Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4030928-IMAGp.5                17 PI      91          4     1486                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:5542340.5                       4 PI      92        935     1762                Unknown (protein for MGC:114776) [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012767793 Xl3.1-IMAGE:8550737.5 - 151 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                      4     4     5     6     5     9     7    10    11    16    18    21    18    23    30    40    30    41    34    44    46    49    50    54    51    55    52    56    52    57    53    57    53    58    53    58    53    58    53    58    53    59    55    60    55    60    56    61    56    61    58    63    58    63    59    64    58    64    59    64    58    63    57    63    61    64    60    64    60    63    59    64    64    65    63    65    64    66    64    64    64    64    65    66    64    66    64    65    64    66    65    66    64    66    63    66    61    65    60    65    60    65    58    62    54    60    45    60    53    59    49    59    44    60    46    59    43    57    41    53    39    53    43    53    40    52    34    52    36    51    35    51    32    50    28    46    26    44    27    43    22    42    21    40    22    39    21    38    23    39    21    38    21    37    20    36    18    34    18    31    17    28    16    28    16    27    15    27    17    27    17    27    17    29    18    31    17    32    17    35    20    35    21    35    17    36    19    38    19    39    22    39    24    42    28    45    31    48    33    50    39    53    42    56    46    58    44    57    48    59    50    60    44    59    50    59    49    60    52    61    51    59    51    61    49    61    52    62    52    61    53    60    52    60    54    62    57    64    57    66    60    67    52    66    60    66    62    65    61    64    59    64    61    66    59    68    63    67    62    66    63    66    63    67    63    66    64    67    64    66    63    66    63    66    64    67    60    65    60    66    61    65    62    67    60    66    46    64    59    63    46    62    46    62    46    62    45    61    46    61    46    60    44    61    44    59    13    57    12    55    11    51    11    40    11    29    10    20    11    16     9    11    10    11     7    11     4    10     4     9     4     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTCCCGCAATTTGTTCGATTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACACTTAAGTTAAATACTGTATAATAAACGTTCAG
                                                                   SNP                                                                                             ---T-----G--
                                                                   SNP                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                             -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -A--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---A--------
                                               BLH ATG     134    3655                                 
                                               BLH MIN     134     359                                 
                                               BLH MPR     134     359                                 
                                               BLH OVR     134     461                                 
                                               CDS MIN     134     359                                 
                                               ORF LNG     134      59                                 
  5   1   2       bld Neu7                                 XL038h02.5p                                                                                                                                                                                                                                                                      TATCCAGGCCTGTNAAGAACTCGCCCAGACTACACGCACTGCCTATGGACCAAATGGAATGAACAAGATGGTTATCAATCATTTGGAGAAGCTTTTCGTTACAAACGATGCCGNCACCATTATAAGGGAACTAGAGGTT
  5   1   2       bld Oo1                             IMAGE:3404777.5p                                                                                                                                                                                                                                                                                        ACTTGCCCAGACTACACGCACTGCCTATGGACCAAATGGAATGAACAAGATGGTTATCAATCATTTGGAGAAGCTTTTCGTTACAAACGATGCCGCCACCATTATAAGGGAACTAGAGGTTCAACATCCGGCTGCCAAAATGATTGTGATGGCTTCCCACATGCAAGAGCAAGAGGTCGGGGACGGGACTAACTTTGTCCTGGGCTTTGCTGGAGCTTACTTG
