Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL011a15.3                            8 END     6           3       75                (no blast hit)

 This cluster: approximate FL confidence score = 69%

 1012767908 Xl3.1-xl302d02.3 - 163 ESTs
                                                                       -160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl302d02.3                                                                                                                                                                 ACAGGGACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGAAAAAAAAGAAGTCCTTCCTCCACCTCTCAGCCAGAGAGAAAAAGAAAGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACTTTTTCTTTTTTCCCCCTTTTTTGGGGGGGGGATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATCCCTCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAAAAAAAAAAAAAAATGAGCGCCAACAGCCCATGGAACAGCAGCCGATGTGGAGAGGAACAAAATGTTTTAAATAAAAAAAGTCTCCAAAAAAAAAAAAAAAAAAAAAAAAGCTGAAACGTATCTACCTGTAAATTTAAATAAATGACATTTTAAATGTAACCCCTATAGGTCCTGCCTTTTTAAGAAGAGGGGTTAGTGTAAGAGCAAAATTGGAAAGGAG
                                                  Xl3.1-CHK-1012685261                                                                                                                                                                       ACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGAAAAxAxAGAxxxxxTTCCTCCACCTCxCAxxxAGAGAGAAAAAGAAAGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACxTTxTCTTTTTTCCCCCTTTTTTGGGGGGGGGATACCTATTGxxGxxTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACTATTGGACGGACGCTGATCCCGCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAAAAAAAAAAAAxAxTxxGCGCCAAxxxxxxATGxxACAGCAxxCxxxGTGGAGxxxxAxAAAATGTTTTAAxxAAAxxAAxxxxxCxAAAAAAAAAAAAAAAAAAAAAAAGCTGAAACGTATCTACCTGTAAATTTAAATAAATGACATTTTAAATGTAACCCCTATAGGTCCTGCCTTTTTAAGAAGAGGGGTTAGTGTAAGAGCAAAATTGGAAAGGAGGTACTG
                                                      consensus depths                                                                                                                                                                      3     6     4     7     4     7     5     8     5     8     6     9     6    12     7    12     7    14     7    17     8    18     8    20    10    26    10    28    10    29    12    31    11    36    11    37    12    38    11    38    11    38    12    38    14    39    14    40    14    42    14    43    14    42    14    43    14    43    14    43    14    43    14    43    14    45    13    46    14    48    14    47    21    48    17    45    16    42    15    42    29    43    39    43    39    43    41    45    40    44    34    42    36    43    37    45    37    46    37    45    38    45    36    44    36    44    36    44    37    43    36    44    38    44    38    44    39    46    40    45    37    44    35    45    39    49    38    50    39    50    40    49    40    49    39    49    42    51    36    48    39    47    39    47    34    44    36    44    33    43    36    46    38    49    40    51    38    52    43    51    43    54    38    53    45    52    36    49    41    52    44    55    42    59    42    56    47    59    46    58    48    60    48    62    48    61    51    61    48    59    50    61    53    63    53    65    52    64    53    65    61    68    62    71    63    71    61    73    62    70    60    70    58    73    65    73    64    73    59    74    57    76    59    77    54    77    60    77    52    80    59    80    59    80    57    81    59    81    59    81    58    81    60    81    45    81    50    78    47    79    51    81    48    82    50    82    56    86    51    84    56    85    59    84    53    84    57    83    51    83    55    81    58    81    58    79    48    68    43    63    36    52    22    37    13    26    12    26     6    25     6    25     5    19     4    16     4    16     4    16     5     9     4     9     3     8     3     8     3     8     3     8     3     6     3     5     3     5     3     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                             CTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                 CTGGCGGTTGCAGGAGCAGCCATTGTTGAGAGAGAGAGAGAGAAAACCTTGCAAACAAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCTGTTTCCCTTTAGGCTGCCATTATTATTATTATTATTATTATTATTATTATTATTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCTCCCCCCCCCTTTTCCTTTTTTTGGGGGGTACCTATTGCTGAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCACATGTGAAATGTATATATGATCTACATGTAGAAGAAGCTTTTATTTTTATAGTTTCCCTTTAAAAAGAAGAAAACACGGTTATGTGAGCATGTGCAGCATCCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGCAGTTCTATCCAGACATACCAAGCTAGTACTGACTATGACTGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTTTGGCCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATATATATATATGTGTATAACAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T--C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------C-C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                               BLH ATG     406     141                                                                                                                                                                 
