Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012767742 Xl3.1-IMAGE:6957664.5 - 95 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6957664.5                             TTGGAGAGACGGTGTATAAATGATTGCAAGCACCAGTGCCCAGGAACAAGCTCAACACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAAAAAAAA
                                                  Xl3.1-CHK-1012685662                                   AGACGGTGTATAAATGATTGCAAGCACCAGTGCCCAGGAACAAGCTCAACACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAGAAAAAAAAAAAA
                                                      consensus depths                                  2     4     2     4     2     4     2     8     3    12    23    34    33    40    40    46    44    49    45    49    48    49    48    49    48    49    49    50    49    51    50    51    50    51    50    51    50    51    50    51    50    51    50    51    50    51    50    51    50    51    50    51    50    51    50    52    51    52    51    52    52    53    51    53    51    53    53    54    53    53    52    54    53    54    52    54    51    54    52    54    52    55    51    56    51    55    52    55    52    55    52    55    52    55    51    54    51    55    49    55    48    55    47    55    43    53    40    52    41    51    41    51    39    51    37    52    39    52    36    53    32    54    28    53    29    56    26    56    26    56    25    55    20    55    21    55    20    58    19    58    20    57    19    57    17    54    15    54    17    54    16    53    16    50    17    47    18    43    18    37    18    35    18    34    19    33    19    32    18    32    18    32    18    33    19    33    19    33    21    33    19    34    19    34    20    32    18    32    22    33    26    35    27    37    27    36    28    36    28    36    28    36    27    36    28    35    28    35    28    34    28    36    30    35    30    36    29    36    30    36    30    36    28    33    30    33    30    33    30    33    30    32    30    32    30    31    28    31    27    31    27    31    27    31    27    31    26    29    26    29    23    27    23    27    21    27    19    27    19    25    18    25    20    26    16    22    11    19    10    17     4     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A--
                                               BLH ATG      19     148                             
                                               BLH MIN      55     213                             
                                               BLH MPR      55     213                             
                                               BLH OVR      19      29                             
                                               CDS MIN      19     213                             
                                               EST CLI      56      61                             
                                               ORF LNG      19      25                             
  5   1   2       bld Emb4 5g                         IMAGE:4680649.5p GGGAATGAACTGGGACAATGGGAGTGGTTTGGAGAGACGGTGTATAAATGATTGCAAGCACCAGTGCCCAGGAACAAGCTCAACACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACG
  5   1   2       chi Eye1                            IMAGE:6949455.5p     ACCCCTTCCCACATTTANATCCTGAGCGAATCCCGGTGGTAATTTAATGCTGGCCACCGGTCCGGGAATCCTTCGAAAAAGAGAGCACAGGGNAAACAGTATTCCCCAGCCATGTTCCGCTTGTTCATCATATTGTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCATCCAGCAAAGCAAATAGATGGATGGTTAACGGACCCCTATACAGTTTGTGCAGAAAGATGACAATCTGTATGGGAGCAGGCCCCTCAAATGATAAAAGACAAGAACTTGCCTTTTTCGCATGCCTCCGAGAAATCTGTTTAATGCGCACGGGCGCTTTCCAATTACACACGCGAAAGCTTGGCCAATTCCAGAGGATATGCGAAAGAAACTAAGGTATATTGGAATGGGGACCAAACGATCAATAACCTTTGAGTGGCAGAGCAAATAATATAAGAGGGATTCGCCCTCTGTCACTACCACCCGCCACGCGTGGGACATAAACCATTCAAATACTCTTTCGGGATACGCATCCCCCAGCGTAAATAACTCTTCTCTTCCGTACCAGGGTGAAGGCGTTCTGTTCTCTCTCCCCTCTTCGGTGCAATACATACCCTCTAACAGGTTGAAAATATATTTTAAGCTCCTTCTCAAAACGAGGGCAAGAACCACTAAGAGGGGAGGTGGGGCCGCGCATAAACCTTTGACACTCACACAATACTCGCTTTCTATGTAATGATCTACCCCCACAGGCGGCCGCCTCACACAAATATGTTTGTGATCACCAATGGGGCGAGAAAAAACGCATTATACTTCTGCCCCCTCCTCCCCTCTTGGGGATGTGCGTGNCCTCCTCTTCGCGGAATGAGCGCGGTCAGCACCTCGTCGGCCATATAAAAGAACAAATTTGGTCGTGACCACTCCGTCACGGTATCTGGCGCGCTAGACNTCGTTTTGATCATAATGAGGAACGCAACGACAACGATGGATTACTAATCAGTCGCAACTATCAATAGG
  5   1   2       bld Emb4 5g                         IMAGE:4680171.5p                      GAGTGGTTTGGAGAGACGGTGTATAAATGATTGCAAGCACCAGTGCCCAGGAACAAGCTCAACACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGCTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGGTAACGGAGCCCTAT
  5   1   2       chi Eye1      in                    IMAGE:6949666.5p                            NNTNNNNTATTTGTNTGAAATAAAGGGATGGTACCGGTCCGGAATTTCCCGAATCACTTTATCACAGGGNAAACATTACTCTTCAGCCATGTTCCGCTTGTTCATCATATTCTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCCAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAAAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTAAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAAGCTTGCTATTGAGGGAATGGGAAAAAGTAGGATCTGAACGGACTAAGACAAACTTGTTGGCAGGATAAAAAAAGGATACTTTTCCTTCTCCCAATGTAAGAACTATTAATTGGTTTGTACCACAAGACAACAACCCGTGGGGTATTAAAGCCAAAGAAAAACCCAGGCCAAAATTACTTTTTAATGTGCAACCCAAAAGTGTGGGACAAACCATGGCCTTACCGTCTATTTTATCCACTCCTCTAAGGAGTATAAAAAGGGTGTGCCAAAGTGAAAGAAAGAACTCCTGGGCACACTTCATCGGGTTGGGGCCTCTTTGTGAAAAATGGAGACAAAGCTTTTACATATGAAAAAACCTTATTTATAAGAGTGGGACATTTCGCAAAATTTATTTATAGGCTCCGGTGAACACAAAAAATCTCTGCCATAAAATAAGGAAAAAAGGGGGGAACACACAATCTCTCCttttttttCCCACCGCGGGAATTTTTAATTAAAAGAGACGCCAATATAACACACTCTCGCGGTGAGGGTTCTGAAAAAAATATCTAACAACCCCTTTTTTTGTGTTTTATCACACAAAACTTTCTAGGTCAAAATTCGCCGCNTCCCTCCAGTGAAGAGTAGTACAATGGGCCACG
