Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL060j19.3                            2 END     1           1       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL439f18ex.5                         47 PI      94         85      570                MGC82808 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012767858 Xl3.1-XL500p09ex.5 - 84 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL500p09ex.5 CTTTCTCTTTCCGGTAACCAAGATGTCTAAGAGAGGTGAGGGCTGAGCGCTCGTGACTTAAATCCGTCGTCATCTGCCGCTTTGTCCGGTAACCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACAAAAAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685791       CTTTCCGGTAACCAAGATGTCTAAGAGAGGTGAGGGCTGAGCGCTCGTGACTTAAATCCGTCGTCATCTGCCGCTxTxTCCGGTAACCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths      2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     8    24    35    43    59    51    68    53    70    41    72    54    73    71    75    73    75    75    77    70    77    77    77    75    77    76    77    79    80    79    81    81    81    78    81    78    81    80    82    80    81    82    82    70    82    82    83    81    83    80    82    80    82    80    82    79    81    66    81    62    81    59    81    59    81    56    79    43    69    35    61    46    52    46    51    45    49    31    41     4     8
                                                                   SNP                                                                                                                                                                                                             -C-------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                             G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                               BLH ATG      97     386 
                                               BLH MIN      97      97 
                                               BLH MPR      97      97 
                                               BLH OVR      97     127 
                                               EST CLI      96      70 
                                               ORF LNG      97       1 
  5   1   2       chi DMZ       in                         xl281n11.5p CTTTCTCTTTCCGGTAACCAAGATGTCTAAGAGAGGTGAGGGCTGAGCGCTCGTGACTTAAATCCGTCGTCATCTGCCGCTTTGTTCGCGTTGCCGATGGCTGAAATGATGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       chi DMZ       in                         xl281n11.3p CTTTCTCTTTCCGGTAACCAAGATGTCTAAGAGAGGTGAGGGCTGAGCGCTCGTGACTTAAATCCGTCGTCATCTGCCGCTTTGTTCGCGTTGCCGATGGCTGAAATGATGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAG
  3   1   2       bld Ga18 5g3  in                       xlk52i11ex.3p                                                       CNGCCCCNNCGTCNGNCCNNNNGTCCGCCCNNNNNNCGCCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACANNNNTGTGGCAAAGGAATGNNNCGATCTGTGGCCCAGGATNCNTCCA
  5   1   2       bld Te1  5x3                        IMAGE:6929127.5p                                                                             GGGCTCTTTCCGGTAACCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCACGATTGCGTCCAACGCAAGCCAGCATCGCATGAAACACCTCCCTTCCCCTTGTTaaaaaattaaaaaaGTATGTTAACCTCTACCGCCGTATTCCAACATAATACGAACTAAAACCTAATCTTCCTGGGTCCGGGGCCCCGCCCCTCCGTGGCCCTCTTCGCAAAAAAAGACCTTTTTCTTTTAGGACCCCAGTTCTTCGGCTTTTGGGTgccccccctctggcccccACATCATAGGGTATAAAGTGAGGAACCATTGGGGGCTCAAGAGGCTTGGGTTTTTCCTACGANGAGAAAACTCCCCGGGGCTCAGTGAACACTAAATGTGACCTTGAGGGTTTTccccccccccccgataaaaaaaaaaTTCACCCCCGGGGGTGGGCTAAACCCGGAAGAGGGGTTTTTTaaaaaaaaaaTACGCCGAAATTGGGAAATTTCCTTAGAAAGTCCATTTAGTCGGAGGATGTCCCAACACGCCACGAGAGATCTCCCCACACCCGGTATATCCTTAATATCTA
  5   1   2       bld Te1  5x3                        IMAGE:6929923.5p                                                                             GGGCTCTTTCCGGTAACCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaaGATGTATCAAAN
  3   1   2       bld Ga18 5g3  in                      xlk154a18ex.3p                                                                             CCCNNNNNCCGNCCACGCGTCCGGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATNNNTNCAACNNAGNNACNTCGCAT
  5   1   2       bld Tad2 5x3                        IMAGE:6873309.5p                                                                              CTCTCTTTCCGGTAACCAAGATGTCTGAGAGAGGGCACGGAGGTTCATCCGGGGCGAAGTTTCGCATCTCCCTTGGTCGCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTGTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGGCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGGCCGGTGGCAAAGGAATGCGCCGAGTCTGTGGCCCAGGATTGCGTGCCACGCAGGCGGCATCGCATGAAccccccccTCCCTTGTAAAAATAAAAAAGATGTAGCTCTCTCGCCCCGCGCGcccccccccacataaaaaaaaTTTGGCGGCCGCGCCTCGGGCCCCGTGAAAAAAAGTTTTCCGGAAGACGCGTTCCACTTTTGGGCGCCCGCGGGGGCCCCCAGTTAGGGGAACATGTGAAACCAATGGGTCCATATACCCTGGCTTTCCCCTCGAGAAAAAGCGCCTGGGGGCCGACGACACTAAGGCGCCCTGTGGAAACTCCGTCCACCAACTTTAACAAAAACACCCCGCCCGCCCCGGAGATACCCCCTCGCCGCTTTTTCCGGAACCTAACAGCCCCAAATACAGGAAACACCTCTGTGGAAGGCGCCACAATTTACTGGGGAGGTCCTATTTCCCACACCGATGGAAAGTCCGCCATAAGCAAAGCGGCTCCAGATATATCGCGAACCTATAAAAA
  3   1   2       bld Ga18 5g3  in                      xlk106j14ex.3p                                                                               TCCGNCCNNNNNNCGCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACANNNNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGANNCNNNCANNCA
  5   1   2       bld Egg2 5x3               IMAGE:3300774-IMAGp.IMAGp                                                                                      AATTCCGGCACGGAGGCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCTAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaaaaaaaaaaaaGATTCGCGGCC
  3   1   2       bld Ga18      in                      xlk144a03ex.3p                                                                                         CCNNGGNCCGCCNNNNNCGGAGGNCNCNGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNCCTGTGGCAAAGGAATGCNCCGATCTGTGGCCCAGGATNNNTNCNNNNNAGGNNNNNCGCATG
