Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012767698 Xl3.1-IMAGE:8533420.5 - 170 ESTs
                                                                       -60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8533420.5                                                             CATCTTGCTGTCACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATCT
                                                  Xl3.1-CHK-1012685239                                                                   GCTGTCACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACAxxGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAACGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAxGxCGCTTGCAGAGAGATGTGAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATCTCTTCTT
                                                      consensus depths                                                                  4     9     8    18    19    29    50    56    62    64    72    75    75    78    75    79    76    79    76    79    76    79    77    80    77    80    76    80    78    81    79    82    79    82    79    82    81    84    81    85    80    85    82    85    83    86    84    86    84    87    85    87    86    88    85    88    85    89    86    89    89    92    91    95    89    95    88    96    91    95    91    96    91    96    91    98    93    99    92    99    95   100    94   100    93   100    93   101    92   100    92   101    85    99    90    99    90   100    82   104    84   103    79   102    77   103    77   103    76   101    73    99    70    98    58    98    60    96    48    93    50    92    45    91    45    91    38    87    41    79    36    75    37    70    39    68    37    64    36    60    34    57    34    54    32    53    31    48    31    45    30    44    30    44    27    44    30    39    31    39    32    40    30    42    31    48    33    48    30    48    32    52    34    56    39    59    37    59    39    60    35    59    37    58    37    56    39    55    40    57    40    57    44    56    44    55    41    54    43    55    48    55    46    55    47    56    49    57    52    60    53    60    53    60    54    61    51    62    29    62    53    62    50    62    56    64    55    64    55    64    57    64    55    63    53    62    45    57    45    52    48    49    45    49    43    46    41    45    42    44    41    44    43    44    43    44    44    45    45    45    45    45    44    45    43    45    33    45    32    45    32    45    30    45    28    44    29    42    29    43    28    42    27    42    27    42    27    42    26    42    25    42    24    42    20    41    12    32     9    28     9    23     7    20
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCAGTGATACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGACGCATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTTGGTTTTGTTTTGAAGCCGAAAATCC
                                                                   SNP                                                                                     -----C-T----
                                                                   SNP                                                                                                 --T---------
                                                                   SNP                                                                                                                                                 T--A--------
                                                                   SNP                                                                                                                                                                                                             C-----------
                                                                   SNP                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                             C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                 ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                             ---G-----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                         ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                 ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------C-A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G--------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------CA--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A--------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C-----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A-----G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C--T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------G--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A--C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A-T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----GT------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T---C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         A-----A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                               BLH ATG      45    2503                                                             
                                               BLH MIN      45     410                                                             
                                               BLH OVR      45      76                                                             
                                               CDS MIN      45      32                                                             
                                               EST CLI     -21      32                                                             
                                               ORF LNG      45       7                                                             
  5   1   2       bld Em10 5g                         IMAGE:8321652.5p GTGACGTCACGAGCATGTGACGGCGCGGGGAACGTCTCTGCGACCCCTCCCATTGGTAGCCATCTTGCTGTCACTCTGTGCGGAAGTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATACCTATTTCACAA
  5   1   2       bld Te1  5g                         IMAGE:6928877.5p                         GGGCCCAGCGGCTTTCTTCCCTCCCATCTTGGTAGCCATCTTGCTGTCACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCANGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGGAGTTACTCATGTCATTCCCTGTTGGCTGNAGGGTTATGTCATTTGGCAACCTGCATTTAAAACACTTCCCTATTTGCTGGGC
  5   1   2       bld Te1  5g                         IMAGE:6929659.5p                         GGGCCCAGCGGCTTTCTTCCCTCCCATCTTGGTAGCCATCTTGCTGTCACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACAATTCCTATTGCTGGGTCGGGGACATAAACCCTATTTTCATAACAGCCAAGTTC
  5   1   2       bld Tail 5g                         IMAGE:8543595.5p                                      AAAAAAANNNCCCCAAGTTNNNGNNGAGACATCATAANATTCGTCCGAAGTTGCTTCTCCCTAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTT
  5   1   2       bld Int2 5g                         IMAGE:8821027.5p                                         CTCGGGCCAGCGATAGGGAGGAGGCCCAAGATACGAATTCGTCCCGTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGATAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGTATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGTTCAGCTATGTGTGCCCGGATTTAGTTAAAGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTTCAGCATTGGATTGTTTGGCC
  5   1   2       bld Int2 5g                         IMAGE:8821607.5p                                           TCCGGGTTCATTTTAGAAGATCCCCTAAAATACAATTCGTCCCGTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAATTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGCAAACTGCCAAGCTGTGAAGAGAGTCAGCTATGTGTGCCGATTTAGTATGATTTAGCAATATGATACTGATGTGCTATGTATCCACCAGTACCAAGGATGATGCAGTTCTAGAGATCAGCATGATGTGGCTATGAAGCGCT
  5   1   2       bld Ga15 5g                            XL407f09ex.5p                                            CTCCCATCTTGGTAGCCATCTTGCTGTCACTCTGATGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCANAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGG
  5   1   2       bld Int2 5g3  in                    IMAGE:8822146.5p                                                  ATAAAATTTTTATGGGATAACATTACTTATTTTATATAGTCCCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCGGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTCCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCGATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTTGGAAACTGCCAAGCTGTGATGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGAATTTAGCAATATGATACAGATGGTGCCAAATGATCAAACAGTTACATGGGGTTAATGCAGTTCTAAGATGATCAGCATCGATGTTGCTATGAACGCTTCTGGGACTGAATCTTTTCATCAGTTTGGCAATCCGATTCACCAACATCCTGAGGTAAATGAAAGTGATCCAAACGTGCT