                                               BLH MIN     460     312                                                                                                                                                                 
  3  -1   2       chi DMZ                                 rxl222m03.3p CGCTGTAATAATCCTTCCCATGGGCCAGTCCTTACTCACAGCTTACTCCCCATTGTATCTCCAGCCAGGAACATTAGTGTTGCTTTCTTCTGAAGGAACAACCTTCTGTGAGCCGAGCTTTGCCCCCCGTGGGCTGACACAGGACGGTGGAGCAGCCGACACACAGGACGACAGTTTGCGCGTGACTGAACACTGTGGTGATCTTGTAACAACCTGGGCATTTGACATCCATGAAATAGGAGTTTGGGCTCTGGACCAGGCGCTTCTTCTTGTGTTTCCTCTTCTCCTCCTCGGGAGTTGGGTGCAGGAGATCCTTAGCGAGTGGCATGTTCTCCGGATGCGCAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGAGAGAGAGAGAGAGAAAACCTTGCAAACAAAGAGAGAGAAAAAGAAAGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTCCCCCCCCCTTTTCCTTTTTTTGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGNAACGC
  5   1   2       bld Emb1                            IMAGE:5155388.5p                                                                                         ccacgcgtccgcccacgcgtccgcccacgcgtccgcccacgcgtccgAGAAAGAAGGAGGAGGGGGGAGGGTACAGGGACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttccccctttttntggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGGATAGGGAGGCATACGCCATTAGTGGGAAGCNGACCGGACTACACGAATATTTTTGAGCTGAAACAAACCGCTTGGCAAAATTTGGGACAGAAGGGAATGTGAACAAATTTTGGTGGNTGGGGAATGGCTTTTTTAC
  5   1   2       bld Oo1       in                    IMAGE:5078578.5p                                                                                                                                          AAAGAAGGAGGAGGGGGGAGGGTACAGGGACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttt
  5   1   2       bld Ga18      in                       xlk70f03ex.5p                                                                                                                                           AGAAGGAGGAGGGGGGAGGGTACAGGGACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGNNNNTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTNNAGGAGCAGCCATTGTtgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaagaaGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCtattattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggANACCTATTGGCGGNTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAANGNNTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGANCCACCCCGATGTATCCACNNACATATCTGGAGNCTGGGANNNGGNAGGCATAC
  5   1   2       bld Oo1  5g                         IMAGE:5083680.5p                                                                                                                                                   AAGGAGGAGGGGGGAGGGTACAGGGACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttnggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTTGTGGTGGGGATGCTTTTACCCCAGAGTTTCTTTGGAAGATGATGCAATGGNTAACCAATCACATTTTTGGTTTGGGAGGGATGGGCCCAAAAGAGATACCCCTAATAGGGACGGGC
  5   1   2       bld Oo1  5x                         IMAGE:5085119.5p                                                                                                                                                         GGGAGGGTACAGGGACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTTTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttccccctttttttggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGccccccaacggcaacgccttcccccccttccaccccaggaccatgctggatcgagatgtgggaccccccccGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCCTAACCCCTACGGGAACCGGACCAGATTAACAACATTTGAGCTGGAACAAACGCCCGCCGAATGGGACNGAGGAACGGGACCATTTCGTGGCGGGCACGGTTCCCACCCCCACAATCCCTTTGCAAAACGCCTGCCCGCCTAcccctccccccccTTGATTGCGACGGAGGGGACCACCCCGCTCCCGCCCCTCGGGAAGCGACCCCCGGGCTCGCGTCGGGAAATTTTCGCCCACGCACCCTCTGAAACGGGGGGCGGCGCCCCGACCCAGCACGTTTTGGGTCTCTGCGGAGCAccccccccACGGGGGTTCCTCCGCCCCAAAC
  5   1   2       bld Emb9 5x                         IMAGE:7978124.5p                                                                                                                                                                      GACAGGCCACCTCCTGGTCCTCTTTGTGGGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattaGCAGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTATATCAACAGGCTGTTCGTCAAAATCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACACCTTCCCCCCCTtccacccaggcaccatgctggatccagatgtgggacccacccccatgtatcccccccaccaTATCTGGGAGCCTGGAAATAGGGAGGCATACGGCATATAGGGAACCCAGACAGACTACACCAATATTTTGAGCGGAACAACGGCCTGCAAAATTGGGACAGAGGAATGTTACAATTTGTGGGGGGGATGCTTTCTACCACAAACTTCTTGAAGATAAAGCGAATGCTCACCCATTCCATTTCTGGTTTGAAGGGATGCGAACATGCGAG
  5   1   2       bld Oo1  5g                         IMAGE:6642561.5p                                                                                                                                                                                                  GGAGACACAGAAAGGGGGGTGGTGGTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGNGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTTGGAGGATGGACCAAAGAGATACCCTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCCTTTGAAGGAAGAGCCCACAGAGCTGTACTATGTCCTTGAAAGCACCCCAGGGAGTCATTCCACAAATAACTTTTGTTTCCCCTTGACTGGGC
  5   1   2       bld Oo1  5g                         IMAGE:6640949.5p                                                                                                                                                                                                                          GTGTATGTGGGAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGGTTTGGAGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCCTCGTATTTCCGCAGCATCTTTTGAGGGAGGAGGCACCGAGCTGTACTATGGTCTGAAGCACCCCCAAGAAGTCATTTCAACATTAACTTTGTTTCCCTTGGCTGTGATTCAATGCACCATGGTTCACACGCATGGCAAACCCTATGTTC
