGTGAAAGGCGGTGTGCAACTTGGTGTTCAGGCTTTGGCTAAAGCACTCAAGATCATTCGCAGGGTGCTTGCCCAAGACTCTGGTTATGACCGTCAGGACACGCTTGTTGAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTGAAGCGCTGGTGAACCAATGATTTCATCATAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACAGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAGAACATTGGCTCTTTGCTTCTACTGATATACTGGAGTTGCTTAATAAACTTTCTGTAAAACCT
  3   1   2       bld Neu7 5g3  in                         XL038f06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACACAAGCCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTAGGCACTGAAATGTACAAGCNAACCCTTC
  3   1   2       bld Tbd7 5g3  in                         XL092a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACACAAACCTAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCNTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTAGGCACTGAAATGTACAAGCNAACCCTTC
  3   1   2       bld Ov1       in                    IMAGE:5049226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACCCAGTGTGAAAGGACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTAGTGTGAAAGAACGTGCCCAACTTGGTGTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTNTTTATGGCACTGAAAATGTACAAGCTGAANCCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTAA
  3   1   2       bld Tbd7      in                         XL067l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTGCCCAACTTGGTGTTCAGGCCTTTGCTGATGCACTCCTTATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAAGATTTATTTATTCATTTTTTTTTATGGCACTGAAATGTACAAGC
  3   1   2       bld He1  5g3  in                    IMAGE:4409033.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGTCAGGGCTTTTGTTGATGCACTCTTTATCATCCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGAAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTATGGCACTGAAATGTACAAGCTGAACTTCTGTCTTTGTACATAATTAAAAATGTTGCTCTTCA
  3   1   2       bld Emb4      in                    IMAGE:4959428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTCAGGCTTTTGCTGATGCACTCCTGATCATTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTTTCTAAAAG
  3   1   2       bld Lu1  5g3  in                    IMAGE:4057266.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGCTTTTGCTGATGCACTCCTGATCATTCCGAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGNTTTATTCAAATCTAGATATCANTTTGCTCTTTGCTTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAAA
  3   1   2       bld Gas5      out                   IMAGE:3749807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGCACTCCTGATCAGTCCCAAGGTGCTTGCCCAAAACTCTGGTTATGAACCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACATATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAACTTTGCTCTTCAAAAAAAAA
  3   1   2       bld Emb4      in                    IMAGE:4959401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGCACTCCTGATCATTCCCAAGGTGTTTGCCCAAAACTGGGGTTATGACCCTCAGGAGCCCCTTGTAAAATTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAAGGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAG
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4203102.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGGTGCTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAAGGTGCTTGCCCAAAACTCTGGTTATGCCCTCAGGAGACCCTTTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAAGAGTTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGTTGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Brn1 5g3  in                    IMAGE:4740274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGCCCAAAACTCTGGTTATGACCCTCAGGAGACCCTTGTAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAACTTTGCTCTTCACTTAAAAAAAAAAAAA
  3   1   2       bld Neu7 5g3  in                         XL042h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCTGGTTATGACCCCCAGGAAGACGCTTGTAAAACTTCAGACAGNAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGNNGNGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTATCTTTTTTTTTAGGCACTG
  3   1   2       bld Ov1       in                    IMAGE:5073155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAACTCTGGTTATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCACTCGAGGCAGGAATTTGGGATAACTACAGTGGGAGGGAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTA
  3   1   2       bld Tbd7      in                         XL099c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGACCCCCAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATNCTGTGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTNATAAACTTTCTGTAAAACCTATTCNCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCNATGTTCAAGATTTATTTATTCATTTTTTTTTATGGCACTG
  3   1   2       bld Neu7      in                         XL031j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGAGACGCTTGTAAAACTTCAGACAGAATATTCAGAATCCGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTAGGCACTNNATGTACA
  5   1   2       bld Ga18      in                      xlk128h19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAACTTTGCTCTTNNNANAAAAAAA
  3   1   2       bld Ga18      in                      xlk128h19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAACTTCAGACAGAATTTGCAGAATCAGGCCAGCTCATTGGTGTTGATTTAAACACTGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAACTACAGTGTCAAGAAGCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTCTATGGCACTGAAATGTACAANC
  3   1   2       bld Sp1  5g3  in                    IMAGE:4175365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAATTTAAACACTGTGTGTAACCAAATGATTTTCAACCCCAGGCAGGGAAATTGGGAATAACTACCAGTGTCAAAAAGCCAGCTGCTTCATTCCTGCACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGAGCAGGAATGTCTTCTCTAAAAGGATGAATATAGCCATGTTGTGACACTTTTCTTACGGTTCAATTAGAAAGTTTATTCAAATCTGATATCATTTGCTCTTTGCTCCCACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAATCTAATCCCACAGCTGTAAAACGATAGCACCTATTGAAAACGTTCAACATTTATTTATTCATTTTTTATGGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCA
  3   1   2       bld Ov1       in                    IMAGE:5072909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGTGAACCAATGATTTCATCCGAGGCAGGAATTTGGGATAAATACAGTGTTAAGAAGCAACTGCTTCATTCCTGTACTGTGATTGCAAGCAATATCCTGTTGGTGGATGAGATTATGAGGGCAGGAATGTCTTCTCTAGAGGGATGAATATAGCCATGTTGTGACGCTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCATTTTTTTTATGGCACTGAAATGTACAAGCTGAACTTCTGTCTTTGTACATAATTAAAAATGTTGCTCTTCAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk121p19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAANCCTCCAATGTTCAACATTTATTTATTCATTTTTTTTATGGCACTGAAATGTACAAGCTGANCTT
  5   1   2       bld Ga18      in                      xlk121p19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGTTGCGACACTTTTTTTCTTATGTTTCAATTAGGAAGTTTATTCAAATTTGAAAACATTTGCTCTTTGCTTCTACTGATTTGCTGAAGTTGCTTAATAAACTTTCTGTAAAACCTATTCCCACAGCTGTAAAACAATAGCACCTATCGAAAACCTCCAATGTTCAACATTTATTTATTCAttttttttATGGCACTGAAATGTACAAGCTGAACTTCTGTCTTTGTACATAATTAAAAATGTTGCTCTTCaaaaaaaaaa
  3   1   2       bld He1       in                    IMAGE:4407897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCACTGAAATGTACAAGCTGAACCCTTCTGTCTTTGTACATAATTAAAAACTTTGCTCTTCACTTAGCATTTACTGTTCTTTTTTTTTTCTGAAAAAACTGGTATGTGATCTGTTGTCCAGAATGCTCGGAACCTGGGAATTTTTGGATAAGGGGTCTTTCTGTAATTTGCATGCCTTGGGTCTTCTATACAATTATAAACCCAATAGAATTGTTTTGCTTCAATAAGGATGCAATCCCCATTCCATTTATAGTAAAGAGAGTTTCTACACCAATAAAAATGTGTTTAAATTAATATCCAATAAATCTGGAGTTGCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)