  5   1   2       bld Em10 5g                         IMAGE:7983416.5p                                                           GCCATCTTGCTGTCACTCTGTGCGGAAGTTGCTTCTACCCTAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCACCTGAGCAATCCCTGGAACTGCAAGGCTGTGAAGGAGAGGTCACTATGTGTGCCGGATTTAGTTAGGAATTAGCAATATGAACTG
  5   1   2       chi Tad2                            IMAGE:6875053.5p                                                              ATCTTGCTGTCACTCTGTGCGGAAGTTGCTTCTACCCTAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGNGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTATACACGTCATTCCTGTGGCAGAAAGTTACGTCATTGGCAGCTGCATTTAACACCTTCCTATTGCTGGGCGGGACATAACCCTATTTCACACAGCAAGTTACTCCCGGGGAACGAAAAAGTGGGGAAATTCCCCCTGGAACCAATCCCCTGGGAAAACCTGGCCCAAGGCCTGTTGAAAAGAAGAAGGGTTCCACCCTATGGGTGGTGGCCCGCGGGATTTTTTACTTTATAAGAAAAATTTTTGCCCCAAATTTA
  5   1   2       bld Tail 5g3  in                    IMAGE:8542200.5p                                                               GAGTTACTAAATAAATTCGTCCCGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCGGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTCCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAACACATTCCGATTGCTGGTCGGGAATAACCTATTTCATCAGCAGTTACTCCGGGATAGAGAGTGGGATTCCACTGAGCATCCCTGAAAACTGCCAGCTGTGAGGAGAATTTGCTACTTGTGCCCGATTAGTTAGGATTTACCAAATGAACGTATGTGCAATGATCAACATACTGGGGT
  5   1   2       bld Int2 5g                         IMAGE:8825220.5p                                                               TTTTTATAAAAAATTGAATTCCTTAACTTAATAAATTCGTCCCGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCCAAGCTGTGAAGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGAATTTAGCAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGTGAATGCAGTTTCTAGAGAATTCAGCATGATGTGCTATGACCGCTTCTGGGCCCGAAATCTTTTTCATCGAGTTGCAATCGAATTTCCACAGCATCCTGAATGGGATGAGTATCAAGCTGCCCTATGAGGTTCGC
  5   1   2       bld Tad1      in                    IMAGE:6878368.5p                                                                GGGGCTGTCACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGGCGGGACATAACCTATTTCATACAGCAGTTACTCGGGGATAGAGAAGTGGAAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGACTGTGAAAGGAGAAATTTAGCTACGTGTGGCCCAGATTTAGTTTAAAGGAATTTAAGCAAAATATG
  5   1   2       bld Lmb1 5g                         IMAGE:8534120.5p                                                                   GGGAGTCTCGATTGAATTGTCCCGCTTCACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTCAGCTATGTGTGCCGGGATTAGTNANNGAATTAGCAATATGATACTGATGTGCTAATGGATCAA
  5   1   2       bld Int2                            IMAGE:8529158.5p                                                                     AATNNNCCCACTGTGGCGGGAAGAGCATAAATAAAATTCGTCCCCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGTATTCCTCCTGAGCATTCCTGGGAACTGCCAAGGCTGTGAATGAGAAATTTACTACGTGTGCCCAGATTAGTTTAGGATTTATCAAATATGAACAGATGGTGCCAATGG
  5   1   2       chi Tad1                            IMAGE:6937675.5p                                                                      GGGACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAACCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTTGAATACACCAGAAAACAGGGGAATACACCTGGCTGAAATCATGTTTGGAATCTTTTCAATGGTTCCAGGAATTTGTACATTGGCTTGTTCAGGGCTGTTTCTTGGCTCTGGGCTGCCTTCCCTGGAATTTTCTCGAACAGGGGGGGTAAAAGCGTCACAACCTTCACTGGGGCACCTGTTCCATTAAAACCGGTGGCCGAATGGGAATTTTACCTCAATGTTCCATTCCCTGGTGGGTCTTGAAAAGGTTTAATGCTCCATTGGGACCAGCCTTGCCCATTTAAAACCCACCTTTCCCCTAATTGGCCTTGGGTTCCGGGGGGACCCCTAACCCCTAATTTTTCA
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3581392.5p                                                                        CCGGGGCCCGGGGAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGTTGCTTCCTGG
  5   1   2       bld Tad2      in                    IMAGE:6873758.5p                                                                         ACTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGGGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTTCCTAATTGCTGGTCGGGGACATAACCCTATTTTCGTACAGCAGTTTACTCCCGGGGATAAGAAAAATGGGGGAATTTC
  5   1   2       bld Emb4 5g                         IMAGE:5515448.5p                                                                          CTCTGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACTGAGCAAATCCTGGAACTGCCAGGCTGTGAGGAGAAATTAGCTCGTGTCCCAGATTAGTAANGAATTAGCAATATGTACAGATGTGCAAATGATCAACAGTACTGGGGGTAATGCAGTTCT
  5   1   2       bld Te1  5g                         IMAGE:6930626.5p                                                                           GGGGTGCGGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAAGTTATGTCATTTGGCAGCTGCATTTAAACACATTTCCTATTTGCTGGGTCGGGGAACATAAACCTTATTTTCATT
  5   1   2       bld FaB  5g                         IMAGE:8074246.5p                                                                           CTCTGTGCGGAATTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACTGAGNCATCCTGGAACTGCCAGGCTGTGAGGAGAATTAGCTACTGTGCCAGATTAGTTAGGATTAGCAATTGATCGATGTGCA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174581.5p                                                                               GAAGGAAGTTGCTTCTACCCTAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAAAAAACAGGGAATACACTGGTGAAATCATGTTTGAGTCTTTCAAATGTCCAAGACTGTACATTGGTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGA
  5   1   2       bld Te2N 5g3  in                    IMAGE:7765439.5p                                                                                  GGAAGTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAATTACTCCGGGACAGAGAAGTGGGAATTCCCCTGAGCAATCCTGGAAATGCCAAGCTGTGAGGAGAGGTCACTATGTGGCCCGGATTAGTTAGGATTTAGCAAATGATCTGATGTGCTAATGGATAACTAACACGGGGAATCGGTTCAAAGGAACCCTTTGGTTGGTTTACCTCCGGGGCAAACTTTTC
  5   1   2      seed FaB  5g3  in                    IMAGE:8069918.5p                                                                                  GGAAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTT
  5   1   2       bld FaBN      in                    IMAGE:8076090.5p                                                                                   GGAGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGAATAACCTATTTCATACAGCATTACTCCGGATAGAGAGTGGGATTCCCCTGAGCATCCCTGAAACTGCCAGGCTGTGAGGAGAATTAGCTACTGTGCCAGATAGTTANGATTTACAATATAACGATGTGCAA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4963120.5p                                                                                    AAGTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAAGGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATT
  5   1   2       bld Brn1 5g                         IMAGE:6949912.5p                                                                                     TTTCGGGATCTCTCCCCGACTGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGGACAGAGAAGTGGGGAATTCCCCCTGAGCAATCCCCTGGAAACTGCCAAGGCTGTTGAAAGAAAAGGTTCACCTATGTGTGCCCCGGGATTTGGTTAAGGAATTTAGCAAATATGATACCGAATGGGGCCAAATGGGTTCAAACAGTTCACCggggggggAATGCCGTTTCCTAAGAAAGAATTCCAGCCTTGATGGTTGGCCTACCAAGCCCTTTCCTGGGGGCCCGAAAATCTTTTTTCATCCCGAGTTTGGCCAATCCCAAATTTC
  5   1   2       bld Lmb1 5g                         IMAGE:8533420.5p                                                                                     AGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCCAGGCTGTGAAGGAGAAATTAGCTACGTGTGCCCAGATTTAGTTAGGATTNAGCAATATGATACAGATGTGCCAATGATCAACATACATGGGGTTATGCAGTTCTAGAAGAATCACATCGATGTGCTAGACGCTCTGGGCTG
  5   1   2       bld Thy  5g3  in                    IMAGE:8549139.5p                                                                                     AGTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATCCACCTGAGCAATCCCTGGAACTGCCAGGCTGTGAAGAGAATTTAGCTACGTGTGCCAGATTTAGTAGGAATTAGCAATTGATACGATGTGCAATGGTCAACGTACTGGGGTATGCATTCTAGAAGATCACATCAGTGCTAGACCTCTGGGCTGATCTTTCTCAAGTGCATCAATCCCACCTCCGATGTATATTT
  5   1   2       bld FaBN 5g                         IMAGE:8077668.5p                                                                                      GTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACTAACCTATTTCAACAGCAGTTACTCCGGGACAAGAGTGGGATTCCCCTGAGCATCCTGGAAATGCAACTGTGAGGAAGGTCACTATGTGTGCCGTTAGTANGAATTACAATATATCGATGTGCAATGATAAATACCGGG
  5   1   2       bld Int2 5g                         IMAGE:8529756.5p                                                                                      GTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGGCCAGATTTAGTTAANGATTNAGCAAATATGATACAGATGGTGCCAATGGATCAACAGTACATGGGGGTTATGC
  5   1   2       bld Int2 5g                         IMAGE:8529697.5p                                                                                      GTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAGGCTGTGAAGGAGAAATTAGCTACGTGTGCCCAGATTTAGTAAAGGAATA
  5   1   2       bld Thy  5g                         IMAGE:8547158.5p                                                                                      GTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTAGCTACGTGTGCCCAGATTTAGTTAANGAATTAGCAATATGATACAGATGGTGCCAATGGATCAA