  5   1   2       add Emb4      in                    IMAGE:4201671.5p                                                                                                                                                                                                                                    AGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGGCCCACAAGCCAGGAGCAGGGCTGGCGGGTTGCAGGGAAGCAGCCATTGTTGACNAGAGAGAGAANAACCTTGCAAACAANAGAGACNAGAGGGAGAAAANAAAAGAAAGTCCTTCCTTCCACCTCTTCAGCCTTCCTGTTTCCCTTTAGGGCTGCCattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttggggggggAT
  5   1   2       bld Tbd7      in                         XL094a19.5p                                                                                                                                                                                                                                    GTGAGNAGAGTAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattaG
  5   1   2       bld Em10 5g                         IMAGE:8318505.5p                                                                                                                                                                                                                                       GAGTGAGAGAGAGCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAA
  5   1   2       bld Neu7      in                         XL046k07.5p                                                                                                                                                                                                                                                       GGGGGGGTGGTGTGTGTGGGNAGTGAGTGAGNAGCAGTGTAAGCTCCAGCACTCAGNACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGNAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagnagagaaaaccttgcaaacaaagnagnagnagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAG
  5   1   2       bld Sp1       in                    IMAGE:4175871.5p                                                                                                                                                                                                                                                                 GCAGAGCAGTGCAAGCTCCAGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTACTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGAC
  5   1   2       bld Emb9      in                    IMAGE:7975075.5p                                                                                                                                                                                                                                                                  TCCCGGGTCTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGAACGACTACTGAATATTTGAGCTGAACATACGCTTGCAAATTTGGACAGAGGAATGTGACAATTTGTGGTGAGATGCTTTTCCAAGGAGTTCTTTGAAGAAGAGCAATTGTAACTTCCCTTTTGTTTGGAGATTGACCAACTAATTCCGTTTGGAGGAAGCTGTTCTCTGTTTTC
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744388.5p                                                                                                                                                                                                                                                                      GCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattatcattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGTGATTTGAAttttttcttttttccccctttttttggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTTCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGGACAAACGCTTGCGAAAATGGACAGAGGAA
  5   1   2       bld Ga12      in                         XL172g10.5p                                                                                                                                                                                                                                                                            CTACAACCCATTAGNAGGGCCCACAAGTCCAGGNAGCAGGCTGGCGGNNGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattattatNAG
  5   1   2       add Em10                            IMAGE:7980043.5p                                                                                                                                                                                                                                                                                   CTACAACCCATTAGAGGGCCCACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattaGCAGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggggA
  5   1   2       bld Neu4      in                    IMAGE:4084626.5p                                                                                                                                                                                                                                                                                               CCATTAGAGGGCCCACAAGCCATGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattaGCAGCAGCTAGGCCGCATCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTACTTCTTCATGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACG
  5   1   2       bld Neu4      in                    IMAGE:4084625.5p                                                                                                                                                                                                                                                                                               CCATTATAGGGCCCACAAGCCATGATCAGGCTGGCGGTTGCAGGATCATCCATTGTTGACAGATAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaGAAGTCCTTCCTCCACCTCTCATCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattaGCAGCAGCTAGGCCGCATCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTAGAAttttttcttttttcccccttttttgggggggggATACCTATTGNCGGCTTACTTCTTCATGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCA
  5   1   2       add Em10                            IMAGE:7980993.5p                                                                                                                                                                                                                                                                                                       CACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattaGCAGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggg
  5   1   2       bld Neu4      in                    IMAGE:4084671.5p                                                                                                                                                                                                                                                                                                             ACAAGCCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTGTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTACTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGGACCCCCCAACGGAACTCCTTCCCCCCTTTCACCCAAGCACCATGCTGGATCGAGATTGTGGACCCACCCCGATGTATCCACCAACATATCTT
  5   1   2       add Ga15      in                       XL489f17ex.5p                                                                                                                                                                                                                                                                                                             CCAGGAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattaGCAGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggg
  5   1   2       bld Ga18      in                      xlk137j01ex.5p                                                                                                                                                                                                                                                                                                              AGCACTCAGACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAACAGGCTGGCGGTNNNNNNNNNCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGNACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAANNNNTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGANGTGGGANCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATANGGAGGCATACNNNNTATGGNAACCAGACAGACTACAGNATATTTGAGCT
  5   1   2       bld DMZ       in                         xl301e07.5p                                                                                                                                                                                                                                                                                                               GCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCANGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCNGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGANAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAA
  5   1   2       bld DMZ       in                         xl279c14.5p                                                                                                                                                                                                                                                                                                                 CACAAGCCAGGAAGCAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTACTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCT
  5   1   2       bld Ga15      in                       XL474d21ex.5p                                                                                                                                                                                                                                                                                                                      GCGGTTGCAGGAGCAGCCATTGTTGACAGAGAGAGAAAACCTTGCAAACAAAGAGACAGAGGGAGaaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattattaGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTATTTCTTCNGGNTGANC
  5   1   2       bld Ga18      in                       xlk55k14ex.5p                                                                                                                                                                                                                                                                                                                      ACTCCAGCTACAACCCATTAGAGGGCCCACAAGCCAGGAACAGGCTGGCGGTNNNGGAGNAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGNNCNTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAANNNTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACNNCATATGGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATNNGACAATTTGTGGNGGGATGCTTTTANCACAGAGTTCNTTTGAAGATGATGCAATGTTAANCATCACTTTTTGTTTGGAGNANGGNNCAAAGAGANACACAATTGGNCGG