  5   1   2       bld DMZ                                  xl261b18.5p                                                                                                                                                                                                                                                                                                          CACTGCCTATGGACCAAATGGAATGAACAAAATGGTCATCAATCATTTGGAGAANCTTTTCGTTACAAACGATGCCGCCNCCATTATAAGGGAACTANAGGTTCAACNTCCGGCTGCCAAAATGATTGTGATGGCTTCCCNCATGCAAAAGCA
  5   1   2       bld Tbd1                                 AW765377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCTGGAGCTTTACTTGAGCTGGCAGAAGAGCTTCTAAGAATGGGACTGTCTGTATCCGAGGTGATTGAAGGCTATGAAAAGGCCTGTAAGAAAGCCTTAGAAATACTCCCCGACCTGGTCTGCAGTTCTGCAAAGAATTTACGTGATGTTGATGAAGTGGCCTCCCTTCTTCAGACGGCCATCATGAGCAAGCAGTATGGCAACGAGCTCTTTCTTTCCAAGCTCATCGCCCAGGCGTGTGTGTCTATCCTTCCCGACTCTGGCAATTTCAATGTTGACAACATCAGAGTGTGCAAGATTTTGGGATCGGGTATCTGCTCCTCTTCTGTCTTGCACGGCATGGTTTTCAAAAAGGAAGTAGAAGGAGATATCACTTCTGTGAAAGACGCCAAAATCGCAGTTTATTCCTGTCCGTTTGATGGCACGATCACCGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGGAGGAGCAAGTGAAGGCGATCGCAG
  5   1   2       bld Brn2                             Brn2-za42b07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTTCTAAGAATGGGACTGTCTGTATCCGAGGTGATTGAAGGCTATGAAAAGGCCTGTAAGAAAGCCTTAGAAATACTCCCCGACCTGGTCTGCAGTTCTGCAAAGAATTTACGTGATGTTGATGAAGTGGCCTCCC
  5   1   2       bld Ga12      in                         XL178n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTCCTTTCNAACTCATCGCCCAGGCGTGTGTGTCTATCCTGCCCGACTCTGGCAATTTCAATGTTGACAACATCAGAGTGTGCAAGATTTTGGGATCGGGTATCTGCTCCTCTTCTGTCTTGCACGGCATGGTTTTCAAAAAGGAAGTAGAAGGAGATATCACTTCTGTGAAAGACGCCAAAATCGCAGTTTATTCCTGTCCGTTTGATGGCACGATCACCGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGGAGGAGCAAGTGAAAGCGATCGCAGATGCAGGGGCCACCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAG
  5   1   2       bld Sp1       in                    IMAGE:4965448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGTCCGGTTGACAACATCAGAGTGTGCAAGATTTTGGGATCGGGTATCTGCTCCTCTTCTGTCTTGCACGGCATGGTTTTCAAAAAGGAAGTAGAAGGAGATATCACTTCTGTGAAAGACGCCAAAATCGCAGTTTATTCCTGTCCGTTTGATGGCACGATCACCGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGGAGGAGCAAGTGAAGGCGATCGCAGATGCAGGGGCCACCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCG
  5   1   2       bld Skin                            IMAGE:8643296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGTTGACACATCAGAGTGTGCAAGATTTTGGGATCGGGTATCTGCTCCTCTTCTGTCTTGCACGGCATGGTTTTCAAAAAGGAAGTAGAAGGAGATATCACTTCTGTGAAAGACGCCAAAATCGCAGTTTATTCCTGTCCGTTTGATGGCACGATCACCGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGGAGGAGCAAGTGAAGGCGATCGCAGATGCAGGGGCCACCGTTATTGTGACAGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATNCATACGCCATTAAAAAGTTGCT
  5   1   2       bld Lmb1      in                    IMAGE:8533227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTTCTGTCTTGCACGGCATGGGTTTTAAAAAGGAAGTAGAAGGAGATATCACTTCTGTGAAAGATGCCAAAATCGCAGTTTATTCCTGTCCGTTTGATGGCACGATCACTGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGGAGGAGCAAGTGAAAGCGATCGCAGATGCAGGGGCCACCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGNGCTGGATCAATACGCCATTAAAAATTTGCTGAAGCCTTTGAGTCCATTCCAGGGCATTGGCTGGAACTCTGGTGTCAAGCCAATGAAATCTCTCCAACCTCTAGCATGCACAGGAAGGA
  5  -1   2       bld Brn2                             Brn2-za45d04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTCCGTTTGATGGCACGATCACCGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGTAGGAGCAAGTGAAGGCGATCGCAGATGCAGGGGCCACCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCGCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGAC
  5   1   2       bld Te2N                            IMAGE:7205057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACGATCACCGAGACAAAGGGCACCGTGCTGATAAACAGCGCACAGGAACTGATGAACTTCAGCAAAGGAGAAGAGAATCTGATGGAGGAGCAAGTGAAGGCGATCGCAGATGCAGGGGCCACCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCGCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCACCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAGACATGATGGAGAGCAGATATTGGACACGTATCTAGTGAATACTGGGGGGATAAGTGGGCACAAACGCAGCGATACT