  5   1   2       bld Thy  5g                         IMAGE:8550214.5p                                                                                      GTTGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGTTATGTCTTGGCACTGCATTAACACTTCCTATGCTGGCGGGACTAACTATTTCTACAGCAGTACTCGGATAAGAGTGGAATCACTGACATCCTGGACTGCAGGTGTGAGAAATTACTCTGGCAGATTAGTAGATACAATGAAGATGGCAAGTCACGACTGGTATGATCTAAGATCCTCATGTATACTCGGCGACTTCTCATGCACATCCACTCGATGAGAGCAGCATGTGCTGAATGTCGGC
  5   1   2       bld DMZ  5g3  in                         xl231m18.5p                                                                                      GTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAAGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAG
  5   1   2       bld DMZ  5g3  in                         xl318c01.5p                                                                                      GTTGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAAGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGT
  5   1   2       bld Sp1  5g                         IMAGE:5507204.5p                                                                                        TGCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTCAGCTATGTGTGCCCG
  5   1   2       bld Ov1  5g                IMAGE:6318164-IMAGp.IMAGp                                                                                        TGATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAAC
  5   1   2       bld Ov1  5g                         IMAGE:6318164.5p                                                                                         GATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCCCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAAGAATTTAGCCAATATGATACAGATGGTGGCCAAATGGATCAAACAGTACATGGGGGGGTAAATGGAGTTCCTAAAAAGGAATTCAGCATCCGATGTTGGCTATGGAACGCTTCCTGGGGGCCTGAAAACTTTTTTTCCTTCCAGAAGTTTGGCCAATCCCAAGAATTCCACCCAACCCCATTCTCTGTAAGGGGGTAAATGAAATGAATTCCAAAACTGGCCCCTATTTGAGGTTTCGGGCGCCCCACTGGGTACACAGAATATTGGGAACCCTCTTggggggggCCCCACCTATTGGTTCCGGGGAATTTCGGGGCGCCCCT
  5   1   2       bld Emb9 5g                         IMAGE:7978230.5p                                                                                         GCTTCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGGTGCTAAATGGATCAAAACAGTACACAGGGGGTGAATGCAGTT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174214.5p                                                                                          ATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATGTCATACAGCAGTTACGTCCGGGATAGAGAAGTGGGAATTTTCACCCTGAGCAATCCCTGGAA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4173561.5p                                                                                          CTTCTACCCTAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGTGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGACCACAACCTGAAGATCATTACTTCCTCCTGACTGAACCCTCCCTAAACACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTCGAGTTTCTCAATGTTCCACGACTGTACATTGCTGCTTAGGCTGTTCTTGCTCTGGCTGCATTCTGGACTCCTCCACACGTGGGAGAGCGCACCCTCACTGGC
  5   1   2       bld Int2 5g                         IMAGE:8531182.5p                                                                                          GCTTCACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGNAGCATCCCTGGAACTGCCAAGCTGTGAAGGAGAAGTCAGCTATGTGTGCCCGGATTAGTNANGATTNAGCAATATGATCTGATGTGCTAATGATCAACAGTACCAGGGTGATGCAGTCTAGAAGAATCACATGATGTGCTATACGCTCT
  5   1   2       bld Thy  5g3  in                    IMAGE:8550272.5p                                                                                          ATCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCAATTGCTGGTCGGGACAAACCCATTTCATACAGCAGTTACCCGGGATAAGAGTGGGATTCACTGAGCATCCGGAACTGCAAGCTGGAAGGAAATTAGCTCTGTGCCGATTACTAGATTTACAAATGTATATGTGTATGTAAAATTCAGGGTATCTCATAAAGATTATCTGGCTATATCTCGGGTGAATTTAAGGTTCCTAATCA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4970082.5p                                                                                           TCCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAGGAATTTAGCAAN
  5   1   2       bld Int2 5g                         IMAGE:8530114.5p                                                                                           CTTCACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCACCTGAGCATCCCCTGGAACTGCCAAGCTGTGAANGAGAGTCAGCTTGTGTGCCGGATTNAGTANGATTAGCAATATATACGATGTGCTATGATCACAGTACCGGGTGATGCGTCTAGAAGATCACATGAGTGCTATACCTCTGGGCGATCTTTCTCGAGTGCATCGATC
  5   1   2       bld Spl  5g                         IMAGE:8461282.5p                                                                                           CTTCACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCACCTGAGCATCCCTGGAACTGCCAAGCTGTGAAGAGAGGTCAGCTATGTGTGCCGGATTAGTNANGATTTACAATATATCTGATGTGCTATGATCACAGACCAGGTGATGCGTCTAGAAGATCACATGAGTGCTATACCTCTGGGCGATCTTTCTCGAGTGCACGATCACGCTCCGATGGAATATCATGCATATCGCATGAGATG
  5   1   2       bld Emb4 5g                         IMAGE:5543280.5p                                                                                            CCTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGGATAGAGAAANGTGGGAATTCCANCCTGAGCAATCCCTGGGAAACTGCCAAGGGCTGTGAAAGGAGAAATTTAGCTACGTGTGCCCAGNATTTAGTTAAGGGATTTAGCAAAATATGATACAGATGGTGGCAAATGGATCAACAGGTACATGGGGGGGTTAATGCCAGTTTCTAAGAAGGAATTTCAGCCATCCATGTTTGGCTAATGAACGCTTTCTTGGGGGNCCTGAAAACCttttttttCATCCCAGAAGTTTTGCCAAATTCCAGAAG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075877.5p                                                                                            TCCTACCCCGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTTCACTGAGNCATCCTGGAAACTGCAAGGCTGTGAAGAGAATTTACTCGTGTGCCAGATTAGTTAGGAATTACAATATGAACGATGTGCAATGGATAACATACT
  5   1   2       bld Ga15 5g3  in                       XL446b16ex.5p                                                                                             CTACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTANCTACGTGTGCCCAGATTTAGTTAAGGAATTTANCAAATATGAT
  5   1   2       bld Spl  5g3  in                    IMAGE:8463324.5p                                                                                             TTNTCCCCGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCCGGACAGAGAAATGGGGATTCCACCTGAGCAAACCCTTGGAACTGCCAAACTGTAGATGATAGGTTCAACTATGTGTGCCCGGAATTAG
  5   1   2       bld Int2 5g                         IMAGE:8530864.5p                                                                                             CNACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAATATG
  5   1   2       bld Eye1 5g                         IMAGE:4755458.5p                                                                                              TACCCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGC
  5   1   2       bld Tbd7 5g                              XL099p02.5p                                                                                                GCTAGNACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTT
  5   1   2       bld Ooc3 5g                         IMAGE:3437230.5p                                                                                                 CCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTCTGTCATTTGCAGCTGCATTATACACATGCCTAGTGATGATCGTGACATAACCTATTAGCTTCACGCAGTACTCCGGATAAAGAAGTGGGAAGTGCCATCTGAACGTGCC
  5   1   2       bld Te2N 5g                         IMAGE:7767089.5p                                                                                                 CCCAGACATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTATGTCATTGGCAGCTGCATTAACACATTCCTATTGCTGGTCGGGAATAACCTATTTCATACAGCATTACTCCGGGAAGAGAATGGGATTCCCCTGAGCATCCTGGAACTGCCAGCTGGAGGAGAATTTACTCTGTGCCGATTAGTANGATTACAATTGACAATGTGCAATGATCAACGA
  5   1   2       bld Ga18 5g3  in                      xlk140c05ex.5p                                                                                                  CCCCAGACATGGCGGCTCGNTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGNNNNNNGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGNTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGNGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGNTATGTCATTGGCAGCTGNATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGANNTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGNTAAGGAATTTAGCAANNATGATACAGANGNNGCCAAATGGNTCAAANAGTANNNGGGGNNANNNCAGTT
  5   1   2       bld Oo1  5g                         IMAGE:5085434.5p                                                                                                   CACGCGTCCGGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGGTTGGCTATGAACGCTTTCCTGGGGCCCCTGAAATCTTTTTTTCATCCCAGAG
  5   1   2       bld Neu7      in                         XL035a06.5p                                                                                                         GGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAG
  5   1   2       bld Em10      in                    IMAGE:7983251.5p                                                                                                          GGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAAGAGAAATT
  5   1   2       bld Em10                            IMAGE:7979245.5p                                                                                                          GGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATCCACCTGAGCATCCCTGGAACTGCAAGGCTGTGAGGAGAATTAGCTACGTGTGCCAGATTTAGTAAGAATTACAATTGATACAATGGTGCAATGGTCAACGTACTGGGGTATGCGTTCTAAAGATCACATCAGTGCTAGACCTCTGGGCTGATCTTCTCAAGTTGCACGATCCCACCCCGATGTAGATACAATGCTTGTT
  5   1   2       bld Panc                            IMAGE:8737614.5p                                                                                                          GGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAGCTGTGAAGGAGAATTTAGCTACCTGTTGGCCAGATTTAGGTAGATTTAGCAATATGATACAGATGGGTGCCAATGGATCAACGTACATGGGGTATGCAGTTCAGAGGATCAGCATCGAAGTTGCCTTGAGCTCCTGGGCTGAAATCTTTTCATCCGAGTTGCCATCCGGAT
  5   1   2       bld Te2       in                    IMAGE:7390372.5p                                                                                                           GCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTNGAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAGGGATTTAGCAATATGATACTGATGGTGCTAATGGATCAACAGTAACANGGGTGATGCAGTTCTAGAAGGATCAGCATGATGTTGCTAGACGCTTCTGGGCCCGATCTTTTCATCAAGTTT
  5   1   2       bld Ga18      in                      xlk164n09ex.5p                                                                                                             GCGGCTCGNTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGNNNNNNGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGNTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGNGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGNATTAAACACATTCCTATTGCTGGTCGGGNNATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGNGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGNNTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGNTAANGNATTTAGCAAATATGATACAGANGGTNNCAAATGGNTCAAACAGTACANGGGGGTTAATNC
  5   1   2       bld Neu7      in                         XL019o05.5p                                                                                                              GCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACA
  5   1   2       bld DMZ       in                         xl253d11.5p                                                                                                              GCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACA
  5   1   2       bld DMZ       in                         xl225b03.5p                                                                                                              GCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAG
  5   1   2       chi Em10                            IMAGE:8317785.5p                                                                                                                TCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGANCAGCCCACATATGCAACTAGTTGGCCCATTCGCCATGGGATTGTCCAAAACTGGGACCTCATGAAGAAATTCCTGAAAACAAATTTCCTTCAAATTATTCCAAACCAAAACCCGGAAGATCCTTTCTTCCCCCCTAATGGAACCCCCCTTGAATTTCCCCAAAAAACGGGGGAATACCCGGCCGAAACAcagttttaaaaacttttccaagttccccagaaatttaaattttgtttttcaggggtttttttttCTGGGGGGCTTCCCCGGGATTTTCCCCAACGGGGGGGAAAAcccccccccTCGTGGGGGTTTTTTATAAAAAGGGGGAAGGGGAGTCCCTCCTGTTTCTTCTCGGGGAGAAAAGttttttttttttggccccctttaaaaaacatttctttttgggggggggaaaaatttttttttatacatttttctccgggaaaaagaggggttttcttcccacccccccaaaatcagggggggggaaaaaaaaaacctccccccccccacttttataaaaaaaaaaaaa
  5   1   2       bld Int2                            IMAGE:8530096.5p                                                                                                                 CGGCTCCCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCAAAGCTGTGAAGGAGAGGTCAGCTATGTGTGCCCGGATTAGTNANGGATTNAGCAATATGATACTGATGTGCTAATGATCAACATACCAGGGTGATGCAGTCTAGAAGAATCACATGATGTGCTATACGCTCTGGGCCGATCTTTTCTCGAGTGCATCAATTCACGCATCCGATG
  5   1   2       bld Neu7      in                         XL046d03.5p                                                                                                                    CCGGCTTGTGTGGTGGNTTGTGGCACTGGNTACACCAAACTTGGNTATGCTGGGNAATACAGNAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGNATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGA
  5   1   2       bld Ga14                               Ga14-p5c10.5p                                                                                                                    ATCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAA
  5   1   2       bld Kid                             IMAGE:7008600.5p                                                                                                                       CCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTT
  5   1   2       bld FaB       in                    IMAGE:8069901.5p                                                                                                                       CCGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGATTTTAGCAATATGATACTG
  5   1   2       bld Em10                            IMAGE:7979251.5p                                                                                                                        CGGCTTGTGTGGTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAGGCTGTGAAGGAGAGGTCAGCTATGTGTGCCCGGATTAGTTANGATTTAGCAATATGATACTGATGTGCCAATGATCAACATACCAGGGTGATGCAGTCTAGAAGAATCACATGATGTGCTACACGCTCTGGCCGATCTTTCTCAAGTGCATCAATCACACCTCCGATGG
  5   1   2       bld Int2                            IMAGE:8528605.5p                                                                                                                         GGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCAAGGCTGTGAAGGAGAATTTAGCTACGTGTGCCAGATTAGTTAAGATTTTNCAATATGATACAGAGGTGCAATGGATTAACATACTGGGGTTATGCATTCAAATGATTACATCATGTTGTTAACCTCTGGGCCGTATTTTTCTCTATTGTCTCAATTCCCACCTCTGATGAAAATT
  5   1   2       bld Lu1                             IMAGE:4056827.5p                                                                                                                           CTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATATACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAGAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCACGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACATGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAAGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCCGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACT
  5   1   2       bld Brn1      in                    IMAGE:4740384.5p                                                                                                                                 TGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGTTTTTGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATC
  5   1   2       bld Em10      in                    IMAGE:7982013.5p                                                                                                                                   GTGGATTGTGGCACTGGATACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGNAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAANGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACAC
  5   1   2       bld FaB       in                    IMAGE:8070126.5p                                                                                                                                       GATTGTGGCACCGGGTACCCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAATTACTCATGTCATTCCTGTGGCTGAACGTTATGTCATTGGCAGCTGCATTAACCACATTCCTATTGCTGGTCTGGACATAACCTATTTCATACAGCAGTTACTCCGGGGTAGAAGAATGTGAATTCCCACTGAGCAATCCCTGGAAACTGCAAAGCTGTGAAAGCAAAATTTAACTACCTGTGCCCAGATTTTATTAGGGATTTACCAATTTGATACAGATGGGGCCAAT
  5   1   2       bld Lmb1                            IMAGE:8534676.5p                                                                                                                                                                                           GTTCATCATCCCATCATGCATTGCTATCAAGGAGTCGGCCAAGGTGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGATAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGTATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAANGATTTAGCAATATGATACTGATGGTGCCAATGGATCAACAGTACACGGGGTGATGCAGTTTCTAGAAGAATCAGCATGATGTGGCTATGACGCTTCCTGGCCTGAATCTTTTCATCAGAGTTGCCATCAGATTCACCAGCATCCTGAGTGTGGAGAGTATCNAACTGCTATGAGTCGCGCC
