Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL445b15ex.3                         66 PI      93          2      828                (no blast hit)

 This cluster: approximate FL confidence score = 77%

 1012767848 Xl3.1-IMAGE:6949834.5 - 58 ESTs
                                                                       .....-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6949834.5                                                                                      TTTTCCATTGGTTAATATGGCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGCTGGATGTTTGAGCTGCTGTCGATATTTGTCACATTAAATCATTTTTG
                                                  Xl3.1-CHK-1012686392                                                                                            ATTGGTTAATATGGCGCTGGCAAGTGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGxxxGxTxxxxxxGCTGxxGTCGATATTTGTCACATTAAATCATTTTTGTTTCAA
                                                      consensus depths                                                                                           3     4     3     5    11    12    17    21    21    28    23    31    25    31    26    32    26    33    26    33    28    37    29    37    31    38    35    40    36    41    35    41    35    42    38    43    38    44    42    47    41    48    41    48    43    48    44    48    43    48    44    48    40    48    45    49    45    49    49    51    50    51    51    52    51    52    49    51    49    51    50    51    48    53    50    53    50    53    50    53    51    53    49    53    50    53    49    53    49    53    49    52    50    51    44    51    44    48    44    46    44    46    40    45    37    44    40    44    41    44    40    44    40    43    36    42    34    41    27    37    29    36    30    34    27    33    26    31    26    31    26    30    24    29    24    29    24    28    24    27    24    26    22    26    21    26    19    25    12    24    12    23     7    23     6    22     4    15     3    11     2     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATTAGTTAACCATTTCCAATTCTGTGTGTGGCAC
                                                                   SNP                                                                                                                          ------T-----
                                                                   SNP                                                                                                                                                              ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                      ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                              ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                               BLH ATG      16      15                                                                                      
                                               BLH MIN      16     141                                                                                      
                                               BLH OVR      16     124                                                                                      
                                               EST CLI      19      43                                                                                      
                                               ORF LNG      16       4                                                                                      
                                                                                                                                                                                                                   PROTEIN --- Ci ---- 1e-016     NP_001027952.1 proteasome Z subunit [Ciona intestinalis] -----------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                          PROTEIN --- Gg ---- 2e-018     NP_989728.1 proteasome (prosome, macropain) subunit, beta type, 7 [Gallus gallus] -------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN --- Ce ---- 2e-055     NP_493558.1 proteasome Beta Subunit (31.2 kD) (pbs-5) [Caenorhabditis elegans] -------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 1e-079     XP_792356.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                PROTEIN --- At ---- 5e-080     NP_172765.1 20S proteasome beta subunit E1 (PBE1) (PRCE) [Arabidopsis thaliana] ------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                PROTEIN --- Os ---- 3e-081     NP_001056842.1 Os06g0153800 [Oryza sativa (japonica cultivar-group)] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                               PROTEIN --- ?? ---- 8e-083     XP_628966.1 proteasome subunit beta type 5 [Dictyostelium discoideum AX4] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN --- Xt ---- 2e-083     NP_001103512.1 proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7) [Xenopus tropicalis] --===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Ag ---- 1e-084     XP_559226.2 AGAP010718-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN --- Dm ---- 2e-086     NP_724974.1 CG12323-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                            PROTEIN === Dr ==== 6e-107     NP_571226.1 proteasome (prosome, macropain) subunit, beta