  5   1   2       chi Emb4                            IMAGE:5570358.5p                                                          AGACCGGGCCGGAATTCACGGGATATCGACTACCCACTCGTCCGCAGTATTCTTCAGCCATGTACCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGGAATGGAAGAAGTAGGATCTGGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGGTGGCACAGACCCACCGTGGGTTAAGCCAGAAACCAGGGAATTACTTCAGGGAGCCAGGGGGGCACCGGCTACTTTTTCCTTCGGGGTACAAGGGGCAAGGAACAAGATCTGGCCCTTCCGGGGGCTTTGGGGAGGGACAGTTTCATGAAAGCCTATTGAGAGGACCTGGAAAATATTCGCCGGAAACACCCCTTTGGCAAAATGGGAAGGGGGTCCCCATTCCTTTGGCCCC
  5   1   2       bld Eye1                            IMAGE:7020059.5p                                                             CTGGACCGGTCCGGATTCCCGGGATCTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTTGCTGAACAACGCTTGCAGATGGGAAAGGGGGTCGCATTCCTTTGTCCCAGGG
  5   1   2       bld Eye1                            IMAGE:7019813.5p                                                             CTGGACCGGTCCGGAATACGAAGGATTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGATATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCCAAGGAGAGATCTGCACTTCTGGTGGGCTTTTGGAGGGGACAGTTCATTGAAGCTATTAAGTGAACTTGGATATAATTTGGCTGAAACACGCCTTTGCAGAGGGAAAAGGGTCGCCATCCCTTGGTCCCAGGGGAATTT
  5   1   2       bld Eye1                            IMAGE:6945874.5p                                                                CTGGACCGGTCGGATTTCGGGATACTTTATCCAGGGAAACGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCCTCTCCCATGTAGACTATATTGTTGTCACAGACACCCCGTGGTTTTAGCAAGAAACCCGGAAATTACTTTTTGGAGCAAGGGGGCAACTGGCTACTTTTTCATCCAGGTACAAGGGTGCAAGGAGAAGATCTGGCCCTCTGGGTGGCTTTTGGAGGGGACAGTTCCTTGAAACCTTTGAAGTGGACTTGGTAATATTTGGCTGGAACCCGCCTTGCCAAATGGGAAAAGGGTCGCCAACCCCTTGTTCTCCTGGGATTTTTTGAAGGCCCCTTAACAACCGGGTGGGGTGAAAAATGAAACCGAATTTTGG
  5   1   2       chi Tad2                            IMAGE:6931530.5p                                                                   CCGGGGAACAAGCTCAACACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAAGGAAACTTTCCTTCTCCAATGTAGAACTATATTTGGTTGTCCACAGAACACCCCCGGGGGGTTTAAGGCAAGGAAAACCCAGGGAAATTTACCTTTATTGGGAAGCAAAGGGGGGCCAACA
  5   1   2       bld Eye1      in                    IMAGE:6948949.5p                                                                    TCCGGAATTCCCGGGATCTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTNTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAAACTTGTGGAGGATAAAAATGATACTTTCTTCTCCAATGTAAACTATATTGTTGTCACAGACACACCGTGGTTAAAGCAAGAAACCAGGGAATTACTTATGGAGCAAGGGGGCAACTGCCTACTTTTTCATCGAGGGTACAAGGTGCAAGGGAGAGATTCTGACCTCCGGTGGGCTTTGGGAGGGACAAGTTCCTGAAAGCTATTAATTGACTTTGATATTTTTGCCTGAAACCCGCCTGGCAGAATGGAAAAGGGGTCCCCATCCCTTGTTCCCCGGGGATTTTATGAAGGGCCGTAACCCCCTGTGGGGGTGGAAAATGGAAAAA
  5   1   2       bld Eye1      in                    IMAGE:6949206.5p                                                                    TCCGGAATTCCCGGGATCTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATANTTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGGTCGCAATCCTTTGTCCCAGGG
  5   1   2       bld Eye1      in                    IMAGE:6957437.5p                                                                    CTGGACCGGTCCGGAATTCTCCGGATCAGGGAAACAGTATTCTTCAGTCACGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCCCAGACACACCGTGGTTTAGCCAGAAACCCGGAATTACTTTATGGAGCAAGGGGGCAACTGGCTACTTTTTTCATTCAAGGTACAAGGTGGCCAGGAGAAGATCTGCCCCTCTGGGGGGCTTTTGGAGGGGACATGTTCCTGGAAACTATTGAAGTGGACTTGATATTTTTTTGCCGGAACACGCCTTTGCACAATGGAAAAAGGGGTCCCCATCCCTTTGTTCCCCGGGGATTTTTTGGAAGGCCCCTAA
  5   1   2       bld Emb4                            IMAGE:5537210.5p                                                                                  AAACCTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGTGGCAAGGAGAGATCTGCACTCTGGTGGGCTTTGGGAGGGACAGNTCATGNAAGCTAATGAGTGACTTGAATAATATTTGCTGAACACCGCTTGCAAATGGNAAAAGGGTCGCATCCTTTGTTCCCAGGGAATTTTATGGAGCCCGTTAGCACCCCG
  5   1   2       bld Emb4      in                    IMAGE:4202496.5p                                                                                    ACGCGTCCGCAGGGNAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTTATCTGGGGAGAAGATTCCACTGCCTCCAGTTATTCTGGCAGATTTTGTAAATGACAAAATCAAACCAACGGTTCTGGTTCTATGGACACATGGTTGTTCCACCCAGCAAAGCATACTCATCGATGGTTTTAACGCTGCCTTATTCAGCTTTTCTGCTAAAGAT
  5   1   2       bld Eye1                            IMAGE:7020328.5p                                                                                    CACTTTATCACAGGGAAACATTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTCTCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGATACTATGAAGGACGTTTAGAGAGATCGTGGTAATACAGGN
  5   1   2       bld Eye1                            IMAGE:7019692.5p                                                                                    CACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGANACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGGTGCAAGGAGAGATCTGCACTCTGGTGGGCTTTGGAGGGACAGTTCATGAAAGCTATGAGTGACTTNGATATATTTTGCTGAAACACGCTTTGCAGATGGNAAAGGGGTCGCATCCNTTGNTCCCCAGGGGATTTTATGAANGCCC
  5   1   2       bld Emb4                            IMAGE:4203752.5p                                                                                     CTTTATCACAGGGNAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCT
  5   1   2       bld Emb4                            IMAGE:5537009.5p                                                                                     ACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAATAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGGTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGAAACTGCTACTTTTTTCCTCGAGGGACAAAGGGGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGGGGCTTGGAAATTTTGGTGAAAACCCTTTGAAATGGAAAGGGGCCCACCCTTGCCCCCGGGGTTTAATGAG
  5   1   2       bld Emb4                            IMAGE:5571373.5p                                                                                     ACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTTGTCACAGACACACCGGTGGTTTAAGCCAGAAAACCCAGAATTACTTATTGAACCAGGGGGCAACTGGCTACTTTTTCTTTCAAGGTACAAGGGGGCCAGGGAAAGATTCTGCCCCTCCTGGGGGCCTTTGGAGGGACACTTTCTTGGAACCTTTGAGGGGAACTTGCAAAACTTTTGTTGCAAACCGCCCTTCCAAATGCACAAAGGGCCCCCCTTCCCTTGTTCCCCCGGGATTTTTGGTCGCT
  5   1   2       chi Emb4                            IMAGE:5569980.5p                                                                                     ACTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAATAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTACACTATATTGTTGTCACACACACACCGTGGGTAAGCAAGAACCCCGCGATTTATTTATGGAGCAAGGGGGCAATTGGCTACCTTTTTTCTTCGAAGGGACAAGGTGGCAAGGGAGAAAATCTCCCCCTCCGGCGGGCTTTTGACGGGAACATTCCCAGACACCTTCAGCGGCGGCCCTGGTAGCACTTCGTgcccgaaaccccccttgccccaccgccacagccgccgcacccgccgtaccccgccgGGTCCTAGACAGGCCCGCCACCATGCCTTCTCATACACACACTCCC
  5   1   2       bld Emb4                            IMAGE:5514704.5p                                                                                     CCTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCACATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGGCAATGAGAAATTTGCCCTCTGGTGGCTTTGGGAGCGCAGTTCTTGAACCTA
  5   1   2       bld Emb4      in                    IMAGE:4960170.5p                                                                                      CTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAAGATCTGATGGACTA
  5   1   2       bld Emb4                            IMAGE:5440029.5p                                                                                      CTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAAC
  5   1   2       bld Eye1                            IMAGE:7020617.5p                                                                                      CTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGGAGAGATCTGCACTCTGGTTGGCTTTGGNAGGGACAGTTCATGAAAGCTATGAGTGACTTTGATATATTTGGCTGAACACGCTTGC
  5   1   2       bld Eye1                            IMAGE:7020095.5p                                                                                      CTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTTCAATGTAGACTATATTGTTGTCACAGAACACACCGTGGTTAAAGCAAGAAACCCAGGAATTTACTTATGGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAAGCTTTGAGTGACTTGATATATTTGCTGAACACCGCTTGGCAGATGGAAAGGGTCGCATCCTTTGTCCCCAGGGATTTTTGAAGGCCCTTAC
  5   1   2       bld Eye1                            IMAGE:7019649.5p                                                                                      CTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGGAGAGATCTGCACTCTGGGTGGCTTTTGGAGGGGACAGTTTCATGAAAGCCTATGAGGTGACCTTGATATTATTTGGCTGAAACACGCCTTTGCCAGAATTGGAAAAGGGGTCCGCAATCCCT
  5   1   2       bld Eye1                            IMAGE:7019546.5p                                                                                      CTTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAAGGAGAGATCTGCACTCTGGGTGGCTTTGGGAGGGACAGTTTCATGGAAGCTATNGAGTGGACTTGGATATATTTGGCTTGAACAACGCTTGGCAGAATGGAAAAGGGGGTCGCCATCCCTTGGTCCCCCAGGGGATTTTATGGAAAGGCCGGTC
  5   1   2       bld Emb4                            IMAGE:5536840.5p                                                                                       TTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGGTTAAGCAAGAAACCAGNGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTTCATCGAGGTACAAGGTGGCAAGGAGAGATCTGCACTCTGGTGGGCTTTTGGAAGGGACGTTCATGAAAGCTATGAGTGGACTTGATTATATTTGCTGAACACGCTTGGCAAATGGGAAAGGGTCGCATCCCTGTCCCCAGGAATTTAAGGAGGCGTAACCCCCGT
  5   1   2       bld Emb4                            IMAGE:5569999.5p                                                                                       TTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGGATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAAGATACTTTCTTCTCCAAGGTAAACTATATTGGTGTCCCAAACACACCGAGGTTTAGGAAGAAACCCAGAAATCCTTTATTGGAGCAGGGGGCCACCGGGTAACTCTCTTCCCCTCCCCGGGACTCGGGCGCGGCGGCGCCATGTTCGCCCGGGCCGGCGGGGCTTCTTCGCtgcccccgcccccgtgtatagcccccgcacccggcttacctaccctcccccttgtccccaaatctctccctacttgtcccaccccccccgctcccccGTATACCGCCGGCGCCCGTAATCAG
  5   1   2       bld Eye1                            IMAGE:6946249.5p                                                                                       TTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAATCTGCTACTTTTTCATCGAGGTACAAAGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAAGGTCGCAATCCTTGT
  5   1   2      seed Eye1      in                    IMAGE:6957664.5p                                                                                       TTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAAACGCTTGCAGATGGGAAAGGGTCG
  5   1   2       bld Eye1                            IMAGE:6946278.5p                                                                                       TTTATCACAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATAGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGGTCGCATCCTTGTCCCAGGGGATTT
  5   1   2       bld Eye1                            IMAGE:7019795.5p                                                                                        CTTTATCCAGGGAAACGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGAATGGAAGGGTCGCATCCTTTGTCCCAGGGGATTTTATGAGGCCGTTA