  5   1   2       bld Sp1  5x3                        IMAGE:5505838.5p                                                                                             CCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld Ga18 5g3  in                       xlk72j20ex.3p                                                                                             CCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNCNTGTGGCAAAGGAATGCNCCGATCTGTGGCCCAGGANNNNTCCANNNNNGNNNNNCNNATG
  3   1   2       bld Ga18                             rxlk163k18ex.3p                                                                                             CCACGCGTCCGAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGNNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNTGTGGCAAAGGAATGCNNCGATCTGTGGCCCAGGANNNNTCCA
  3   1   2       bld DMZ  5g3  in                         xl259a18.3p                                                                                             CCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGACGGGGGTGATAGTGAACAACAAGGGNGA
  3   1   2       bld DMZ  5g3  in                         xl259o19.3p                                                                                             CCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCAT
  5   1   2       bld DMZ  5g3  in                         xl259o19.5p                                                                                             CCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld DMZ  5g3  in                         xl259a18.5p                                                                                             CCAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Egg1 5g3  in                    IMAGE:3300774.5p                                                                                              GCACGAGGCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCTAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTgtaaaaataaaaaagatgtaacaaaaaaa
  5   1   2      seed Ga15 5g3  in                       XL500p09ex.5p                                                                                              CAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga18 5g3  in                      xlk115c15ex.3p                                                                                              CAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGANNCNTCCANNC
  3   1   2       bld Ga18 5g3  in                      xlk145c22ex.3p                                                                                              CAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATNNNTNCANNNNNGNACNNCGCATNNNNNNCCTCC
  3   1   2       bld Ga18 5g3  in                      xlk104c20ex.3p                                                                                              CAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTNNGAAGTTTCGCATCTCCCTTGNTNTNNCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACANNNNTGTGGCAAAGGAATGCGNCGATCTGTGGCCCAGGA
  5   1   2       bld DMZ  5x3  out                        xl331f01.5p                                                                                              CAAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCTAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Tbd5 5x3                        IMAGE:3579762.5p                                                                                               AAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Te2  5x3                        IMAGE:7210877.5p                                                                                               CAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCTAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACaaaaaaaaaaaaaaaaaaaaaaaaaaGGG
  5   1   2       bld Ga15 5g3  in                       XL403l21ex.5p                                                                                               AAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga15 5g3  in                       XL442c21ex.5p                                                                                               AAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga15                               XL408c05ex.3p                                                                                               AAGATNTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTANCTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAANTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTNGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGC
  3   1   2       bld Ga18 5g3  in                      xlk112g08ex.3p                                                                                               AAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNCNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGANNCNTCCAACNCAGG
  3   1   2       bld DMZ  5g3  in                         xl339j06.3p                                                                                               AAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCAT
  5   1   2       bld DMZ  5g3  in                         xl339j06.5p                                                                                               AAGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL419a16ex.5p                                                                                                 CTCCGCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga15 5x3                           XL424p03ex.5p                                                                                                 GATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                       xlk52i11ex.5p                                                                                                 AGATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGNATCTCCCTTGGTCTCCCCGTGGNNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk112g08ex.5p                                                                                                 AAGATGTCTAAGAGAGGNCNCGGAGGTTCATCCGGTGCGAAGTTTCNNTCTCCCTTGGTCTCCCCGTNGNNCNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTGTaaaaataaaaaaGATGTAA
  5   1   2       bld Ga15 5g3  in                       XL520k19ex.5p                                                                                                  ATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL520k19ex.3p                                                                                                  ATGTNTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAATCGCAGGCAGCATCGCAT
  3   1   2       bld Ga18 5g3  in                      xlk127n14ex.3p                                                                                                  ATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACANNNNTGTGGCAAAGGAATGCGNCGATCTGTGGCCCAGGANNCNTCCANNNNNGNACATCGCA
  5   1   2       bld Ga18 5g3  in                       xlk72j20ex.5p                                                                                                  AGATGTCTAAGAGAGGNCNNGGAGGTTCATCCGGTGCGAAGTTNCNNNCTCCCTTGGTCTCCCCGTGGNNCNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTgtaaaaataaaaaagatgtaacnanaanaaaaaaaaNAA
  5   1   2       bld Ga18 5g3  in                      xlk106j14ex.5p                                                                                                  GATGTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGNNCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18                              xlk121b14ex.5p                                                                                                   GATGTCTAAGAGAGGNCGCGGAGGTTCATCCGGTGCGAAGTTNCNNNCTCCCTTGGTCTCCCCGTGGNNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGNGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNCTATCACAGGCCCTGTGGNAAAGGAATGCGCCGATCTGTGGNCCAGGATTGCGTCCAACNNAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk145c22ex.5p                                                                                                   GATGTCTAAGAGAGGNCNCGGAGGTTCATCCGGTGCGAAGTTNCGNNCTCCCTTGGTCTCCCCGTNGNNCNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga15                               XL493h08ex.5p                                                                                                    GTCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGACGACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk127n14ex.5p                                                                                                    ATGTCTAAGAGAGGNCNNGGAGGTTCATCCGGTGCGAAGTTTCGNNCTCCCTTGGTCTCCCCGTNGNNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACNCAGGCAGCATCNNATGAACACCTCCTCCCTTGTaaaaataaaaaaGATGTAA
  5   1   2       bld Ga18 5g3  in                      xlk115c15ex.5p                                                                                                    GATGTCTAAGAGAGGNCGCGGAGGTTCATCCGGTGCGAAGTTTCGNNCTCCCTTGGTCTCCCCGTNGNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18 5g3  in                      xlk104c20ex.5p                                                                                                    GATGTCTAAGAGAGGNCGCGGAGGTTCATCCGGTGCGAAGTTTCNNNCTCCCTTGGTCTCCCCGTNNNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk142m13ex.3p                                                                                                     TCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGANNCNNCCA
  3   1   2       bld Ga18      in                      xlk126b10ex.3p                                                                                                     TCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGANNCNTCCA
  3   1   2       bld Ga18      in                       xlk67e21ex.3p                                                                                                     TCTAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGNNNNCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACNNNNCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGANNNNTNCAACNNAGGNACNNCNNAT
  5   1   2       bld Ga18 5g3  in                      xlk154a18ex.5p                                                                                                       TCTAAGAGAGGACGNGGAGGTTCATCCGGTGCGAAGTTTCGNATCTCCCTTGGTCTCCCCGTGGNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGNCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk146p09ex.3p                                                                                                       TAAGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATNCNTCCANNNNNGNACNTCGNAT
  5   1   2       bld Ga18      in                      xlk126b10ex.5p                                                                                                        TCTAAGAGAGGNNNNNNGGTTCATCCGGTGCGAAGTTNNNNNCTCCCTTGGTCTCCCCGTNGNNCNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGNGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGNTATCACAGGCCCTGTGGNAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACNNAGGCAGCATCNNATGAACACCTCCTCCCTTGTaaaaataaaaaaGATGTAA
  3   1   2       bld Ga18      in                      xlk149k16ex.3p                                                                                                         AGAGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGNNNNNNCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNNNNGTGGCAAAGGAATGCGNCGATCTGTGGCCCAGGANNNNNNCA