  3   1   2       bld Ga18      in                      xlk103d14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCnnnnnnnnnAGNNAANGGNNNCNNNNTGANAACAGNNNACAGNACTGNNGACTTCAGCNANGNNAGAGATCTGANGNNGAGCANGTGANGNNGATNNNNNTNNAGGGNCACNGTTATTNTGACAGGAGGCAAAGTTGCCGACATGGCNNNCCATTNNNNAAACAAAATACANCTNATGGTAGTAAGGTTAANCTCCAAATGGGATCTTCGAAGACTGTGCAAANCCGTATGTGCNNCTGNCCTTCCCAGGATGNCCCCTCCTACAGCAGAGGAGATNGGACACTGTGACAGTGTTTACNTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACANCCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGNCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTNCCCTGGGCTGGATCAATACGCCATTAAAAAGTNNNNNNAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCNCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTANNNCTTAAGTTAA
  3   1   2       bld Tad1 5g3  in                    IMAGE:6878875.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGATGGGGAGAGCCAAAGTGTAGGAAAAGGTGAAATTTCGACCAGGATTGGGCGGGGGGGCCCACACCCGTGTATTATTGTTTTGGCGCGGGGAGGGGACAAAAATTTTGCCCGAACACAGGGCTTCTTCCCATGTACGGCAAAAACAAAATACCAACCCTTCATGGGTAATAAGGGTTAAAACTCCCAACATGGGATTTTTCGAAGACTTTGCAAAAACCGGTATGGGCAATTGCGCTTCCCCAGGATGACCCCTCTTACAGCAGAGGAGATTGTACACTGTGACAGTGTTTCTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGGGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGGAAAGATTAGTCGCTTTTTTTCCCGCA
  3   1   2       bld Ga18      in                       xlk71a08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATNAANNAGNGCACAGGNACTGATGNACTTCAGCAAAGNAGAAGAGAATCTGATGNAGGAGNAAGTGNAGNNGATCGCAGATGCAGGGGCCACNGTTATTGTGACAGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGNTTAANCTCCAAATGGGATCTTCGAAGACTGTGCAAANCCGTATGTNNAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACANCCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTNCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTAANACTTAAGTTAAATACNGTATA
  3   1   2       bld Tad2      in                    IMAGE:6873796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAATTTTGGGTGCCATTTTAACGCGGCCCGGGGGGACCAATGGGCCTTTTCCCTATTTCGCCCAAAACCAAATTTACAAACTCTCCATGGGTAGGTAAAGGTTAAAACTTCCAAAATGGGGATTTTTGGAAAGACCTGTGCAAAACCCGTATGTGCCAACTGCCCTTCCCCGGGATGACCCCTCTTACAGCAGAGGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCCAATTTGTTCGACTTAACACTTGGA
  3   1   2       bld Tail      in                    IMAGE:8542022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGTGTTAACGCGCCCGAACTGAATCGGCAGGGAAGATCGTGAGGCCATGAGCATCCAGTCAGGCACGTAATTGACAGAGGCAGTGCCGACATGCTTCATAGCAAACAAATACAACCTCATGTAGTAGTAACTCAAATGGATCTCGAGACTGTGCAAACGTATGTGCACTGCGCTCCCAGGATGACCCTCTACAGCAGAGAGATGGACACTGTGACAGTGTTTACTGTCAGAAGTTGGGGATACACAAGTGTGTGTCAAACATGAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACTCATGGACGACGTGGAAAGAGCTGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTAACACTAAGTAAATACTGTATATTTAAGCG
  5   1   2       bld Emb9      in                    IMAGE:7976428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGCAGGGGCCACCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTTTGCAAAACCGTATGTGCAACTGCGCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCAT
  5   1   2       bld FaB                             IMAGE:8072662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGTTATTGTGACGGGAGGCAAAGTTGCCGACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCANGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCACAACGCAGCGATTATGTACTTCGGTTGACAGTATATATGGCAAAGCGCTGGGGACCAGAGCCCCAACAGCAGGACCTGGATAGG
  3   1   2       bld Emb9      in                    IMAGE:7976428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGACATACTTGTTTGGCCTAGAAGTTGTCGATCGGATACGGGCCGTATTGAGGAGCAGTGCGACTGTTCCTTAGCAAAATACACTCTGAGAAGGTAACTCAATGATTCTGGAGATTGCAAACGTAGGCAAATGGTTCTCAGATGCCCTCTACAGCAGAGAGATTGACACTGGACAGTGTTACTTGTCAGAAGTTGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTGTTCACTTACAC
  3   1   2       bld Eye1      in                    IMAGE:6948616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGCTTTCCCTTACCGCAAACCAAATACAACCTCATGGGTAGTAAGGGTTAAACTCCAAATGGGATCTTGGAAGACTGTGCAAAACAGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCANATTTGTTCACTTAACACTTAAGTTAAATAGGA
  5   1   2       bld Tad2      in                    IMAGE:6873796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACATGGCTCTCCATTACGCAAACAAATACAACCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGGAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGGAATACTGGGGGGATTAAAGTTGGCCACAAACGCAGCCGATTACTGTACTTTCGGGTTGGACCAGAATCCATCATGGGGAAAACCCAGCCGN