  5   1   2       bld DMZ       in                         xl236c11.5p                                                                                                                                                                                                                                                                                                                                     ATTAGAGGGCCCACAAGCCAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGA
  5   1   2       add Ga18                              xlk133a15ex.5p                                                                                                                                                                                                                                                                                                                                           CCATTGTTgacagagagagaaaaccttgcaaacaaagagacagagggagaaaaaaaaGAAGTCCTTCCTCCACCTCTCAGCCTTCCTGTTTCCCTTTAGGCTGCCattattattattattattattattattattattattattattaGCAGCAGNTAGNNCGCAGNCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCNNGGGGANTTNCTCACTCTCAGNCATGNTTTAAC
  5   1   2       bld DMZ  5g                              xl266k07.5p                                                                                                                                                                                                                                                                                                                                                     GCCAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGG
  5   1   2       bld DMZ       in                         xl320k01.5p                                                                                                                                                                                                                                                                                                                                                      CCAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCC
  5   1   2       bld DMZ       in                         xl246l15.5p                                                                                                                                                                                                                                                                                                                                                      CCAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGG
  5   1   2       bld DMZ       in                         xl253j03.5p                                                                                                                                                                                                                                                                                                                                                       CAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGG
  5   1   2       bld Emb4 5g                         IMAGE:5572193.5p                                                                                                                                                                                                                                                                                                                                                             CAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTNGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCANAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAAACACCCCAAGGAGTCATTCCCACAATAAATTTGTTTCCCCTCGACTGTGGACCAGTGCACAATGGGTCACACAGCATGGGAAAACCTATGTTCACACAGGGAATGGTGAAAAAGGGCGATTAAACCTGGGAAGTTCCTGGTTCAATGGAACTGATGAAGGGATAAAAACGTGGGGACTTCCAGTATCCAGACAACATTCGAAAAGCCTCATTTCC
  5   1   2       bld Emb9 5g                         IMAGE:7975551.5p                                                                                                                                                                                                                                                                                                                                                             CAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcggacaaagagagagaaaaagaAAGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCGATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCANAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTCCGAAGCATCTTTGAGGGAGGACCACAGAGCTGTACTATGTCTTGAACACCCAAGGAGTCATTCCACATAATTTGTTTCCTCGATGTGACAGTGCAA
  5   1   2       bld DMZ       out                        xl291j16.5p                                                                                                                                                                                                                                                                                                                                                                  TGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacnaagagagagaaaaagaaaGGTCCTTCCTCCACCTCANCCTTCCTGTTTCCCTTANGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACNTTCTcccccccccTTTTCCNTTTTTNGGGGGGNA