type, 5 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PROTEIN --- Mm ---- 6e-107     NP_035316.1 proteasome (prosome, macropain) subunit, beta type 5; proteasome beta typesubunit 5 [Mus musculus] --------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PREDICTED - Bt ---- 2e-108     NP_001032701.1 hypothetical protein LOC534640 [Bos taurus] ------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PREDICTED - Cf ---- 6e-109     XP_537370.2 PREDICTED: similar to proteasome beta 5 subunit [Canis familiaris] ----------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                          PROTEIN --- Hs ---- 1e-109     NP_002788.1 proteasome beta 5 subunit; proteasome subunit, beta type, 5; proteasome subunitX; proteasome epsilon chain; macropain epsilon chain; multicatalyticendopeptidase complex epsilon chain; proteasome chain 6; proteasome subunit MB1;PSX large multifunctional pro [Homo sapiens]  ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                        PROTEIN === Xl ==== 4e-146     AAI55951.1 Unknown (protein for IMAGE:7394114) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6949834.5                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------ATG------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------TGA---------------------------------------------TAA---TAG
                                                                   ORF                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Te2  5g                         IMAGE:7209665.5p ACAAAGGTTTTCGGGTTCCGGAATTTCCCGGGATGTGACGCAACTGGGACGGCGTCGTTTTAACAATTGAAGGAAGAAGTGCGTGTTTTCCATTGGTTAATATGGCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACTACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAAGCCCAGAGCTGGCACGGCGTTCCATTTNACAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGACTTTATACACGTGCGTGAGGATGCTGGGTGCGGTGTCTCA
  5   1   2       bld Ga15 5g3  in                       XL410l19ex.5p                                                                          AAGAAGTGAGTGTTTTCCATTGGTTAATATGGCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGACATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCANTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTANAANAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCANGCCACATATCNTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACNTGCGTGAGGATGGCTG
  5   1   2       bld Te2  5x3  out                   IMAGE:7390798.5p                                                                              TGACTAGACAGTTCGGTCGGAATTCCGGGTCGCTGGCAGTGTGGTGAGTTCTGAAATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCTGTATGCCTATGGTGTCTAGACAGCGGAATAATATGATTGGAGTAGAAAACCCAGACTGGACGGGTCCATTTACAGCACATATGTGAGCTACCTGGGGATGTGACTATCACTGCTGAGATGCTGTGCGTGCCAGAGAGTTAGATGCCAAAATCAGCAGTATAGATGGACCTAGTGGATCATCATGTA
  5   1   2       bld Te2N 5g                         IMAGE:7766922.5p                                                                                      TTTTCCATTGGTTAATATGGCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGTTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGAAGATGTTTTAAAATTGACCCGAAATATCAGGGTCAAGTT
  5   1   2       bld Egg1 5g3  in                    IMAGE:3300510.5p                                                                                                 GCACGAGGGCGCTGGCTATTGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAATGGAACCGTGTGTC
  5   1   2       bld DMZ       in                         xl312i06.5p                                                                                                        GGCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGG
  5   1   2       bld Egg1                               PBX0063A01.5p                                                                                                         GCGCTGGCAAGTGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCT
  5   1   2       bld Ga15      in                       XL451c03ex.5p                                                                                                         GCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTANAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACNTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTANAATTGCACCA
  5   1   2       chi Te2N                            IMAGE:7765495.5p                                                                                                         GCGCTGGCAAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGCACAACTACTCTGGCCTTCAAGTTCCGTCATGGAGTTAACGTGGCAGTGCACTCCCGTGCTACCTCTGGGGCATAAATTGCCTCCTGAAGCGTGAAGCTTGAGATTGACTACTAAACGATACCCTCTATACCACTATATTAGGGACCGCAGCACACCGTACCATGTGGTAGAGAATGCTTGCCCCAAAGAGCCGCAGGTCTTATCTTGCCGGCCTATACCCCATGTCTGTGAATGTTGATACTCACCAGTTTGGCGTGATGGATTACTTGTTCTACTTGCGGTAATCTCCTAGCGACCTCTCTTAACTGACAGATACCATTTAATGGACCTGCCCATGTTCACTGTGACGCTGCTTCGACTTTGTTTACCTCCAATGTTATCTCTTCCATTTTTTTCACCCTGACTTTCTTTCTCTCCATACATTGTTATTAATCCTGTCCTCCTATAAATCTATCATCTTGACACTCTCTCTTAATGACCCTCTcgctctttcacggttttttacttctttccactagtctatatttcttatttctccttcttttctctctctgtcctatcttctccACTATAATGTTACTCCATTTTTACTCTATCATTTCCTCTTCTCCATATTTTCCTCACACCTACTCAATTCTTTTTTATCTACACCCATTTCTTCTCTTAA
  5   1   2       bld Gas8      in                    IMAGE:3516074.5p                                                                                                          CGCTGGCAAGTGTGGTGAGTTCTGAAGATCTGTTTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCCAGGAGGCCTTGCAACTGGAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGTCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGCGTTTAGC
  5   1   2      seed Brn1      in                    IMAGE:6949834.5p                                                                                                           GCTGGCAAGTGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAAGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAAGaaaaaaaaTTAGTGAGATCAATCCCAAAACTA
  5   1   2       bld DMZ                                  xl260a05.5p                                                                                                              GGCAAGTGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAANTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACNTTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCANACTGTANCTTCTGGGANAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAANAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCA
  5   1   2       bld DMZ       in                         xl264i22.5p                                                                                                                CAAGTGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCT
  5   1   2       bld Tbd5                            IMAGE:3580637.5p                                                                                                                 AAGTGTGGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACTACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCGCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGGGGAGGG
  5   1   2       bld Tbd7      in                         XL069e24.5p                                                                                                                 ACGAGGGTGAGTTCTGAACATCTGTCTTGGNAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACACCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGNGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGNACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAANGGAACCGTG
  5   1   2       bld Te2                             IMAGE:7394114.5p                                                                                                                    TGTGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGATTTGCACCAGAATATCAGGGTCAGTTACTAGGTATGCGACTCTNAGGNTGTGATCNGTACAGTGTCACTGACGACTCTG
  5   1   2       bld Neu7      in                         XL006c03.5p                                                                                                                       GGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTA
  5   1   2       bld Neu7      in                         XL012f12.5p                                                                                                                       GGTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTG
  5   1   2       bld Eye1      in                    IMAGE:6957153.5p                                                                                                                        CCGGATTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGGTCAATTAACTAGGTATTGGGGACCCCTTAAGGGTTGTGGAATCCCGTACAAGTTGATCAAACTTGACAGAACATACTGGGAGGAGGaaaaaaaaTTAGTGGAGATCATTCCCCCAA
  5   1   2       bld Te2N                            IMAGE:7206701.5p                                                                                                                        GTGAGTTCGGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGACATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAAGGTGTGAATCCAGTACAGGTGATCAACTGAACGACATACTGGGAGAGAAAAAAATTTAATGAAATTCATTCCCAAACTAAATATTAAATTAACCT
  5   1   2       bld Ga18      in                      xlk115e10ex.5p                                                                                                                        TGGTGAGTTCTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGNNNNGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGNGCTGNAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGNTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTNGTCTCTACTATGTGGACAGCGAAGGGAANCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGNTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAANTGGAGGTAGAAGAAGNCCAAGAGCTGGCACGGCGTTCCATTTACCAGGNCACATATCGTGATGCTTACTCTGGNNGNAGTGGNGAACTTATACCACGTGCGTGANGNTGGNTGGGNGCGGGNNTC
  5   1   2       bld Tbd7                                 XL100f21.5p                                                                                                                             GCTGAAGATCTGTCTTGGAACCGGCCCCGGGNATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAGACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAG
  5   1   2       bld Ga18      in                      xlk121l02ex.5p                                                                                                                              AGTTCTGAAGATCTGTCTTGGAACCGGCCNNNNNTAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGNNNNNNGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGNGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGNATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGANTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGANGGCCTGGNCTCTACTATGTGGACAGCGAAGGGAANCGTGTGTCAGGNTCAGTGTTTTCTGTGGGCTCTGNNTCCATGTATGCCTATNGTGTTCTAGACAGCGGATATAACTATGANNTTGGAGGNAGAAGAAGCCCAAGAGCTGGCACGGCGNTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGNGCG
  5   1   2       bld Eye1      in                    IMAGE:4757153.5p                                                                                                                               CGGAAGATTTGTCCTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGCACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTT
  5   1   2       bld Tbd7      in                         XL095d18.5p                                                                                                                               GTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTAC
  5   1   2       bld Tbd7      in                         XL108b19.5p                                                                                                                               GTGAAGATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAG
  5   1   2       bld Neu7                                 XL001e03.5p                                                                                                                                     TGTCTTGGNAACCGGCCCCGGGNATAGNACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAG
  5   1   2       bld Neu7      in                         XL044m11.5p                                                                                                                                     TGTCTTGGNAACCGGCCCCGGGNTAGNACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGNAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCC
  5   1   2       bld Ga18      in                       xlk74a03ex.5p                                                                                                                                       ATCTGTCTTGGAACCGGCCCCGGGATAGACCGGTGCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCNNNNNGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGNGCTGNAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGNATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTNGTCTCTACTATGTGGACAGCGAAGGGAACCGNGTGTCAGGNTCAGTGTTTTCTGTGGGCTCTGNNTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGNAGAAGAAGNCCAAGAGCTGGCACGGCGTTCCATTTACCAGGNCACATATCGTGATGCTTACTCTGGTGGAGNNNNGAACTTATACCACGTGCGTGAGGNTGGCTGGGTNNGGGTNTCTCAAGATGATGTTTTAGAATNNCANCAGAAANATCAGGGTCANGTTAACTAGGTGTTGGGNCTNNNNAGGGTTGNNAATNCAGTANNAG
  3   1   2       bld Ga18      in                       xlk74a03ex.3p                                                                                                                                        ATCTGTCTNGGNACCGGCCCCGGGATAGACCGNNNNCTGNGGCCTTGACCTCCATGGNACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCNNGGAGCCTGGGATCGAGTTTCTGCACGGGACANCCACTCTGNCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTANNNNNNCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCNTACCTTCTAGGTACTATGGCAGGNNNNCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGNATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTTGTGAGATCAATCCNAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATA
  5   1   2       bld Neu7      in                         XL012a11.5p                                                                                                                                         TCTTGGAACCGGCCCCGGGNATAGACCGGTCCACTGCGGCCTTGACCTCCATGGCACGAGTTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTNCATGTATGCCTA
  3   1   2       bld Te2  5x3  out                   IMAGE:7390748.3p                                                                                                                                                                GAGTACTGCTAGATAGAATGTCGATCGATGTCATGGAGTGAATGTTGACGCCCGAGACGTCATCGCTACTCAGCAGATTCAGGTGCCGAGTGGAAGACGCGAGCTGATGATTCTCACGACACCATCTGCNTCAGTTCGTCATGAGTATCGTGCTGTGACTCCGTGTACAGCTGCGCATACATGCCTCACAACAGGAAGAAGGTGATGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTGAGCTGCTGTCGATATTGCACATAATCANTAAGCC
  3   1   2       bld Ga18      in                      xlk115e10ex.3p                                                                                                                                                                                    CTTGACCTNCATGNCACGAGTTTCAGNNNCTGNCCGGANCTGNCGAAGGNNNNNNGNAGCNNGGGATCGAGTTTCTGCANGGGACAACCNCTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACNNNNNNGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTNCCTTCTAGGTACTATGGCAGGNNNNCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGANCTGCTGTCGAT
  5   1   2       bld Gas4      in                    IMAGE:3421434.5p                                                                                                                                                                                                     TTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCGTGGAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATT
  5   1   2       bld Tbd5                   IMAGE:3580637-IMAGp.IMAGp                                                                                                                                                                                                     TTTTCAGGTGCTGCCCGGAGCTGGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACTACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCCATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGT
  3   1   2       bld Brn1      in                    IMAGE:6949834.3p                                                                                                                                                                                                        AGGTGCTGCCCGGAGCTGGGCGAAGGAACCCGCGGAGCCTGGGATCGAGTTTTTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTTGGCACCTGGATGTTGAGCTGCTGTCGATATTGTCA
  3   1   2       bld Eye1      in                    IMAGE:6957153.3p                                                                                                                                                                                                        GGGGAAAAGGAAACCCGGGGGAAGCCTTGGGAATGGGAGTTTTCTGCCACGGGGACAACCCAATTTGGCCCTTTCAAGTTTCCGTCAAGGAGTTATCGTGGGCTGTCGACTCCCGGTGTTACAGCTGGCGCATACATTGCCTCCCAAACCAGTGAAGAAGGTGATTGAGATTAATCGGTACTTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGGTGGCACCTGGATGTTTGAGCTGCTGTCGATATTGTCACAATAACT
  3   1   2       bld Ga15 5g3  in                       XL410l19ex.3p                                                                                                                                                                                                                           GGCGAAGGAACCGCGGAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGACATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCCCTGGATGTTTGAGCTGCTG
  3   1   2       bld Ga15      in                       XL451c03ex.3p                                                                                                                                                                                                                                          GAGCCTGGGATCGAGTTTCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTTGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATAT
  3   1   2       bld Ga18      in                      xlk121l02ex.3p                                                                                                                                                                                                                                            AGCNTGGGATCGAGTTNCTGCACGGNACAACCNCTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTAnnnnnnnnGCATACATTGNNTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTNCCTTCTAGGTACTATGGCAGGNNNNCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGNNTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGNNACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGNCNCCTGGATGTTTGANCTGCT
  3   1   2       bld Ga15      in                       XL472o04ex.3p                                                                                                                                                                                                                                                           TCTGCACGGGACAACCACTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGC
  5   1   2       bld Ga15      in                       XL472o04ex.5p                                                                                                                                                                                                                                                                            CTCTGGCCTTCAAGTTCCGTCATGGAGTTATCGTGGCTGTCGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACC
  3   1   2       bld DMZ       in                         xl312i06.3p                                                                                                                                                                                                                                                                                                 ATGGAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTTGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATA
  5   1   2       bld Te2N                            IMAGE:7768803.5p                                                                                                                                                                                                                                                                                                    GAGTTATCGTGGCTGTGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATAGTGAGATCATCCCAACTATATTTAGTAACATTTTCATCTGTGGTGCACTGNATGTTGACTGCTGCGTATTGTCCATAATCATTTGTTTCAAGTaaaaaaaaaaaaaaaaaGGCGCGCTTATACCGAGATGTCTATTGGCGATAACTAGCTGCGCGTAACTCGCT
  3   1   2       bld Te2N      in                    IMAGE:7203245.3p                                                                                                                                                                                                                                                                                                                   TGGACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGGGCACCTGGATGTTGAGCTGCTGTCGATTTTCACAAAACATG