  5   1   2       bld Eye1                            IMAGE:4743333.5p                                                                                         ATCACAGGGNAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAAAAGTAGGATCT
  5   1   2       bld Eye1      ?                     IMAGE:6947904.5p                                                                                          GGTCCGGAATTTCCGGGATCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTANGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGGAACCAGGGATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCCCTTTGGTGGGCTTTGGGAGGGAACGTTTCTTGAAACCTATGAATGGAACTTGATAATATTTGCCGGAAAAACCCCTTGTCAAAATGGGGAAAGGGGTCCCCATCCCTTTGTTCCCCCGGGGAATTTATTGGAAGGGCCCGTTAACACCCTTggggggggggAAAAAAC
  5   1   2       bld Tbd2      in                    IMAGE:3199469.5p                                                                                           TCACAGGGAAACAGTATTCTTCAGTCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTNCAGTGAATGTGGAGCTTGCTATTGAGGGAATGGAAGAAAGTAGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATTCTTTCTTCTCC
  5   1   2       bld Emb4                            IMAGE:5515777.5p                                                                                              CAGGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTCATCGAGGTACAAGGTGCAGGAGAGTCTGCACTCTGGTGGCTTTGAGGGACAGTCATGAAGCTAGAGTGACTTGATATATTGCTA
  5   1   2       chi Emb4                            IMAGE:5570435.5p                                                                                                GGGAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGAGCCTATACAGTGTGAGAAGATGACATCTGTATGGAAGAGCACGTCAGATGATAAAGGACAGTACTTGCATTGNTGCATGCTCTGGAATCTGTTAATGGGATGGGGCTTCCAGTGAATGGGAAGCTTGCTTATTGGGGGATTGGAAAAATAAGGATTTGATTGACTaaaaaaacttggggggggaaaaaaaGGAACTTCTCTTTCCCCAAGGGAAACAAAATTGTTTGCACCAACCCCCCGGGGGTAAGCCAGAAACCCGGAATTTTTTTGTGGCCCAGGGGGCGCCGGTTAATTTTTTCCCCCAGGTACAAAGGGCAAGGGAGAAATTCCCACCCCgggggggcttttggggggCAATTTTCTGGAACTCTTGAGGGCCTCTTTATTATTTTCGTGAAAACCCCCCTTGGAAAGAAAAGAAGGGGCCCCCTCTTTGTCCCGGCGGGTTTTAGACGGGCCGGACCCCTCTCTGTGGGGGGAAGGAAAGGGAAAACTTTTTCCACCACAttttttttttCCTTTCCTTCTTACCGACGCGGTCGGGGGGATACAGAGGGGGTGTGGTGTCTCCCTTGCT
  5   1   2       bld Emb4      in                    IMAGE:4960379.5p                                                                                                  GAAACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGANGGAATGGAAGAAGTANGATCTGATGGACTAGAGAAACTTGTG
  5   1   2       bld Eye1      in                    IMAGE:6957541.5p                                                                                                     ACAGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGAATGGACTAGAGAAACTTGTGGAGGATAAAAAAGATACTTTCTTCTCCAATGTAGACTAAAATGTTGTCCCCAGACACACCCGTGGTTTAAGCAAGGAAACCCGGAAATTACTTATGGGAGCAAGGGGGCAACTGCCTACCTTTTTCATTCCAGGTACCAAGGGTGCAAGGAAAAGATCCGGCCCCTCTGGTTGGGCTTTGGGAGGGAACAGTTTCCTGAAAGCCTATTAATGGGATTTGGATAAAAATTTTGCCTGAAAAACCCCTTTTCAAAATGGGAAAAGGGGTCCCAAATCCCTTTTCC
  5   1   2       bld Emb4                            IMAGE:5542365.5p                                                                                                       AGTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACNAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCCGATGGAAAGGGTCGCATCCTTTGTCCCAGGGGAATTATGAGGGCGTTACACCCTGTGGGGGGAAAAATGAA
  5   1   2       bld Emb4      in                    IMAGE:4203428.5p                                                                                                        GTATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCT
  5   1   2       bld Emb4                            IMAGE:5440141.5p                                                                                                          ATTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAAGCAGAAACCAGGAATTACTTATGGAGCAGGGGGCACTGCTACTTTTCATCGAGGTACAGGTGCAGGAGAGACTGCACTCTGTGGCTTGGAGGACAGTCATGAGCTATATGACTGAATATTGCTGACACCTGCAATGAAGGTCC
  5   1   2       bld Eye1      in                    IMAGE:4743596.5p                                                                                                           TTCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTTTTGAGGGAATGGAA
  5   1   2       bld Eye1      in                    IMAGE:4757538.5p                                                                                                            TCTTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTG
  5   1   2       bld Emb4                            IMAGE:4930323.5p                                                                                                              TTCAGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGNCTTTGGAGGGACAGTTCATGGAAGCTATGAGTGACCTTGATATATTTGCCTGAACACGCTTTGCAGAATGGAAAAGGGGTCGCATCCCTTGTCCCCCAGGGATTTTATGAAGCCCCGTAAACAACCTGC
  5   1   2       bld Ga18      in                      xlk144e07ex.5p                                                                                                                  AGCCATGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGNNNNGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGNAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGNCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAANCAGGAATTACTTATGGAGCAAGGGGNAACTNNTACTTTTTCATCGAGGTACAAGGNGNAAGGAGAGANCTGCACTCTGGNGGCTTTGGAGGGANAGTTCATGAAGCTATGAGTGANTTNANATATTTGCTGAA