  5   1   2       bld Tail                            IMAGE:8545834.5p                                                                                                                                                                                                                                GGCCAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGAGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTCCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCGATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAAGATTCAGCATCGATGTGGCTATGACGCTTCTGGGGCTGAATCTTTTTCATCAGAGTTTGCATCAGATTCACCACCATCTCGAGTGTAATGAGTGATCAACTGCTATGACTCGCGCCCTGACAATATGACCTCGTGTCCTAGTCGGATCGATCCTGCAAAG
  5   1   2       bld Em10                            IMAGE:8318610.5p                                                                                                                                                                                                                                       TGGGAGACCAGGCTCAAAGGCGCCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGG
  5   1   2       bld Tad2                            IMAGE:6931648.5p                                                                                                                                                                                                                                                                          GGGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCANACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCCGCATTGATGTTTGGCTACGAAGCGCTTTCCTGGGGGCCCGAAAATCttttttttCATCCCAGAAGTTTTTGCCAAATCCC
  5   1   2       bld Tad2      in                    IMAGE:6872741.5p                                                                                                                                                                                                                                                                              ATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTGGAAGATTGGGATCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAAAAGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCAGCTTCCTGGAGGCCCCGAATCTTTTTTTCATCCAGAAGGNTTGCCAATCCCAGATTTTCACCCAGCTCTAGTGN
  5   1   2       bld Int2                            IMAGE:8824425.5p                                                                                                                                                                                                                                                                                               CCCAGGCCGGTCACCTAGGAGCCCCCCCACTCCAATTCGTCCCGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTCCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCGATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGACGTTCGGCGCCCACTGTACAAGATATTGTACTCTCTGGTGGGTCCACTATGTTCCGGGATTTCGACGTCGCTTGCAAGAGATGTGAGAGACAGTTGATGCCCGGTTGAAGCTGGACGGAGGGAGTTGGAGTGGGGTGGTCG
  5   1   2       bld Tad2                            IMAGE:6931402.5p                                                                                                                                                                                                                                                                                                                            GGATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAAGAATTCAGCATCGATGTTGGCTATGAACGCTNTCCTGGGGCCTGAAATCTTTTTTTCATCCAGAGTTTGCCCAATCCAGAATTTCACCCCAACCCCATTCTCGGGGAAGTGGGTAAGATGGAAAGTGTATCCCAAAAACTGGCCCCCTATTTGGAC
  5   1   2       bld Spl                             IMAGE:8462603.5p                                                                                                                                                                                                                                                                                                                                                         GGATTGTGGAAGATTGGGACCTCATGGAGAGATTCATGGAACAAGTTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCNAACTGCCCTATGATGTCGGCGCCACTGTACAGAATATGTACTTCTGGAGGTCACTATGTCCGTGATTTGAANGCGCTGCAAGAGATGTAGAGACATGATGCCGCTGAGCTACGAGACTGATGGGTCTCTAGCCAGCATGAGTCAGGAACATCCTCAAGTACGATGTG
  5   1   2       bld Spl                             IMAGE:8462716.5p                                                                                                                                                                                                                                                                                                                                                                          AAAGNNNCCAATCCTTNGCAGATCCATCGATTCGAATTCGTCCCCAGAGCAGAACCTGAAGATCATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCACTATGTTCGTGATTTNGAANGCGCTGCAGAGGATGTAAAGAGACAGTGATGCCNGCTGAGCTGACGAAGACTGAATGGGGTCTCTAAGCCCAGCCATGATGTCAGTGATACCATCCATCAGAGTATCTGATGTCGAGATCTGCTGCTCAGCCGAATTACATGGT
  3  -1   2       bld Tbd4                            IMAGE:4060302.3p                                                                                                                                                                                                                                                                                                                                                                                                  CTTTGGCAGATCTGAATTCCCCGGGGCAGAACCTGAAGACATTACTTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAG
  5   1   2       bld Spl                             IMAGE:8460287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCNGGNATTCNGACGTCGCTTGCAGAGAGATGTGAAGAGACAGTTGATGCCCNGTTGAGCTGAGCGAGAAGTGAGTGGTGTCGTCTTAGCCCNAGCGATGATGTCAGTGATACCATCCATGCAAGTATCTT
  5   1   2       bld Thy       in                    IMAGE:8550362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCTGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCNGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTGATGCCCNGTTGAGCTGANNCGAGAGTGAGTGTGGTCGTCTTAGCCCAGCCGATGATGTCAGTGATACCATCCATCAGAGTTGCGTCTGGTCGAGATCAG
  5   1   2       bld Lmb1                            IMAGE:8535555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATCACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGACGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGACAGTTGATGCCCGGTTGAACTGAACGAGAGCTGAGTGGTGTCGTCTTAGCCCAAGCGATGATGTCAGTGATACCATCCATGCAAAGTATCTGCTG
  3   1   2       bld Ga18 5g3  in                      xlk140c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                      CTNANATCNNNNNCCTNCTGNCTNNNCCCCCCTTGANTNCNCCANAAACANGNNTNNNNCTGCTGAAATCATGNTTGAATCNTTCANTNNTNCAGGNTTGTACATTGCTGNTCAGGCTGNTCTTNCTCTGGCTNCTTCCTGGACTTCTCGACAGGTGGGAGANNNNANACTCACTGGCACTGTCATAGACAGTGGCGATGGANNTNCTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATNCCTATTGCTGNTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGNATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACNNNNNGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGNCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGNNNNGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGNNNCCAGGCTTGGAGGAGCTCATTAATNTCTCTTTGCACAGGTGGAACCCAGGCAGNTTCTTTTTGATGACTAATTNTGA
  5   1   2       bld Ga18      in                      xlk124m04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGNGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGNGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGNTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGNCGCTTGNAGAGAGATGTGAAGAGAANAGTTGATGCCCGNTTGAA
  5   1   2       bld Brn3                            IMAGE:8539368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCTCTTGACTGAACCCCCCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAACGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGNCGAGAGCTGAGT
  5   1   2       bld Em10                            IMAGE:8321612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTAAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAGTCTTTCAATGTTCCAGGACTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGC
  5   1   2       bld Neu7      in                         XL050p17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGAATACACTGCTGAAATNTGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCT
  5   1   2       bld Sp1       in                    IMAGE:4175608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTT
  3   1   2       chi Tad1      in                    IMAGE:6878368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATACTCCCAGGGCGAGTCAAATACGACACATAAGACGCCGCGGATAATTTGCTCACACTCACCCGAGACCGAGCTCGTGTTTTGATTATAATAAGATAATTTAGACAGGAGTGGACAAACCACGCTTATCCTCCCTTGAGAAGATTTGATGCTTCCTCCTGCATAATCGTGATATCACTGTATTCAGTTTGGGCAAATCCACTCACACGCGTGTTTACTACCCTAGGGAGAAAATTGCGTTGTATGCGATCGTCATATAGGGANCACGGACGGCGAAAATATGTTTCCCCCCAACAAATTATAGGAGTTTGTCCCAACTAGTAGGAAATATGACCAAACACATAGGAAACAACTTATTCCTGACATTAATATTNCACTCTTAGTACACAAACACACATCGGTTTTCTCGCTCTTCTTATCGTTATNTTCCCGAAACATCATCTATACTTGATTGTACCTCNACCGCGGTCACTATTATAATATAGCTGACTTTCTTATTNCTCCTCCCTTCATGGACAGAAGATGATTCCTTACCCGGGCTGGCGGCCGCGCGTGATGGACGTCGATGGGCNGCGTGCCTCTCGCGTGACGTCCCCGTAATATTTATAATTAGTAGTACGTGGCAGGTAGATTTTTATCCCCTCATTCCTCCATTTTCGCGAAGTAGCTTATAGTGACGGTTTCCAGGATATTCCCCGCCCGTCATCCCTAGATTTAGGGCCCTGCCCATCCCCCCGGCAAATTTTTACCACAAGGTGTGGCCCAGCACCCATAATAATTGATTTTATCGGGGAAAATAGGAGCCGTAGCTTTTTGTTCGCCAGCAACACCGTTGTTTGGAATTCGACTCATAATTCCCTTGCAGCGGCGCATAAGTTTTGGTGGGCAGATCCGCAGGGCGGGTCAGGTCAACGTCCGCCCAGGCTTTCATGGAGCTCATTAATGTCTCTTTGCACGGGTGGAACCCAAGCAGATTCTATTTGACGACTTAATTGTTGATTAAAAGAACCTAGTGGCTATTAGTTACCTGTGCCATGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGTCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTATGAACCGGAAAAACCCACCCGTTGTGCTCATTTCCTTCTATAAATTCCTTTATTATGTTGTTATCGAAGAATGGA
  5   1   2       bld Ga12                                 XL214e23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCTGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGA
  5   1   2       bld Kid                             IMAGE:4033063.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGGCTGTTCTTGCTCTGGCTGCATCCTGGACTTCTCGACAGGTGGGAGAGCGCACGCTCACTGGCACTGTCATAGACAGTGGTGATGGAGTTACACACGTCATTCCTGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCANGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCCAAGAAGGACTCATGAAGAGATTGGGCCCGAGCATATGTCGCCCACAACCCCGGTGGTTCGGNGGTCATGGCCCTTAATCCCCGTGTTGGCCCGACGCCAT
  3   1   2       bld Int2 5g3  in                    IMAGE:8822146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCTCTGGTCTCGATTGCCTTCCTGAACTTTCGACAGGTGGGAGAGGCGCACATTCACTGGCACGTTCATAGACAGTGGCGATGAGTACTCATGTCATTTCTGTTGCTGAAGTATGTCATGGCAGCTGCATTAAACACATTCCGATTGCTGTCGGGACAATAACTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTTCCACTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGACGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGTGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGATCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTGTGATATTTGAAAAAAAT
  5   1   2       bld Lu1                             IMAGE:4632997.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAA
  3   1   2       bld Tad2      in                    IMAGE:6872741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGTGCAGAGGGTATGTTTGCCGTAAAAGGGAAAATAGAAAGACCAGCGCAAANTGTCACTAACTAACAGAAGGTGAGCGATTAAAGGATGCAAAGGATAGGAGAAAGAAAGCATAATTGAGAGCAAAGCGTTTATTTCACCGGTCGTGAGTAATATTAATTTTTTCCACCGGGGCAATTACGGTGGAATAGTGACAAGGTAATTAGGGGAAGGAAGTTCTAGCTTATGTGTCCCCGGGATTTAGTTAAAGGAATTTAGCCAAATGGGATTCTGAGGGTTCCCAGATGGATCAAACAGTACACCGGGGGGGAAGCGGTTTTTAAGGAAGGAATTCAACATGGATGTTGGTTACAAGCGCTTCCTGGGCCCGGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATTTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGTTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATC
  3   1   2       bld FaB       in                    IMAGE:8069901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGTTCATTGGCACCGTTCATAGACAGTGGTGATGAGTACACACGTCATCTGTGGCAGAGTACGTCATTGGCAGCTGCATAAACACATTCCTATGCTGTCGGGACATAACTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCTAGGCTAGAATATA
  3   1   2       bld Thy  5g3  in                    IMAGE:8550272.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTTAGTTGTGTGTCGATTGCGTGGAGCCTCTGCTTCAGCAGGGAGATATAGTCTCTGTGTGAGTAGTCTGCAGTCATACACATCTATGTGTCGGCATACTATTCTCAGCAGTATCCGGAAGAGAGTGGAATCCACTGAGCATCCTGAACTGCCAAGGTGTGAAGAGAAATTAGCTACGTGGCCCAGATTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGGGAACCCAGGCAGATTCTTTTGTGACTAATGGAAAAGAACTGTT
  3   1   2       bld DMZ  5g3  in                         xl318c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGGCAGAAGGTTACGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAAGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTT
  3   1   2       chi Ga18                               rxlk7f06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGGNAGNNGNTTACGTNATNNGCAGCTGCNNAANCNNNTNCNTANTNCTGGNNGGGANNNNANCTNTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGNAATCCCTGGAANCTNNCAAGGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGANTTTAGCAAATATGATNCTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGNCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCNNNCAGGCTTGGAGGAGCTCATTAATNTCTCTTTGCACAGGTGGAACCCAGGCANNNNNTTTTGATGAANT
  3   1   2       bld Ga18      in                      xlk164n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGCTGAANNTTANGTCNNNNAGCTGCANNAAANNNNTNCCTNNTGCTGGTCGGGACANACCNTNTTTCATACAGNAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTNCNANGGCTGTGAAGGAGAAATTNAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACGGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGNCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGNNNNGNGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCGNCAGGCTTGGAGGAGCTCATTAATNTCTCTTTGCACAGGTGGAACCCAGNCNNNNNNTTTTGATGNCTA
  3   1   2       bld Spl                             IMAGE:8464900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCGTGAACAGTCCGCTTAGCAGGGAGATACCACATCTGGCGAGTAGTCATGCAGTCATAACCATCTATGTGTCGACATACTATTCCACAGCAGTATCNGGACGAGAGTGGAATCCACTGAGCATCCTGGAACTGCAAGCTGTGAAGAGAGTTCAGCTATGTGGCCCGGATTTAGTTAAGGATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTGAGAAATATGTGAAAAGACCGGT
  5   1   2       bld Tad2                            IMAGE:6931565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAAGATCCATGTTGGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCCAAGAAAGACTATGGAGGAGATTTGGGCCCAAGCATTTGTCCGCCACCAACCCCCGTGTTTTGGGAAGTCCATGGTCCCAAATTCCCCTTGGCAGGCGGGCGCCAATAATGGTTTTC
  5   1   2       bld Tad1      in                    IMAGE:6878219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAGGCTGTGAAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGAATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGGATGGGCCGAGCATTTGTCGCCACAACCCCCGTGGTTTGGAGTCATGTCCTAATCCCCTTGCAANCGGCCGCATATTGTTTTTGGAGGGGCTGGTTCTGCAATTGCCGTGGTCAGGAACAACGCGCCGCCCCAGGCTTTTGGAGGGAGCTCCATTT
  3   1   2       bld DMZ  5g3  in                         xl231m18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGACATAACCTATTTCACACAGCAGTTACTCCGGGACAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAAACTGCCAAAGCTGTGAAGGAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAAGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTT
  3   1   2       add FaBN      in                    IMAGE:8076090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTGGTCGGACATACCTATTCATACAGCAGTACTCCGGGAAGAGAGTGGGAATTCCACCTGAGCAATCCCTGAAACTGCCAAGGCTGTGAGGAGAAATTTAGCTACGTGTGCCCAGATTTAGTTAAGGATTTAGCAAATATGATACAGATGGTGCCAAATGGATCAAACAGTACATGGGGGTTAATGCAGTTTCTAAGAAGGAATTCAGCATCGATGTTGGCTATGAACGCTTCCTGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCTGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGTTGAGCGAGGAGTTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTTATCCCATCACATGCAGAGGTATTGTCTGTTTGGTTTGGAGGATCCATGTTGGCTTTCCACGCCGGAATTTTACTCAATGTGTGCCACACCAAGAAGGATTATGAGTGAGATTGGGCCGAGCATTTGTCGCCACAACTCCTGTGTTTGGAGTCATGTCTTAATTCCTTGCAGTCGGCGCATATGTTTTGGAGGGTTGGTTTTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTGCACAGGTGGAACCCAGGCAGANNCNNGG
  3   1   2       chi Tad2      in                    IMAGE:6873758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGCGGAAAAACATGTGGGGTACATGGGGGAAACAGATTGAATTTCCCCCGAAGAAGAGATCTGCCCTCCACTACCATTTTAAATTTTTTTTCCGGGCCGTGGCCACAATAATATGGATTACCCAAATGAGAAAAATTTCTTGGGATAACACTCTCTTTGTTGGGGCAGGGGAGGGGTTTCCACCAAATATTAAGTTTCCCCCAAGGGAGATAATCTTCCTCAAGAACCTGTTCCGAGCCTTTGGCCCCGGGATGACTACTATTGGCCTGCTAAGGGCAGCAATCCCCTTTTTTTGTTATTTCCCCCCCCCTGGGCTTTATCAAAAAGCACTTGCAATACCCGACAAGGGAAAAGCTTCCGGAAATATTGGGGTTCGGGGTTTCGTGTACATTTAAANCGGCCCCCCAAAAGCTCTCGGAAATAGACATTGGTTTTCCCATGGGTGGATTTTATCCCCCCATTCCACCATTGCCAGGAGGGTAATGGCTTGTTCTGGGTTTCCGGAAGGAATCCCATGTTTTGGCTTTCCAAGGCCGGGAAATTTTTCCCCAAGTTGTGCCCACACCATAGAAAGGACTATGAGGAGATTTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTTCATGGTCCTAATCCCCTTGCAGCGGCGCATATGTTTTGGAGGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTTCCTCACCTTGGAAAACACGCCCCCCAAACCATTCATTCACTAGTGACGCTCTCGTAGTNNNGGGGTTTTTGG
  3   1   2       bld Neu7      in                         XL049f21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAGAGGTTCAGCTATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGAACCCAGGCAGAATCCTTT
  5   1   2       bld Neu7      in                         XL049f21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGAGGTTCAGCTATGTGTGCCCGGNTTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGG
  3   1   2       bld Te2N 5g3  in                    IMAGE:7765439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCTAGTGTGCCCGCATTAGTAAGGAATTTAGCAAATATGATACTGATGTGCTAAATGGATCACACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGCCAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTTTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTGCCAAGTGTGTCACACCAAGAAGGCCTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTTTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACTCGAGTGGCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Em10      in                    IMAGE:7982013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGTGTGCCCGGATTTAGTTAAGGAATTTAGCAAATATGATACTGATGGTGCCAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTACGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTGATGAAATATGTTATAAAAATATTC
  5   1   2       bld Egg1                               PBX0066C06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGAGGCTGATGGTGCTAAATGGATCAAACAGTACACAGGGGTGAATGCAGTTTCTAAGAAGGAATTCAGCATTGATGTTGGCTATGAGCGCTTCCTGGGGCCCGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGGACAAC
  5   1   2       bld Skin                            IMAGE:8644315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGGCCTGAAATCTTTTTTCATCCAGAGTTTGCCAATCCAGATTTCACCCAACCCATCTCGGAAGTGGTAGATGAAGTGATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCTGAGAGCACTGAGCTCTCTCCGCTTGCCTTCTGCCTTAAGGATCTGAA
  3   1   2       bld Tad1      in                    IMAGE:6878219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAATCCAAGTTTTTCCCCCAACCCTTTTTGGGAAGTGGTAGAGGAAGTATTCCCAAAACTTGCCCTATTGATTTTTGGGGGCCCACTTACCAGGAAATATTGTATTTTCGGGGGGGGTCCATAAGTTTCCGGGATTTTCGGACGTCGTTGGCAGAGAGATTGTGAAGAGAACCAGTTGATGCCCCGGTGAAAGTTGAAGCGAGGAGTTGAGTGGTGGTCGTCTTAAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCCATCACATGCAGAGGTATGCTGTCTGGTTTGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGNGTATTTGCTTTGTTTGGGGGTTGTTT
  5   1   2       bld Skin                            IMAGE:8644327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGCCCATCTCTGAAGTGGTGGATGAAGTAATCCAAAACTGCCCTATTGATGTTCGGCGCCCACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGGTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCATGGGCTTCTCTCCGCTTTGCCTTCTGCCTTTCTGGATCTAGCGCTTCTGTT
  3   1   2       bld Thy  5g3  in                    IMAGE:8549139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATGAAGGTGATCCAAAACTGCCCTATTGATGTTCGGCGGCCCACTGTACAAGAATATTGTACTCTCTGGCGGTCCACTATGTCCGGGATTTCCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCAGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTC
  5   1   2       bld FaBN                            IMAGE:8079096.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGATCCAAACTGCCCTATTGATGTTCGGCGCCCACTGTACCAAATATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGC
  3   1   2       bld Spl  5g3  in                    IMAGE:8463324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCATTCGAGGTGAGAGATCAACTGCCATGAGTCGCCCACGTACAGATATGACTTCTGAGGTCATATGTCGTGATTTGGAGGCGCTGCAGAGAGAGTAAAGAGACAGTGATGCCGGCTGAGCTGAGCGAGAGCTGAGTGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTGGGGGGAGTTTCTTGGTTTTGTTTGAAGCCGAAAATCCTATATAATCCAGTTCG
  3   1   2       bld Tail 5g3  in                    IMAGE:8542200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTATTGACGTTCGGCGCCCACTGTACAAGAAATATGTACTCTCTGGTGGGTCCACTATGTCCGGGATTTCGACGTCGCTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGATTTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATATCAATGATATATATTATAACCGTTGAAAAG
  3   1   2       bld Ga18      in                      xlk102p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCGGCGCCCNCTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGNCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGNCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCNNNCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGNNNNTTTTGANNAAAT
  5   1   2       bld Ga18      in                      xlk102p04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCGNGNNACTGTACAAGAATATTGTACTTTCTGGAGGGTCCACTATGTTCCGTGATTTTGGAAGGCGCNNNNNAGAGATGTAAAGAGGACAGTTGATGCCCGGNTGAAGCTGAGCNNGNNNNNAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGNTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGNTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTT
  5  -1   2       add Gas1                                Gas1-C024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACNGNACAAGAANATTGTACTCTCTGGTGGGTCCANTATGTTCCGGGATTTCGGANGTCGCTTGCANANAGATGTNAANAGAACAGTTNATGCCCGGTTGAAGCTGAGCGAGGAAGTTGAGTGGTGGTCGTNTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCANAGGTATGCTGTANTGGTTCGNAGGATCCATGTTGGNTTCCACNCCGGAATTTTACCNAGTGTGCCNCNCCAAGAAGGACTATGAGGANATTGGGCCNAGCATTTGTCGGCCACAACCCCGTGTTTGGAGTCATGTCNTAATCCCTTGCANCGGCGCATATGTTTTGGAGGGCTGGTNTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCNCAGGTGGNACCCAGGCCNATTCTTTTTGATGNCTAATTGTTGAATAAAAGAACCTAGTGGCTTTTaaaaaaaaaaaaaaaaaaCTCGAACTAGTTCCTCGTGCNGGATTNTCAAGNGACT
  3   1   2       bld Thy       in                    IMAGE:8550362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACATTCGAGGAGAGAGGACCAACTGCTATGAGTCGCGCCACTACAGATATGACTTCTGCGGTCATATGTCCGGATTCGACGTCGCTGCAAGAATGGAGAGACAGTGATCCCGTTGAGTGAGCGAGAGTGAGTGTGTCGTCTAAGCCCAGCCGATTGATGTCAGGTGATACCCATCACATGCAGAGGTAGCTGTCTGTTCGGAGGATCCATGTTGGTTCCACGCCGGAATTTNACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTGGGGGTATTTTGGTTTTTGTCAAACCCGAAATCCATAAAAAACCGGTTCC
  5   1   2       bld Skin      in                    IMAGE:8640768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGATaaaaaataaaaaaaaaaaaaaaaaaataaaaaTTCGTCCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGtatttgctttgtttgggggtattttggtttttgttttgACCTGAAAATCATAATTAATACATGATATCTCTCCTaaaaaaaaaaaaaaaaaGGCGGTCGCAGGCCTGATTATTCTTCTTAGACCGGCGGCTC
  3   1   2       bld Ga18      in                      xlk124m04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNCTGTANNNGANNATNGTNCTCTCTNGCGGGTCCACTNNNTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTNCCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGNCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCANCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGNCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCNNNNNTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGANCCTGANNNNNAATAANAA
  5   1   2       bld Skin      in                    IMAGE:8640786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAATGGTTCTTATTAATTAAAGAATTCGTCCCCACTATGTTCCGTGATTTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGTCCGGTAtttgttttgtttgggggagtttcttgtttgttttgAAGCCGAAAATCATAATAAATACATGATTTCTCTTCTAGGaaaaaaaaaaacataaaaaaaGGCGGCCGCAGGCTGAATTCTCTAGAACGCGGCTCGAGCCCTCTCTCGCCCTATGATTA
  3   1   2       add Brn1      in                    IMAGE:4740384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAATATTGTATTTTTTGGGGGGTCCACTATGTCCGGGGATTTCGGAGGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTAATGGCCGGTTGAAGCTAAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAAAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAACGGCGCATATGTTTTGAAGGGCTGGTTTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGAAGAAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTTTTTTTGATGACTAATTGTTGAATAAAAAATCCTAGTGGCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld FaB       in                    IMAGE:8070126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGTACTCTCTGGCGGGTCCACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTAGTCTGAACCC
  3   1   2       bld Emb4 5g3  in                    IMAGE:4970082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  NTGGCGGTCCACTATTTCCGGGATTTCGGACTTCGCTGCAGAGAGATGTGAGAGAACAGTGATGCCCGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCATGAGAGCCAATGAGCTTCTCTCCCGCTTTGCCTTTATGCCCTTTATGGATTATGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTNNGNACCCTGAAAACCCAATAAAAAACCAGATA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGGTTCACTATGTCCGGGATTCGGACGTCGCTGCAGAGAGATGTGAGAGAACAGTTGATGCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTGGGGGTATTTTGTTNNG
  5   1   2       bld Skin                            IMAGE:8644112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTATGTTCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTACGAGGATTTACTTCTGTATAGTCTATATGATTCACTCGCTGCTGTGTGAGGTCGGTATTGCTTGTTGGGGGTATTTTGGTTTGTTTTGACTGAATCCATATAATACATGATTTCTCTTaaaaaaaaaaaaaaaaaaGGCGCGCAGCTGATTC
  3   1   2       bld Skin      in                    IMAGE:8640786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTATGTCCGTGATTTGGAAGGCGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTTCT
  3   1   2       bld DMZ       in                         xl253d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCGGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTGAACC
  3   1   2       bld FaB  5g3  in                    IMAGE:8069918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATATGTCTTCGGCGGTCATATGTCCGGATTCGAGTCGCTGCAAGAATTAAGAGACAGTGAGCCCGTTGAGTGAGCGAGAGTGAGTGTGGTGTCTAAGCCCAGCCGATGATGTCAGGTGATTCCCATCACATGCAGAGGTATGCTGTCTGGTCGGAGGATCCATGTTGGTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTGGGGGTATTTTGTTTTTTNCCACCCGAACCCCAATTTACACCTATT