  3   1   2       bld Spl  5g3  in                    IMAGE:8464579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCAGAGCTCAATCAGCACCTATGACGAGCAGTCGACAGCTTCATAGCAACAATCACTCATGTGTAGTAACTCAATGGATCTCGAGATGTGCAAACNGAGTGCACTGCCTTCCAGATGACCTTCTACAGCAGAGAGATGGACATGTGACAGTGTTACTGTCAGAAGTTGGGATACACAAGTGTNGTGTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCTAA
  3   1   2       bld Spl  5g3  in                    IMAGE:8463447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGTATTACGAAGCAGTTCGACTGCTTCATTAGCAACAATCACCTCATGTGTAGTTACTCCAAATGGATCTCGAGACTGGCAAACCGTATGGCAATGCCCTTCCAGGATGACCCTCTACANGCAGAGAGATGGACACTGTGACAGTGTTACTTGTCAGAAGTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTACACTTAAGTTAAATACTTTATAATCAT
  3   1   2       bld Ga18      in                      xlk110i21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AANNAATNNNNNNCATGNTAGNANGNTTAAACNCNAAATGGGATCTTCGAANGNCTGTGCAAAANCGTATGTNNAACTGCCCTTNCCCAGGATGNCCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGNNCATTGCTACAATTGTGATCCGCGGCTCCACAGACANCCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTNNTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTAANNCTTAAGNNA
  3   1   2       bld Ga18      in                      xlk153b01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNAAANNAANNNNCCTCATGGTAGTANGNNTAANNNAAATGGGATCNTCGAAGACTGTGNAAAACCGTATGNNNAACTNNCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATNGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGNNCATTGCTACAATTGTGATCCGCGGCTCCACAGACANCCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGNCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTNNCCTGGGCTGGATCAATACGCCATTAAAAAGTNNNNNNAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGATTAANNCTTAAGTTAAA
  3   1   2       bld Thy  5g3  in                    IMAGE:8550737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTATTCGAGCAGTGCGCAGCTTCATAGCACAATCACTCAGTGTAGTAACTCAATGGTCTCGAGATGGCAACGTAGTGCACTGCCTCCAGGATGACCCTCTCAGCAGAGAAATGGACACTGTGACAGTGTTTACTGTCAGAAGTGAGGATACACAAGTTGTTGTTTCAAACATGAAAAAGAAGACGGGGCCATGNCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATTGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCTA
  5   1   2       bld Ga18      in                       xlk63b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGNGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTNNNNNGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGNTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGANTCGACATCGAGNCGNNNNNNCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGNTGGNCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAG
  5   1   2       bld Bone                            IMAGE:8743251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCATGGTAGTAAGGTTAAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCCTGCTTTGTGACTCTCGGAGAAAGGA
  3   1   2       bld Thy       in                    IMAGE:8549113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCATGGTAGTAGGTAAACCTCCGAGAGTGATCGTCGAAGCTGGCAAACGTATGTGCACTGCCCTTCCCAGAATGACCTCCTCTACAGCAAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTGGGGATACACAAGTTGTGTGTTCAAACATGAAAAAAGAGACGGGGCCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCTAATTTCTTCCGG
  5   1   2       bld Egg5                            IMAGE:3431605.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACTCCAAATGGGATCTTCGAAGACTGTGCAAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTTCTCTCCAAACTCTACGCCATGCACCANGAAGGCAACAAGAACGTGGGATTCGACATCTAGGCGGAGACTGCGGCCATGAAAGACATGAATGAGAGCCAGATATTGAACACGTTTTTTATTGAAATACTTGGGGTTAAAGTTGGG
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGGATCTCGAGATGTGCAAACNGTATGTGCACTGCCCTTCCCAGATGACCCCTCNTACAGCAGAGAAATGGACACTGTGACAGTGTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATTGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTTTCACTTACACTAAGTTAATACGTTATAACTCTCGT
  3   1   2       bld Lmb1      in                    IMAGE:8532672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTGTGCAAACCGTATGTGCAACTGCGCTTCCCAGGATGACCCTCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTAAATACTGTATAATAAACGTCAGTTCTTC
  3   1   2       bld Lmb1      in                    IMAGE:8533227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAACCGTATGTGCAACTGCCCTTCCCAGGATGACCCCTCCTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATAACACTTAAGTTAAATACCGTATAATAAACCGTTCC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCGAGATGGCAACGTAGTGCACTGCTTCCAGATGACCCTCTCAGCAGAGAGATGGAACTGGACAGGTTACTGTCAGAGTGGGGATACACAGTGTTGTGTCAACATGAAAAGAAGACGGGCCATTGCTACAATGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTTTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu7 5g3  in                         XL003d05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTACAGCAGAGGAGATTGGACACTGTTGACAGTGTTTACTTGTCCAGAAGTTGGGGATACACAAGGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACNTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTT
  3   1   2       bld DMZ  5g3  in                         xl305o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCNTACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACNNGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTT
  3   1   2       bld Ga12 5g3  in                         XL150g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACAGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGTGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTT
  3   1   2       bld DMZ       in                         xl262n15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGAGGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGNTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGNTCCGCGGCTCCACAGNCAACNTCATNGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAANGTCNTCACACGGGACAAGCGCNTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACNCCATTAAAAAGTTTGCNGAAGCCTNNGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGTCCAATGAAGTCCTC
  5   1   2       bld Brn3                            IMAGE:8539199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGATTGGACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCTGGAGGAGGAGCAGTGGAAATCGAGTTGGCAAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTANGGCTGTGTAAGAGAACAGTATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGGAAGAAGGACTGGNATGACGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATGTGCGCGCAGTAAGATTAGTCGCTTTTTTTCCNGCATTNGTT
  3   1   2       bld Ga15      in                       XL427j09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACACTGTGAACAGTGTTTNNCTTGTCAGAAGTTGGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTAAA
  5   1   2       bld Ga15      in                       XL427j09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCttttttttCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGA
  3   1   2       bld Te2N      in                    IMAGE:7202347.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTGTTCGATAACACTAAGTAAATCCTGGATAACTCATG
  5  -1   2       bld DMZ                                  xl244c05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGACAGTGTTTACTTGTCAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCtttttttttCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAAC
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3199531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGCAGTGTTACTGGTCACAAGTGGGGATACCAAGTTGTGTGTTCAAACATGAAAAAGAGACGGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGGACAACCTCATGGACGACGTGAAAGAGCCGTAGATGACCCCGTGAACACTTTCANAGTCCTCACACGGGACNAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGAT
  3   1   2       bld Emb4 5g3  in                    IMAGE:4970188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTACTGTCAGAAGTTGGGATACACAAGTGTGTGTTCAAACATGAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCAGCAATTTGTTCACTTAACACATAAGATAAATACGGAAACAGACGTCGTGGACCAC
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3579713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGTGGGGAATACACAGCTCGTTGTGTTCCAACATGAAAAAAGAAGACGGGGCCCAGTGCTACAATTGGGACCCCGGTTTCCCCAGACAACTTCATGGACGACGTGGAAAGAGCGTAAGATGACGCCGTGAACACTTTCAAAGTCTTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAAAA
  5  -1   2       bld DMZ                                  xl259d06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTNTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCtttttttttCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAAC
  3   1   2       bld Ga12      in                         XL178n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTTGGGGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACTTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCNTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTNTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGTATTAGTCGCTTTTTTTTTCCCGCAATNTGTTCGATTAACACTTAAGTTAAATNCTGTATAATAAA
  3   1   2       bld DMZ  5g3  in                         xl275j13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTCACTAACACTAA
  5  -1   2       bld DMZ                                  xl295b23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACACAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGNCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCANGGCAAAACCAGCGGGCG
  3   1   2       bld Neu7 5g3  in                         XL009c05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAGTTGTTGTGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACG
  3   1   2       bld Ga18      in                       xlk63b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TNNNNTTCAANCNTGAAAAAAGAANGACGGGGCCNTNCNNNAATNNTGATCCGCGGCTCCANNAGNCNACNTCATGGACGACGTGGAAANNANCCGTAGATGNCGCCGTNNACACTTTCAANGNCNTCACACGGGACAAGCNCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAAGTTTNNTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTAANNCTTAAGTTAAATAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTCAAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCACCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATACCCAAAAAAAAAAAAAAAG
  5   1   2       bld Lmb2                            IMAGE:8638713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACATGAAAAAGAAGACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTANAGATTAGTCGCttttttttCCCGNCATTTGTTCGATTAACACTTAAGTTAATACTGTATATAAACGTTCAGTTTCTGATaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld DMZ       in                         xl341f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCGGCACGAGGACGGGGNCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTAACACNTAAGTAA
  5   1   2       bld DMZ       in                         xl341f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGT
  5   1   2       bld Emb4                            IMAGE:4682478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGCCATTGCTACAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCttttttttCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATaaaaaaaaaaaaaaaaG
  5   1   2       bld Ga15      in                       XL516p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGCAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATaaaaaaaaaa
  3   1   2       chi Lmb2      in                    IMAGE:8635464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAGCTATATTTGGTTACCGCGTAGCCAAAAAGACTATACTACTTTTGCTGGATCCATTCGATGGAATTTGTCCCCCTTACAACTCTTCCCACGGGACAAGCCCCTTTTACCGCGAGGGGGAGCTGTGGAAATCGAGTCGGCGAAACACATAACATCTTATGGAGAGACCTGCGCGGGGTGCGACAGATACGCCCTTAAAAAGTTTGTTGAAGCCTCTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAATTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAAATGATCGATCACACNNCNGTACCNNNGnnnnnnnnnnnnnnCCCTGTT
  3   1   2       bld Ga15      in                       XL516p16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATTGTGATCCGCGGCTCCACAGACAACCTCATGGACGACGTGGAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTAAATA
  3   1   2       bld DMZ       out                        xl257a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACGTGGAAAGAGCNGTAGATGNCNCCGNGAACACTTTNAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATANCATGTTNNGGAGAGACCTNNCCTGGGCTGGATCANTACGCCATTAAAAAGTNTGNTGAAGCCTNTGAGTCCATTCCAAGGGCNT
  3   1   2       bld Egg6                            IMAGE:4435820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAGAGCCGTAGATGACGCCGTGAACACTTTCAAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGAACCAANNCGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTTCCCGCAATTTGTTCGATTAACACTGAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAA
  3   1   2       bld Tbd1                                 AW782467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTTCAAAGTCCTCACACGGGACAAAGCGCCTTGTACCGGGAGGAGGAGCAGTGGAAATCGAGTTGGCGANACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAA
  5   1   2       bld Lmb2      in                    IMAGE:8635464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTCAAGTCCTCACACGGGACAAGCGCCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTGTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACNGGAAAGAAAGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGAGATCATTGTGCGCGCAGTAAAGATAGTACGCttttttttCTCGCATTNGTTCGATAACACTTAAGTTAATACTGTATAATAAACGTCAGTTCTGATCACCTGGAGaaaaaaaaaaaaaaaaaaaaGGCGCGCCAGCTGAATTCTTAACGCGTCGGCTCTCGCTCTATGGTGGATACTGATCCACTGAAGAACATGTATTGGCAACCACAAATCTGAAA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGGCCAAGCGCCTTGTACCCGGAGAAGGAGCAGTGGAAATCGAGTTGGCGAAACACATAACATCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGAT
  3   1   2       bld FaB       in                    IMAGE:8070522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGACAAGGCGCTTGTACCCGGAGGAGGAGCAGTGGAAATCGAGTTGGCGAACACATAACATCTTATGGAGAGACTGCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATTGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCCGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTAAATACTCAACCCCCTCCTCCCCCCCCCC