  5   1   2       bld Ga18      in                      xlk142m13ex.5p                                                                                                         TCTAAGAGAGGNNNNNAGGTTCATCCGGTGCGAAGTTTCNNTCTCCCTTGGTCTCCCCGTGGNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCNNATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18      in                      xlk146p09ex.5p                                                                                                          TAAGAGAGGNCNNNNGGTTCATCCGGTGCGAAGTTTCGNNCTCCCTTGGTCTCCCCGTGGNNCNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCNNATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl322k15.3p                                                                                                           AGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCA
  5   1   2       bld DMZ       in                         xl322k15.5p                                                                                                           AGAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaaGATGTANCNNAAAANAAA
  5   1   2       bld Ga15                               XL410g16ex.5p                                                                                                            GAGGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAANGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Ga18      in                       xlk67e21ex.5p                                                                                                            TCTAAGAGAGNCNNNGGTTCATCCGGTGCGAAGTTNNNNNCTCCCTTGGTCTCCCCGNNNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGNAGGCAGCATCGNATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0123D06.5p                                                                                                              GGACGCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCTAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaaGAT
  5   1   2       bld Ga18      in                      xlk149k16ex.5p                                                                                                              AGAGAGNNNNNNNGNTCATCCGGTGCGAAGNTNNNNNCTCCCTTGGTCTCCCCGTGGNNNNTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGNNATCAAGGGNCGTCTGAACAGACTGCCGGCCGCTGGGGTTGNNGNNATGGTGATGGCCACAGNGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGNAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGNATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Tbd7      out                        XL060j18.5p                                                                                                                ACGCGGNGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaaGATGTAACAAACACGGGAGTCTGCTGGTCGTGATTTGGGTTCATTTTGAAGCTCAAACCTTAAAGGAAAAACAAAACTCTTGCCCTGACTCAATGGAAGAAATTCACAGTCCGACTGTTCTGGGAATCTCCATGGTAACACTGTGCCTTTACAAGCTGGGGTAGGACAATGTTCCGTTGAGGTCCCAGTATCAGAGGGTCCCCCTATACAGTATTTTCAGTTCCTGAGA
  5   1   2       bld Ga14                               Ga14-p18h1.5p                                                                                                                  GCGGAGGTTATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGNGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAAAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAG
  5   1   2       bld Ga12      in                         XL175j14.5p                                                                                                                  GCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL175j14.3p                                                                                                                  GCGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGGGCAAAGGAATGCGCCGATCTGGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCANAACACCTCCTCCCTGNAAAAAAAAAAGA
  5   1   2       bld Ooc1      in                      xlnoc002p15.5p                                                                                                                   CGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAAGTCGAACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCC
  5   1   2       bld Ga15      in                       XL436i12ex.5p                                                                                                                   CGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL436i12ex.3p                                                                                                                   CGGAGGTTCATCCGGTGCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAAGCGCAGGCAGCATCGC
  5   1   2       bld Ga18      in                      xlk144a03ex.5p                                                                                                                           GNTCATCCGGTGCGAAGNTNCNNNCTCCCTTGGTCTCCCCGTNGNNNGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGNGCATCCGGCAGTGGNTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTNTATTTTGAAGACAATGCGGGGGNGATAGTGAACAACAAGGGGGAGANGAAAGGCTCNNNATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACNNAGGCAGCATCNNATGAACACCTCCTCCCTTGTNaaaataaaaaagatgtaacaaaaaaaaaa
  5   1   2       bld Tbd5                            IMAGE:3579576.5p                                                                                                                                   GCGAAGTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAAGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAAGAATGCGTCTAACGCAAGCAGCATCGCA
  3   1   2       bld Egg1 5g3  in                    IMAGE:3300774.3p                                                                                                                                        GTTTCGCATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATAATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCTAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACAAAAA
  3   1   2       bld Ooc2                            IMAGE:3745629.3p                                                                                                                                              CATCTCCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACAAACAA
  3   1   2       bld Ooc1      in                      xlnoc002p15.3p                                                                                                                                                   CCCTTGGTCTCCCCGTGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTAACAA
  5   1   2       bld Tad2                            IMAGE:6932132.5p                                                                                                                                                                 GGGGGAGCCGTCATTAACTGCGCTGACAACACAGGTGGAAAGAACCTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCGGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTtgtaaaaataaaaaagatgtaacggaaaaaaacaaccacaaaaaaaTATGAAATTCTTGTC
  5   1   2       bld Neu4                            IMAGE:3557756.5p                                                                                                                                                                    GAGCCGTCATTAACTGCGCTGACAACACAGGTGNGAAANAACTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTAAAAATAAAAAAGATGTNCCANANaaaaaaaaaaaaa
  5   1   2       bld Ga15      ?                        XL495l05ex.5p                                                                                                                                                                                       CTGACAACACAGGTGGAAANAACTTGTACATCATCTCTGTGAAAGGCATCANNGGACGTCTGAACNNACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACNNCTGAACAAAGGAAAACCTGAACTGAGGAAGAAGGTG
  3   1   2       bld Ga15 5g3  in                       XL403l21ex.3p                                                                                                                                                                                               ACAGGTGGAAAGAANTTGTACATCATCTCTGTGAAAGGCATCAAGGGACGTCTGAACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACTTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGGCGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCAGCAGGCCCTGTGGCAAAGGAATGCGCCGATTCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCAT
  3   1   2       bld Ga18      in                      xlk121i11ex.3p                                                                                                                                                                                                                                                     AACAGACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGNCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATNCNNCCA
  5   1   2       bld Ga18      in                      xlk121i11ex.5p                                                                                                                                                                                                                                                      AACAGACTGCCGGCCGCTGNNTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGNCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGNNTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCNNATGAACACCTCCTCCCTTGtaaaaataaaaaagatgtaacnnnaaaaaaa
  5   1   2       bld Ga15                               XL420p20ex.5p                                                                                                                                                                                                                                                         GACTGCCGGCCGCTGGGGTTGGAGACATGGTGATGGCCACAGTGAAGAAAGGAAAACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTC
  3   1   2       bld Ga15 5g3  in                       XL442c21ex.3p                                                                                                                                                                                                                                                                   CGCTGGGGTTGAANACATGGTGATGGCCACAGTGAAGAANGGAAAACCTGAANTGANGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGANCGGGGTGTTCCTGTATTTT
  5   1   2       bld Kid                             IMAGE:4032012.5p                                                                                                                                                                                                                                                                                                               AACCTGAACTGAGGAAGAAGGTGCATCCGGCAGTGGTTATACGGCAGCGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCGCATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaaaaaaaaaaaaaaG
  5   1   2       bld Ga15      out                      XL468l21ex.5p                                                                                                                                                                                                                                                                                                                                       ATCCGGCAGTGGTTATACGGCAACGGAAGTCGTACCGGAGAAAAGACGGGGTGTTCCTGTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCGTCCAACGCAGGCAGCATCNCATGAACACCTCCTCCCTTGTaaaaataaaaaagatgtaacaaacaaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL500p09ex.3p                                                                                                                                                                                                                                                                                                                                                                       TACCGGAGAAAAGACGGGGTGTTCCTNTATTTTGAAGACAATGCGGGGGTGATAGTGAACAACAAGGGGGAGATGAAAGGCTCGGCTATCACAGGCCCTGTGGCAAAGGAATGCGCCGATCTGTGGCCCAGGATTGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)