  3   1   2       bld Skin      in                    IMAGE:8640768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATTTCGGACGTCGCTTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTTCGGAGGATCCATGTTGGCTTTCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTTATTTT
  3   1   2       bld Em10      in                    IMAGE:7983251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGAGCGGCCAGACAGATTGCTTCGGCGTCATTGTCGGATTCGAGTGCTGCGAAGATGAAGGACAGTGAGCCGGTGAAGTGGCGAGAGTGATGTGTGTCTAAGCCCAACCGATGATGTCAGTGATACCATCACATGCAGAGTATGTGTCTGTTCGGAGGATCCATGTGGCTTCCACGCCGGAATTTACCAAGTGGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTGGGGGTA
  3   1   2       bld DMZ       in                         xl225b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGACGTCGCCTGCAGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTT
  3   1   2       bld DMZ                                 rxl222e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTTGCAGAGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTTGGTTT
  5   1   2       bld Egg1                               PBX0151E08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGAGAGATGTGAAGAGAACAGTTGATGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCCCAAGCCGATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATG
  3   1   2       bld Te2       in                    IMAGE:7390372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGATGTAAAGAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTTGGTTTGTTTGAAGCCGAACCCCTTTTTTTTTCCNACC
  5   1   2       bld Skin                            IMAGE:8645040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGACAGTTGATGCCCGGCTGAAGCTGAGCGAGGAGCTGAGTGGGGGTCGTCTAAAGCCCAAGCCAATTGATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGGAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTAtttgttttgtttggggggagtttcttggttttgttttNNGAGCGAAATCCNATATAAATACATGATTCTCTTTCTaaaaaaaaaaaaaaaaaaaaaaGGCGGCCGCAGCTGA
  5   1   2       bld Egg1                               PBX0093F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGGCCCGGTTGAAGCTGAGCGAGGAGTTGAGTGGTGGTCGTCTTAAGCTCAAGCCGATTGTATGTTCAGGTGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTTCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTTAAGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTT
  3   1   2       bld Tbd3                            IMAGE:3549047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCCCAAGCCGATTATGTTCAGGTGATACCATCCACATCAGAGGTATGCTTCTGTTCGGAGGATCATGTGGGTTCCACGCCGGATTTACCCAAGTGTGCCACACCAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTTTCTCCCGCTTTGCCTTTTTGCCCTTTATGGATTTTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATCTCTTTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL446b16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGATGTTTCAGGGNGATTACCCATCACATGCAGAGGTATGCTGTCTGGTTCGGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGNGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTNTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTNTGAACCTGAAAATCCAAT
  3   1   2       bld Tbd7                                 XL053h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATTACCCATCACATGCAGAGGTATGCTGTATGGTTCGNAGGATCCATGCTGGCTTCCACGCCGGAATTTTACCAAGTGTGTCACACCAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAAAATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTGGTTTTGTTTTAAGCCGAAA
  3   1   2       bld Ga15                               XL499g24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGGATCCATGTTGGCTTCCACGCCGGAATTTTACCAAGTGTGCCACACCAAGAAGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCNTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTNGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTNGAATAAAAGAACCTAGTGGCNNNTAGTTACCTGTGCCCTGGNATTCTGTCCGNTTGTGACTATAANGTGCTCGTTCCTGTNGTTATGGGCTGTGTTTGTTNTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACANTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCNTTATGGATTCTGAGCTCTTTCTGTTNTTTAATCGACGGACTTTACTTCTGTATAGTTCTATATGATTCCATCTCGCTGACCTGNGTGAGGTCCGGTATNTGCNTTGNTNGGGGGTATTNTGGTTT
  3   1   2       bld Neu7      in                         XL046d03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTGTGTCACACCAAAGAAGGACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCT
  3   1   2       bld Neu7      in                         XL050p17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCACGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTNGTTTTTGTTTNAACCTAAAATCCAATAATAAATACCA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4174581.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTATGAAGAGATTGGGCCGAGCATATGTCGCCACAACCCCGTGTTCGGTGTCATGTCCTAATCCCGTGTGTCGACGCATGTGTTTTGGAGGGCTGGTCTACAGTGGGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL462f03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCggtatttgctttgtttgggggtattttggtttttgttttNAACCTGAAAATCCAATAATAAATACCATGATATCTCTTCTTAANAAAAAAA
  3   1   2       bld Ga15      in                       XL462f03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTATGAGGAGATTGGGCCGAGCATTTGTCGCCACAACCCCGTGTTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTT
  3   1   2       bld Ooc2                            IMAGE:3745725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGGAGTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTTTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATCTCTTCTTAAGAAA
  3   1   2       bld Egg4                            IMAGE:3743277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCATGTCCTAATCCCTTGCAGCGGCGCATATGTTTTGGAGGGCTGGTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTTTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATCTCTTCTTAAGAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4963120.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGGTCTACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTTGGTTTTGTTTTGAAGCCGAAAATCCAATAATAAATACCATGATTTCTCTTCTTA
  3   1   2       bld Neu7      in                         XL035a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTGGTTTTTGTTTNAACCTAAAATCCAATAATAAATACCATNATANCTCTTCTTACCA
  3   1   2       bld Neu7      in                         XL019o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGCAGTGCGTGTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTG
  5   1   2       bld Tad2                            IMAGE:6874792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGTGCGTGTCAGGACAACGGCTGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGAATCCTTTTGATGAAATATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTTGGTTTTGTTTTGAAGCCGAAAATCCAATAATAAATACCATGATTTCTCcaaaaacacaacaaacaaaacaacacacaaacaTGTCGGCCCGCCTCGGGCCCTCGAAAACCTTTCTAGACCATTCCGTTTGGGCGCCCGGGGCCCCAGAAGGTAAGGGAACCATGGGTCATAGCCTGTTTTCCTAAGGAGAATCTTGGGCAATGACCTAAGGGCCTTGGGAATTccccccccactaaaaaaaaCGCCCCGGCGGGGGTAACACCAAAAGCGTTTTTTGAACCACAATTCCCAAAATTGGCGAGTTTCTTGGAAGGGCCACTTTAACGCGGGGACACCCCATCTCAAACAAGGGGAGAGCTACCCAAAGCCGAAAAAACTCTCCCTATAATCCGACAAGATTTATCACCCCCGCC
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3581392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGGACAACGGCCGCCCAGGCTTGGAGGAGCTCATTAATGTCTCTTTGCACAGGTGGAACCCAGGCAGATTCTTTTTGATGACTAATTGTTGAATAAAAGAACCTAGTGGCTTTTAGTTACCTGTGCCCTGGTATTCTGTCCGCTTGTGACTATAATGTGCTCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATTTTTTTTTTAAAAAAAAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4173561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGTTGAATAAAAGAACCGAGTGGCTTTTAGTTGTCTGTGCCCTGGTATTCTGTCCTCTTCTGACAATAACATGCTCGTTCCTATTGTTATGGGTTGTGTTTGTTCTGTAGAACACGTGCGGTACAGGAAAACTGGGCCCCAAATGCTGGACATTGGGATCAGCTTATGTGCTTAGTGGGCATTGTAGCCCCTGAGAGCCAATGGGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTCTGGATTCTAAGCGCTTTCTGTTTTCTAATGAGGATCGACTTCTGTATAATTCTATATGATTCCACTCGCTGCCTGTGTAAGGTCCGGTATTTGTTTTGTTTGGGGGGAGTTTCTTGGTTTTGTTTTGAAGCCGAAAATCCAATAATAAATACCATGATTTCTCTTCTTA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4174214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGTTCCTGTTGTTATGGGCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTTTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTTTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATTTTTTTTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Sp1       in                    IMAGE:4175608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGTGTTTGTTCTGTTGAACACGTGCGGTACAGGAGAACTGGGCCTCAAATGCTGGACATTGAGATCAGCTTAGTGGGCATTGTAGCCCCTGAGAGCCACTGAGCTTCTCTCCCGCTTTGCCTTTCTGCCCTTTATGGATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGTATTTGCTTTGTTTGGGGGTATTTTGGTTTTTGTTTTGAACCTGAAAATCCAATAATAAATACCATGATATCTCTTCTTACCAACA
  5   1   2       bld Sp1                             IMAGE:5507089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCTGAGCTCTTTCTGTTTTTTAACGAGGATTTACTTCTGTATAGTTCTATATGATTCCACTCGCTGCCTGTGTGAGGTCCGGtatttgctttgtttgggggtattttggtttttgttttgAACCTGAAAATCCAATAATAAATACCATGATATCTCTTCTTaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)