  5   1   2       bld Te2N      in                    IMAGE:7203245.5p                                                                                                                                                                                                                                                                                                                     GACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATATTTGTCACATTAAATCATTTTTGTTTCaaaaaaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl264i22.3p                                                                                                                                                                                                                                                                                                                      ACTCCCGTGCTACAGCTGGCGCATACATTGCCTCACAAACAGTGAAGAAGGTGATTGAGATTAATCCGTACCTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGC
  3   1   2       bld Neu7      in                         XL012f12.3p                                                                                                                                                                                                                                                                                                                            TGCTACAGCTGGCGCATACATTGCCTCACAAACCAGTGAAGAAGGTGATTGAGATTAATCCGTACNTTCTAGGTACTATGGCAGGAGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAAATTAGTTAACCATTTCCAATTCTGTGTGGGCACCGGATGTTTGAGCTGCTGTCGATATGTCACATTAAATCATTTTGTTCAAAA
  3   1   2       bld Gas8      in                    IMAGE:3516074.3p                                                                                                                                                                                                                                                                                                                                                                                                   AGTACAATGGCAGAGGCGCTGCAAAACTGTAGCTTTTGGGAAAGACTCCTGGCCCGTCAGAGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCGCATTCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATATTTGTCACATTAAATCATTTTTGTTTCAAAAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu7      in                         XL006c03.3p                                                                                                                                                                                                                                                                                                                                                                                                                AGGCGCTGCAGACTGTAGCTTCTGGGAGAGACTCCTTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCGGATGTTTGAGCTGCTGTCGATATTGTCACATTAAATCATTTTGTTCAAAA
  3   1   2       bld Neu7      in                         XL044m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTGTTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTTGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATATTGTCACATTAAATCA
  3   1   2       bld Tbd7      in                         XL095d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGACTCCTTGCCCGTCAGTGCCGCATTTATGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTCATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGAATNAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACNAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCGGATGTTTGAGCTGCTGTCGATATTTGTCACATTAAATCATTTTGTTTCAAAA
  3   1   2       bld Tbd7      in                         XL108b19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGCTAAGGAACAAAGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTAGTTAACCATTTCCAATTCTGTGTGGGCACCGGATGTTTGAGCTGCTGTCGATATTGTCACATTAAATCATTT
  3   1   2       bld Egg1 5g3  in                    IMAGE:3300510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGCGTATTTCAGTGGCTGCTGCATCAAAACTGCTGGCCAACATGGTTTACCAGTACAAAGGCATGGGATTATCCATGGGAACTATGATCTGTGGCTGGGATAAGAGAGGGCCTGGTCTCTACTATGTGGACAGCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATATTTGTCACATTAAATCATTTTTGTTTCAAAAAA
  3   1   2       bld Tbd7      in                         XL069e24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGNCNACATGGTTTANCAGNNCNAAGGCATGGGATTATCCATGGNANNTATGATCTGTGGNTGGGATAAGAGAGGGCCTGGTCTNTACTATGTGGACANCGAAGGGAACCGTGTGTCAGGTTCAGTGTTTTCTGTGGGCTCTGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACNACGNGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCNNCACTAATATTAGTTAACCATTNCCAATTNCTGTGTGTGGCACCTGNTATGNT
  3   1   2       bld Eye1      in                    IMAGE:4757153.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCCACGTGGTTTTCCAGTCCAAAGGCAGGGGATTTTCCTGGGGACTATTATTGGTGGTGGAATAAGAGAGGGCCTGGTTTTTCTTATGGGCCAAGGAAGGGAAACCGTGTGTCAGGTTCAGTGTTTTTGTGGGGTCGGCCTCCATGTATGCCTAGGTGGTTCTAGACAGCGGATATAACTTTAAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGG
  3   1   2       bld Gas4      in                    IMAGE:3421434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAACCGTGGTCCAGGTTCAGTGTTTTCTGTGGGCTCGGGCTCCATGTATGCCTATGGTGTTCTAGACAGCGGATATAACTATGAATTGGAGGTAGAAGAAGCCCAAGAGCTGGCACGGCGTTCCATTTACCAGGCCACATATCGTGATGCTTACTCTGGTGGAGTGGTGAACTTATACCACGTGCGTGAGGATGGCTGGGTGCGGGTGTCTCAAGATGATGTTTTAGAATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGGGACTCTTAAGGGTTGTGAATCCAGTACAAGTGATCAACTGACAGACATACTGGAGAGGAAAAAAATTAGTGAGATCAATCCCAAACTAATATTATTAGTTAACCATTTCCAATTCTGTGTGTGGCACCTGGATGTTTGAGCTGCTGTCGATATTTGTCACATTAA
  3   1   2       bld Neu7      in                         XL012a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACTCTGGTGGAGTGGTGNACTTANNCCACGTGCGTGAGNATGGCTGGGTNCGGGTGTCTCAAGATGATGTTTTAGNATTGCACCAGAAATATCAGGGTCAAGTTAACTAGGTATTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)