  5   1   2       bld Eye1      in                    IMAGE:4743433.5p                                                                                                                      TGTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTT
  5   1   2       bld Eye1      in                    IMAGE:4743157.5p                                                                                                                       GTTCCGCTTGTTCATCATATTTCTGTTAACATATCAAGTTCTGTTATCCCCTGTGCCAAACAATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAA
  5   1   2       bld Brn1                            IMAGE:6952758.5p                                                                                                                                                                                  AACATGGGGTTTTTCAGTATATTGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAAATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTACGATCTGATGGACTAAAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAACGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAAGGACAGTTCATGAAGCTATGAATGACTTGATATATTTGCTGAACACGCTTGCAAATGGAAAAGGGTCGCATACCTTGTCCCAGGGGATTTATGAGGCCCGAAACCACCTGTGGGGTGAAAAATGAAAACAAATTTTGGACCAAAAATCTTTGGAATTCCGTTCTATTAGGGAAAATTCCACCCCTTGACTCACGGGGGGTTTTAAACCATTTCCCTTTCACAGGAAAAAAT
  5   1   2       bld Eye1      in                    IMAGE:6947786.5p                                                                                                                                                                                            CCGGAATTCCCGGGATGCTCATCAAGATGAATTTATCCAGAGATTAAAGGACTGGGTGGCAATAGAAAGTGACTCTAGTGATCCATCGAAGAGAGACTTGGTTAATAAAATGATGGAAATGACAAAGGACTATATTCTCAAACTGGGTGGAAGTGTTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTTCCTCGAGGTCCAAGGTGCCAAGGAGAGATCTGCACTCTTGGTGGCTTTTGGAAGGACAGTTTATTGAAGCTACGCAGCGCCTCTGATATTTTTGCCTGAAAACTCTTTGCCCATGGGAAAGGGGCCCGCATCCTTTTTCCCCAGGGACCCCTGAGGGCGCGAAACACCCGTGGGGTGGGACAACCGAAAATGTACCTCGGCCCCGAGCCTCTGCGAGCTTCCGTCCCTCGCCGGCGCCGGTGTATTGTCCACCCTCCGCGCAGTTGCCTATTATTGCCCTGGCCTCCCCTCTCACCCCGCATCTTCTCCTATCATCCTGTAGACGTTGTTCTCCGCCTGCTCCGGCGCTG
  5   1   2       bld Brn1                            IMAGE:6953767.5p                                                                                                                                                                                                                                                                                                                                                       TTGAGATGGCAGAAATTGGTGAGCAAGAGCTGTCATCTGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCATTCTAGAGGAAATGCAAGCTGACACAGGGGGTTAAGCAAATTCCTTCACTGATACAAAAAGAAAGATTTACTTTATTGCACCAGGATGGCCGGCTTATCCCTTTCTCCTTATCAAATTCATTGGGGAATTGAAAGAGAAGCTTTTTCTTCTGGGGAAACACGGGAAACCTTAAAAACTGGTGAAATCCCCCTGGCCAAAAAAGATAAATTTGGGGAAAAAGGTTTCTCCCTCATTTTCTCGGGCAAAAGATTCCCCC
  5   1   2       bld Emb4                            IMAGE:5514877.5p                                                                                                                                                                                                                                                                                                                                                                                          CTNGGGGAGAAGATTCCACTGCCTCCAGTTATCCTGGCAGAGCTAGGAAATGACAAAAGCAAACCAACGGTCTGTTTCTATGGACACATGGATGTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCATTCATGGGATTGAAGGAGCTTTCTCTGGACAGGAC
  5   1   2       bld Brn1                            IMAGE:6953433.5p                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGAGCTAGGAAATGACAATAGCAAACCAACGGTCTGTTTCTATGGACACATGGATCTTCAGCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTTGTCCCAGGGATTTATGAGGCCGTACCACCTGGGGGTGAAAATGAAACAGATTTGTACAAAAAATCTTGAATTCCATCTATAAGGAAAATGGCAACCTTGACACAGGGGGTTTAAGCAATTCCCTTCCTGGATACCAAAAGAAGGATTTTTCCTTTTTGCACCCGCAAGGGGCGCCTAGTCCCCTTCCGCCTAATCCAACTTCCCTGGGGGGGAACTGGAAAAGGGAAACCTCTTTTCCCTCTCTGGGGGAAACCATGGGGAAACACCCCATAAATACGTTGTGTGATAATAACCCCTGTGCCCACAAAAAAGTTTACATTCCGGGGGTAAAAAGATTTCTCTTACCCATTTTTCCGGGGGAAAAGACTCTCCCCTCTAAACGCATGTGTGAAAAACCCCCTTCTCTGGTTTAGCTCAAAAAACTATAATACCGGTGTGTTTACCCGGTGCTTTCACTTCTCGGGAAGGGTCCCACAAATATTTTTCTTTTAAATATAGGGAAACAAGTGACCCTATAATATATAAACAATAACGGGGGTTAGACACAATGGGGAATAGTTTCGGGGTACTTACAATACCTCTTTAGTATTGGGGGGCAGTGACATGTGAAGGAGAAACCGCAAACAAATATTCTGGGAGAACACTTTGN
  5   1   2       bld Eye1      in                    IMAGE:6949609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGATCTCCGGATCAGGGACACATGGATGTTCTTCCAGCAAAGCAAACAGATGGATGGTTAACGGAGCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAAGTTCTCCCATTCGGGCAAGTCCCCTAAACATGGAAACCATTCTGTTTGTAAAACAAAACAAGGGTTACCCCGATTAACTTTGGGAAGGCCCAAAATTTTTTCTTgaaaaagggaaaaaagattccttaaattaaaaaaataaaaagggcttaaacaaaatgggggttaaaattttgggggaaaaCCC
  5   1   2       bld Eye1                            IMAGE:7020636.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTCCGGTCCGGATTCCCGGGATATGACATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAAATGGTAANTGGGAGCAAAAACCTTGGGTTGGCAGACATGNAATGAGCCCGCAATATCTGGGCAGCTTAGGAGAGCAATTTAAAAAGAATGTTTTAAACTTGGAAAGCAGACATTGAT
  3   1   2       chi Tbd7                                 XL093e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCTATACAGTTGTGGAGAAAGATGACAATCTGTATGGAAGAGGCACGTCAGATGATAAAGGACAAGTACTTGCATTGTTGCATGCTCTGGAATCTGTTAATGTGATGGGTCTTCCAGTGAATGTGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAGTAAGCCTGCATTTTGGTTTTGTTTCAAGATTTTAACACATGATGAAACATCCACAAATTCTCAATGTTCATCAGCTTTTCTCTTCCTACGACTGAAACTCATAATACAGCAGAATGAAAGAAGTTATATTATGCCTGTACAGGAGTTTGTACTTTTGGAGTTGCAGCAAGTTAAATGTAGTCTAGTAATTTATGTTTTCTAAAAGCATTTATAAATGCTTCATTAAACACATT