  3   1   2       bld Emb4 5g3  in                    IMAGE:4203608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAACATCTTATGGAAAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGTGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAAAAAAAAAAAAAA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4202961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTCTTATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAATTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGGGTCAAGGCCAATAAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAANACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAAAAAAAAAAAAAA
  3   1   2       bld Ov1                             IMAGE:4055618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTNTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCGCCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTTCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATA
  3   1   2       bld Sp1       in                    IMAGE:4965448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGGAGAGACCTGCCCTGGGCTGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk109g11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTGGGCTGGATCAATACGCCATTAAAAAGTTTNNTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCTTTTTTTTTCCCGCAATTTGTTCGANNNNNNTTAAGTTAANNNCTG
  5   1   2       bld Ga18      in                      xlk109g11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTNGNNNGATCAATACGCCATTAAAAAGTTTGCTGAAGNCTTTGAGTCCATTCCAAGGGCATTGGNTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGNNNNNNCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGGGATGGAATCATTGTGCGCGCAGTAAAGATTAGTCGCtttttttttCCCGCAATTTGTTCGATTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATaaaaaaaaaa
  3   1   2       bld Neu7 5g3  in                         XL003m03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGATCAATACGCCATTAAAAAGTTTGCTGAAGCCTTTGAGTCCATTCCAAGGGCATTGGCTGGAAACTCTGGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTGACACTTAAGTTAAATAC
  3   1   0       chi Tbd5      out                   IMAGE:3580900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCTGGCGGAAATTCTGGGTGTCAAAGCAAACGAATTCCTCTCCAAACTTTATTCAATGCACCAAGAAGGCAACAACAACGTGGGATTCGACATTGAGGCAGAGAGTGCGGCAGTGAAAGACATGCTGGAAAGCAACATATTCGACACGTATCTAATGAAATACTGGGGGATAAAGTTGGCTACAAACGCAGCCATTACTGTACTTAGGGTTGACCAGATTATAATGGCAAAAGCAGCCGGTGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGACGAACCAGACAAATCATAGGGCTCCATCATTATGGCAAAACCAGCAGGAGGCCCAAAAGCACCAACGGGAAAGAAGGACTGGGACGACGACCAAAATGACTGAACGAATGTCTGAATCCGTTTGGTCTAATCATTAAGTGCAGTACAGATTTTTTTTTTTTTTTTTGCTATTTGTTCACTTACCCTTAAGTTAAATACTGTATAATAAACGTCCGTTAACCGATAAAAAAA
  3   1   2       bld Emb4                            IMAGE:4203352.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGTCAAGGCCAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4173754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTCAAGGCAAATGAAGTCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTTCTGTACTTCGGGGTTACCCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAAATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGTTTCTGATA
  3   1   2       bld Ga18      in                      xlk127m19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCTCTCCAAACTCTACNCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGGAGACTGCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTANNNCTTAAGNNANNNC
  5   1   2       bld Ga18      in                      xlk127m19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCTCTCCAAACTCTACGCCATGCACCAGGAAGGCAACAAGAACGTGGGATTCGACATCGAGGCGNNNNNNCGGCAGTGAAAGACATGATGGAGAGCAAGATATTGGACACGTATCTAGTGAAATACTGGGGGATAAAGTTGGCCACAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATTATAATGGCAAAAGCAGCTGGCGGACCAAGAGCCCCCAAACAGCAAGGACACTGGGATAAGGATGACTGGCAAGATGAACCAGAAAAACCTTAGGGCTGTATCATCATGGCAAAACCAGCAGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGTATAATAAACGTTCAGNTTCTGATNNaaaaaaaaaa
  3   1   2       bld Bla1      in                    IMAGE:3379709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGCAAACGCAGCGATTACTGTACTTCGGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGCTTTTTTTCCCGCAATTTGTTCACTTAACACTTAAGTTAAATACTGT
  5   1   2       bld Bla1      in                    IMAGE:3379709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTTGACCAGATCATCATGGCAAAACCAGCGGGCGGCCCAAAAGCACCGACGGGAAAGAAGGACTGGGATGATGACGAGTGATCACCTGCTTTGTGACTCCGGAGATGGAATCATTGTGCGCACAGTAAAGATTAGTCGC

In case of problems mail me! (