  3   1   2       chi Eye1      in                    IMAGE:6949666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGGATATTCGAAAAAAGATTGGGTATTTTCGGTGAGGGCCCCGGAGAGAAATCTTTGGGGAGGAGAGAAAAAAAAAAGGTTATTCTTTTTCTTCCCCACAAGTAGAGACTATATATTGTTTTTTCACACAAAACACACCCTGTTGGTGTTAGGCCAAAGAAACCCCCCGGGGAATTTTCTTTTTTGGGAGGCAAAGGGGGCCAAACGCGTTTGTTTTTTTTTTTCCGAGGGGTTCCAAAGGGGGCCCAGGGGGGGGGATTCCTCCCCTTCTTTGGGGGCTTTTTGGGGGGGCACCGGTTTCTGACAGGTTTATGGAGAGGGACTGGAAGAGAATTTGTCTGTGATCCAGGCCTTCCCACATGGGACAGAATGTTACTGAACTCCTTGCCCATGGATAGGGTCGCATCCTTGTCCCAGGCATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAGAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGGAACAGTAATCAGCCACTGTATTCTCTCGAG
  3   1   2       chi Eye1      in                    IMAGE:6947786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATATTAGCATTGCATGGGAGGTAGGCGATAACGAACGTAGAGGAGAGAGTGATGTGACCTAGAAGGCGGCGTAAGAGCCCGGACAGGGTCAGTCGCTATAAATTGGCCGGTAGATGATGCGACGAATGCTGTGAAAGAGGCGGTGGCAGCGGAGCGTACTATGTGTACTTATAGATAGGAGCGAGGGAGCACTGGTTGGGTAGTGAGCTGGCTGACGTGCGCGCACTAAGTGGAGAATTTGGGGTATTGTGGGCGTATCACTGGGATGGATATCATTTGGGTGGAAGGCTCGATTGTACTATAAGGGAAATTGTTTGTGGGCCACTATCGCATCCGTGCAGGGATTAAAACTAAAAACACTACGCGCTTGCCCAAAAATTATTTCAAATCACGGTGTGAGGAGGAAATGCGGGGCTGGAAACAAGGGTTTAAGCCATGTTCGTTCATGGATACAAAGGGAAGGATTTAGTTATGCACGGATGGCGGCTATCCTTCTCTATCAGTTCATGGGGGTTGAAGGAGCTTTCTCTGGAACAGGAATCTGAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGTGAGGAAAGAGGACACGGGCGGAAGTAGGGCTGCGTGGAAAAAAAGGGGACGGACGAAATAGGAAGACGA
  3   1   2       chi Eye1      in                    IMAGE:6957541.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGTCGATTAGTTATTATCGGTAGTATAAAGATTGTGCGGTTAACGGCATAATAGCTTATATTATATAGTGGCGGGGGGGCTCCCACCCCCACATGTCTTTTTAAGAGAAGGAGAGGGAGGCACCGTGTTCGCTTTCTTTATTTGTGCAGAGAGGGTGTTTGTTTTAATAGAGGGGGGCGGCGCGCGCCCCTTCGGGGGTGAGAGGTGAAAAAAAAAAAGAAGCGGCGTTGTGTTTTATAACAAAAAAAAATATATTTTTTCTTCTCCGCCCCCGGGGGGGGGAGAAAAAAAAATACTAGAGGGCGCAGCCCGGGGGGGGGGAGAAAAAAACATATTTCTTTCTCTGTGGCAAGAAAAAAAAAAAAGAGGGTTTTTTTTTTTTTTTTTTCACACAAGGGGGGGGGGGCTCTTTTCTTTTTTTTTTATAAAAAAATAAAAAGGGGGGAGAAAAAAAGGGGTTTTTTTTTCTTGAGGAACAGCAGAGAAAAAAAAAATTTTTTTCTCCCCCCCAAAAAAAAAATTATTTGAGAAAATTTTTTCCCCTTTGGGGAAAGGTTCCCTAAAAAGGAGGGGCCCACTTTTTTTTTAAACAAAACCCGGTTTCCCGTTTTTCTTTGGGGGGCCAAATTTTTTTTAAAAAGAAAAAGTCCTTAAAAAAAATAAAAGAACCAATGGTAATTGGGGCAAACCCTTTGTTGGCCCACCAGAATGACCCCAATTTTTGGCCAGTTAGGGAGGGGCCAGGTTAAAAAGANGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAAGCAGCCACTGTATTTCTCTGCAGAGATAGAAAT
  3   1   2       chi Eye1      in                    IMAGE:6948949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTCTTTCTTCCAAAAATGTTCGGGATATAAAATATGTTGTTCTCAACGAGATACAACCCCTAGTGGGTTAAAGGCAAGAGAAACCCCCGGGAAATTAACTTTATGGGGACGCCAAGGGGGGGTAAATTGGGTTATGTTTTTTACATGGAAAGGTTACCAAAGGGGGAAAAGGAAGAGAATTGTGCCACTTTGGGGGGGTTTTGGGAGGGGACCAGGTTCAAGGGAAAGTTAAGGGAGGGAACATTGAATAAATTTTGCTGAAACCCCGCTTGCAAGAATGGAAAAAGGGTTAGAATTCCCTTTTCCCAGGGATTTTATGAGGCCCGTAGCCACCTGTGGGGTGAAAAATGAAACAGGTTTTGTACAAAAATCTTGAATTCAGTTTAGGGGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCTTTCATGATACAAAAGAAGATTTACTTAAGCACAGAGGGGGCTATCCTTCTCTATCAATTCATGGGATGGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCTGGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTGACAGTAATCAGCCACTGTACTCTTTTTGAAGTTCNNNCCTCTGGGCGCACGCGAGTATGTAATGCGGTGCCAGGGCAGGAGGGAG
  5   1   2       bld Eye1                            IMAGE:6958852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGCTTGCTATTGAGGGAATGGAAGAAGTAGGATCTGATGGACTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGGAGATGTACTTGGGAAAGAGTGTAATGGTTACTAGGAATTGGGTGGACCAGATGATGCTTCCTCATGGTCAAAA
  5   1   2       bld Eye1      in                    IMAGE:4757619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAGAGAAACTTGTGGAGGATAAAAAGGATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGGAAGTT
  5   1   2       bld Tad2                            IMAGE:6872368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATACTTTCTTCTCCAATGTAGACTATATTGTTGTCACAGACACACCGTGGTTAAGCAAGAAACCAGGAATTACTTATGGAGCAAGGGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATGGGAGCAAAACCTTGGTTTGGCAGACATGAATGAGCCACAATATCTGGGAGCTAGGAGAGCAGTTTAAAAAGAGTGTTTAACTTTGGAAAGCAGAACATGATCCCAAGCCTGGTGGGGACCAATTCCCCATTTGCTAAAAAC
  3   1   2       bld Eye1      in                    IMAGE:6957437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATATTTGTTGTTCACAGAACACACCCGGGGTTAAACCAGGGAAACCCGGGAAATCACTTTATGGAGCAAGGGGGCAAACGGCTTATTTTTCCAGCGAGGTACCAGGGTGCAAGGGAGAGATCTCCACTCTGGGGGCTTGGGAGGGGCCAGTTCAGGAAGTTATGAGTGACTTGATATATTTGGCTGAACACGTTTGCAGGAGGAAAAGGGTTCGCATCCTTGTCCCAGGGGTTTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAATTTCTTCAACATCTTCCTGAACATGTAACAGTAATCAGCCACTGTATTTGTAGCAGAGA
  3   1   2       bld Eye1      in                    IMAGE:6949609.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTTCTCTCTTGCGGGAGGGGGTGTACCAAAAGGGGGGGCCCCAAAAGGGGGGGGGAAAATTTCCCCCCACCTTTTTTGGGTGGGGCTTTTTGGGGAGGGGACACCATTTTCCATGGAAAGGTTATTGGGGGGAACCTTGGAATTTATTTTGGCTGAACCACCGCTTTGCAAGATGGAAAAAGGGTTCGCATTCCTTGTCCCCAGGGGATTTTATGAGGGCCGTAGCCACCTGTGGGTGAAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCNGCGA
  3   1   2       bld Eye1      in                    IMAGE:6957664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAAGCAAGAAAACCAGGGAATTACTTATGGAGCAAGGGGCCAACTGCTACTTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGGTGGCTTGGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGAAAAGGGTCGCATCCTTGTCCCAGGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTCCTTCAAGAATTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAATTTA
  5   1   2       bld Eye1                            IMAGE:7019942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGTCCGGTCCGGATTCCCGGGATGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGCTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACNTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAANCATCTTCCTNGAACTGTAACAGTAATCNAGCCACTGGGTATTTCTTCTGCAGAAGATATTTTTTAAAATTAAAATGGTG
  3   1   2       bld Eye1      in                    IMAGE:6949206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATTACTTATGGAGCAAGGGGCAACTGCTATTTTTTCATCGAGGTACAAAGGTGCAGGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTCCTTCAAGAATTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACGGTATTTGTTG
  5   1   2       bld Brn1                            IMAGE:6953503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGATTACTTATGGAGTTGCGGCAACTGCTACTTTTTCATCGAGGTACAAGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTTGAAAGTACCAAACTATATGCCTTCTTAACCTTCAAAGAACTTTTCTTTCAACCATTCTTCCCTGAAACTGGTAAACAGTTAATTCAGCCCCCCTTGTAATTTTTCCTCCTGGCCAT
  5   1   2       bld Tbd7      in                         XL074k08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGTGCAAGGAGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATACCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAG
  3   1   2       bld Ga18      in                        xlk4n02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCNCTGCNNNNTGNTNGCTTNGNAGGGACAGTTCATGAAGCTATGAGTGACTTGANATATTTGCNGAACNCGCTTGCAGATGNAAAGGGTCGNNNCCTTGTCCCAGGGATTTATGAGNNCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAANTCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATACCTGCAAAAGTAATTGGAAAGTTCNNATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATNCTTCTTACCTTCAAGANCTTTCTTCAACNTCTTCCTGAACTGTAACAGTAATCANCCACTNNNNNNNCTGCAGA
  5   1   2       bld Gas8                            IMAGE:3516025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGATCTGCACTCTGGTGGCTTTGGAGGGACAGTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGAATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAGTGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAACGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTG
  5   1   2       bld Ga18      in                        xlk4n02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTCTGGTGGCTTTGGAGNNNNNTTCATGAAGCTATGAGTGACTTGATATATTTGCTGAACACGCTTGCAGATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATACCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGANCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCC
  5   1   2       bld Emb4                            IMAGE:4930640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATACCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCCTTCAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATGTTTAAATTANATGTGTAAACATCAGTTCaaaaaaaaaaaaaaaG
  5   1   2       bld Emb4                            IMAGE:4930664.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGGAAAGGGTCGCATCCTTGTCCCAGGGATTTATGAGGCCGTAGCACCTGTGGGTGAAAATGAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATACCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTTCACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAATTAAATGGTGTAACATCAGTTTCaaaaaaaaaaaaaaaGGCG
  5   1   2       bld Emb4                            IMAGE:4957420.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAACAGATTTGTACAAAAATCTTGAATTCAGTCTAGAGGAAATGCAAGCTGACACAGGGGTTAAGCAATTCCTTCATGATACAAAAGAAGATTTACTTATGCACAGATGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTANGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATA
  3   1   2       chi Tbd7      in                         XL074k08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATACCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGGTAACGTAAGATGTTACAGTATAACTGTTTACATCTCCAATAATATATCCTTATGCTGAGACCTACGTTATACAAGCCTGCAGCATCCAGTTGCATTCCATGTGCTCTTTATCATTTCTGATGTTTGTCTGCCCTCTAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACGAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAG
  3   1   2       bld Emb4      in                    IMAGE:4202496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAAGAAGAATTTACTTATGCACAGATGCGCTAATCCTTCTCTATCAATTCATGGGATTGANGGAGCTTCTTCTGGAACAGGAACTAAAACTGTAATACNTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAGTTCA
  3   1   2       bld Emb4      in                    IMAGE:4960170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGGCGTTATCCTTTTCTATCAATTCATGGGATTGAAGGAGCTTTTTCTGGAACAGGAACTAAAACTGTAATACTTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAGTTCA
  3   1   2       bld Emb4      in                    IMAGE:4960379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGCGCTATCCTTCTCTATCAATTCATGGGATTGAAGGAGCTTTCTCTGGAACAGGAACTAAAACTGTAATACCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAAAAAAAAAAAAAA
  3   1   2       bld Tbd2      in                    IMAGE:3199469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCTATCAATTCATGGGATTGAAGGAGCTTTTCTGGACCAGGACCTAAACCTGTAATCCTGCAAAAGAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAAAA
  3   1   2       bld Eye1      in                    IMAGE:4743433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGTTAACCCCCGCAAAAGTAATTGGAAAGGTCTCCATCGGGCAAGTCCCTACCATGGGCCCATCTGGTGTAACCAACCAGGTTACCGATGACTTGAAGCCCAAATTTTCTGGAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCA
  3   1   2       bld Eye1      in                    IMAGE:4743596.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCCTGCAAAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGAAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCA
  3   1   2       bld Eye1      in                    IMAGE:4743157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATATTTTAAATTAAATGTGTAAACATCAAAAAAAAAAAA
  3   1   2       bld Eye1      in                    IMAGE:4757538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAATTGGAAAGTTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAAAAAAAAAA
  3   1   2       bld Eye1      in                    IMAGE:4757619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAAGTTCTCCATTCGGCAAGTCCTTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAACCATCAAAAAAAAAAAA
  3   1   2       bld Emb4      in                    IMAGE:4203428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTCCATTCGGCAAGTCCCTAACATGGAACCATCTGTTGTAAACAAACAGGTTACCGATTACTTGGAGGCCAAATTTTCTGAAAGGAAAAGTCCTAATAAAATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAGTTCAAAATTGGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Eye1                            IMAGE:7020134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAAGGTAACAATGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCACAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGNGAATTGGTGGACCCAGATGAATGCCTCCCTCATGGGTCAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGGACCCAAACTATTATGCTTCTTTACTTCAGAACTTTTCTCACATCTCCTGACTGTACAGTATCAGCCCTGAATTTCCTGCGAAAAATTTTTAAATTAATGGGGTAACCTCAAAAAAN
  5   1   2       bld Emb4      in                    IMAGE:4956947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACGCGTGGGTCTGGTAATTGGAGCAAAACCTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCaaaaaaaaaaaaaaaa
  3   1   2       bld Emb4      in                    IMAGE:4956947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGGTTGGCAGACATGAATGAGCCGCAATATCTGGCAGCTAGGAGAGCAGTTAAAAGAGTGTTTAACTTGGAAGCAGACATGATCCGAGCTGGTGGGACCATTCCCATTGCTAAAACTTTGGAAGATGTACTTGGAAAGAGTGTAATGTTACTAGGAATTGGTGGACCAGATGATGCTCCTCATGGTCAAAATGAGAAAATAAGCAAGTACAATTACATTGAAGGTACCAAACTATATGCTTCTTACCTTCAAGAACTTTCTTCAACATCTTCCTGAACTGTAACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAA
  5   1   2       bld Emb4                            IMAGE:4930505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACAGTAATCAGCCACTGTATTTCTCTGCAGAGATATTTTTAAATTAAATGTGTAAACATCAGTTCAAAATTGGTCATTGACTTCAATTTTATTGCTACTTTTTATATAAACAGAGTTCTTTAAATATTAGTAAAGCCTTTAACATGTAACACTGTAATCAGTCAGAGCAAGTATCGCTCCATCACACAACAATGCATACACTGCTTTACGAAAACGATGCAAACTATAAGTACTGGAGAAATTGTTAGCATACCATAACTGCACTGATCCAATTAGCTGGACAAATAAGAACATGACCGTTCATCTCTATGGGATATTATGAGTGATTCATATATATACACATTTAAATATGAATGCTCTAAATGCAATTTTACATTATTTGTACTGGAAGCAGGAAGAGTATCTGCAAACAAAGTAATGCAACTAATAGTaaaaaaaaGCGAATTTGCTATATGACTGGCTAAAATACTTACCTGAAAATAAGTGTAATACTTATTATATAAGAAAATACATACTTGCTAACGGTCCCTTATTTCCATAGAAAGTAAAGATTGTTTTCCCTGGACATTTTTGAAGTTTTTAAAATTTACTGCACAGCAATCTCAATATCAGAAATCAGTTCTCATTTTCTGCTCTCACCTTACAGCCTATGGTTTTATGGGAATCATAAAAGCTAATAAAACAGTATCATATATGCATGTAGGGTTGCCACCTTTTCTGGAAAAAATACCTGCCTTCCTATATACAGNATTTATCTTTTTTCCCTATAANTAAACATTGNNGATCACCATAATTNTTACCCAAATAGGCCGTNNTAATAACGGNCAGGTGGGCAACCCTATACGCATTGCTATGTATGGTGGGGGACTCCTGTGCTGTNCTATTAACAACA
  3   1   0       add Ga18      in                      xlk144e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNNNTTTTTAANTTNAANNNGTAAACATCAGNTCAAAATTGGTCATTGNCTNNANTTTTATNNCTNCTTTTTATATAANNNNAGTTCNTTAAATATTAGTAAAGCCTTTAACATGTAACACTGTANTCAGTCAGAGCAAGTATCGCTNCATCACACAACAATGNATACACTGCTTTACGAAANCGATGCAAACTATAAGTACTGGAGAAATTGNTAGCATNCCATAACTGCACTGATCCAATCAGCTGGACAAATAAGAACATGNCCGTTCATCTCTATGGGATATTATGAGTGATTCATANANNNNCACATTTAAATATGAATGCTCTAAATGCAATTTTACATTATTTGTACTGGAAGCAGGAAGAGTATCTGCAAACAAAGTAATGCAACTAATAGTAAAAAAAAGCGAATTTGCTATATGACTGGCTNNNATNCTTNNCTGAAAATAAGTGTAATACTTATTATATAAGAAAATACATACTTGCTAACGGTCCCTTATTTCCATATAAAGTAAAGATTGTTTTCCCTGGACATTTTTGAAGTTTTTAAAATTTACTGCACAGCAATCTCAATATCAGAAATCAGTTCTCATTTTCTGCTCTCACCTTACAGCCTATGGTTTTATGGGAATCATAAAAGCTAATAAAACAGTATCATATATGCATGNAGGGTTGCCACCTTTTCTGGAAAAAAATACCTGCCTTCCTATATACAGTATTTATCTTTTTTCCCTATTAATAACATTGGGATCANCCATAATTTTTACCAAATAGGCTGTTAAATAACGNCCAGGTGGCAACCCTATACGCATNCTATGTATGGTGGGACTCTGTGCTGTCTATTNANACACATATCCTATGACACAANGNCNAGCCACAGTGTTTCAAGACATTACTTTCAGATGTTGGCNTCNCTGAAGAAGGTAGAAAACAATAAAAGTTNCCANCTATTNNNNNAGCTGCTGAGNNTAAAGGAGCCTGNCNCCCAG
  5   1   0       add Emb4                            IMAGE:5515344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCAATCAGCTGGACAAATAAGAACATAACCGTTCATCTCTATGGGATATTATGAGTGATTCATATATATACACATTTAAATATGAATGCTCTAAATGCAATTTTACATTATTTGTACTGGAAGCAGGAAGAGTATCTGCAAACAAAGTAATGCAACTAATAGTaaaaaaaaaGTGAATTTGCTATATGACTGGCTAAAATACTTACCTGAAAATAAGTGTAATACTTATTATATAAGAAAATACATACTTGCTAACGGTCCCTTATTTCCATATAAAGTAAAGATTGTTTTCCCTGGACATTTTTGAAGTTTTTAAAATTTACTGCACAGCAATCTCAATATCAGAAATCAGTTCTCATTTTCTGCTCTCACCTTACAGCCTATGGTTTTATGGGAATCATAAAAGCTAATAAAACAGTATCATATATGCATGTAGGGTTGCCACCTTTTCTGGAAAAAAATACCTGCCTTCCTATATACAGTATTTATCTTTTTTCCCTATTAATAACATTGGGATCAACCATAATTTTTACCAAATAGGCTGTTAAATAACGGCCAGGTGGCAACCCTATACGCATGCTATGTATGGTGGGACTCTGTGCTGTCTATTAACACACATATCCTATGACACAAAGGCCCAGCCACAGTGTTTCAAGACATTACTTTCAGATGTTGGCTTCTCTGAAGAAAGTAGAAAACAATAAAAGTTACCAGCTATTTGCTGCAGCTGCTGAGTTTAAAGAGACCTGACACCAGACATAAAAGCTGGATATAAAAGTATTTTTCACTATGAAA
  5  -1   0       add Brn2                             Brn2-za43d05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGTTTTATGGGAATCATAAAAGCTAATAAAACAGTATCATATATGCATGGGNGGTTNCCACCTTTTCTGGAAAAAAATACCTGCCTTCCTATATACAGTATTTATCTTTTTTCCCTATTAATAACATTGGGATCAACCATAATTTTTACCAAATAGGCCGTTAAATAACGGCCAGGTGGCAACCCTATACGCATGCTATGTATGGTGGGACTCTGTGCTGTCTATTAACACACATATCCTGTGACACAAAGGCCCAGCTACAGTGTTTCAAGACATTACTTTCAGATGTTGGCTTCTCTGAAGAAGGTAGAAAACAATAAAAGTTACCAGCTATTGCTGCAAGCCGCTGAGTTTAAAGGAGACCTGACACCCAGACATAAAAAGCTGGATAATAAAAGTAATTTTCAACTATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)