  5   1   2       bld Ga14                                Ga14-p8c6.5p                                                                                                                                                                                                                                                                                                                                                                                         TATTgagagagagagagagaaaacttgcaaacaaagagagagaaaaagaaaGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCAT
  5   1   2       bld Ga12 5g                              XL154k21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAAAAGAAAGGTCCTTCCTCCACCTCAGCCTTCCTGTTTCCCTTAGGCCTCCATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGG
  5   1   2       chi FaBN                            IMAGE:8077371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGGTCCGGATTCCCGGGATCACACACGCACATACACAGACAGAATAAAATTCCTTCTGCCTGCTTCCTCTGAGGCCCAATTTCTGCCTTTTTAGGGGGGCTTGTTTTTCTTCTGCGAGATTCCACAAGGGCATTTTATGCCAGGAGCCTTAGCTGTGGGCACCCAGTTCCTTCTCTGCTCCACACCAGGCATGTGAAGATGTCAGTTGGCTGCGCATGTCCTGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATTGGCAACCTATGTTCACACGGTATGTGTAGAAGGCAGATTATAA
  5   1   2       bld Ga15      in                       XL428n06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGGAGCTTCCATGAGCTGTCACAGCCTTTAACATCTTTTATGATATAGTATAATCCCTCTGTGCATGAGAAGAAGCCAGCTAATCAGGGAATATACATGGGATGGAATAGGAATTCTCTTTCTTTCCTGCGTCGTGATCGTTTGTATTGATGAGAAGCAAATCTATCCCAGGAGCTCATAGCAAATGGCAGAAGAATTTGAACTAGCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGAACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGAT
  5   1   2       chi FaBN                            IMAGE:8077252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACACGCACATACACAGACAGAATAAAATTCCTTCTGCCTGCTTCCTCTGAGGCCCAATTTCTGCCTTTTTAGGGGGGCTTGTTTTTCTTCTGCGAGATTCCACAAGGGCATTTTATGCCAGGAGCCTTAGCTGTGGGCACCCAGTTCCTTCTCTGCTCCACACCAGGCATGTGAAGATGTCAGTTGGCTGCGCATGTCCTGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGATATGATGAGG
  5   1   2       bld DMZ       in                         xl302d02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  attattattattattattaGCAGCAGCAGCTAGGCCGCAGCCAAATCCTTGCAGCCTCTTTGCTGCTTTCCTGCCATATTCTCTCATGTGCTGGGGGATTTTCTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAAttttttcttttttcccccttttttgggggggggATACCTATTGGCGGCTTATNT
  5   1   2       bld Em10 5g                         IMAGE:7979084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTATTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTccccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTNCACACAGGTATGTGTAGAAAGCAGATTATACCTGGAGTTCATGTTCGATGATATGATGAGGATA
  5   1   2       bld Em10 5g                         IMAGE:7979426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTATTATAAGCAACTAGGCCGCAGCCAAGTCCTTGCAGCTTTTCTGCTGTTTCCTGCCATATTCTCTCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTccccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTTCCTCGACTGTGACCAGTGCACAATGGTACACAGCATGGCAAACCTATGTTCCACANGTATGTGTAGAGGCAGTTATACCTGAGTCATGTTCATGAATGATGAGGATAAACGTGCACTCATATCAACACATCAGACTCTTCCGGATATCTACATGATGCCAACCCCAAGTGACAGTTCTA
  5   1   2       chi Ga12      in                         XL146k11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTTATTTTTGCCCAACCTATAATAAGTTACATCAGAAAACGTAAGTGCTGGCTTTCCTTGTATCCAGCCCTCGCTAACTACAAGCTTCAACTTTAAACCATTGACAAAGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATAGGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGAACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAG
  5   1   2       bld Ga18 5g                            xlk63h02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATGTTCTGGGGGATTTTCTCAGTCATGTTTTAACTCCTTTAATTTTTTACATTCTcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCNTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGANGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGANCAGTGCACAATGGTCACACAGCATGGNAAANCTATGTTCACACAGGTATGTGTAGANNGNAGANTATACCTGGNGTTCATGTTCGATGACATGATGAGGNNAAAAACGTGNCANTTCAGTATCAGANANNTCGAGAGNTCNTTNCCCGGAGNATTCTAGNCATNNATGCCNNNACCCNNAA
  3  -1   2       bld Bla2      in                    IMAGE:7296552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCACTCTCAGTCATGTTTTAACTCCTTCTGCGATTTGAATTTTTTCTTTTTTCCCCCTTTTTTGGGGGGGGGATACCTATTGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTTGACTGTGATAATGCACAATGGTCACACAGCATGGCAACCTATGTTCACACGGTATGCGTAGAGGCAGATATACTGGAGTCATGTTCAGAATGAGAGGATAAACGTGCACTCAGTATCAGCACATCAAGCTCATCCCGATATCTACTGCTGCCAGCCCCATGTGACAGTGCTAACATACAAGCGACTCATCC
  5   1   2       bld Sp1  5g                         IMAGE:4964284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATTCTCTTTCTTTCCTGCGTCGTGATCGTTTGTATTGATGAGAAGCAAATCTATCCCAGGAGCTCATAGCAAATGGCAGAAGAATTTGAACTAGCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTTGACTGTGATCCATGCACAATGGTCACACAGCATGGGCAACCT
  5   1   2       chi DMZ       in                         xl254k08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCCAGGAACAGGCTGGCGGTTGCAGGAGCAGCCATTGTTgagagagagagagagaaaaccttgcaaacaaagagagagaaaaagaaaGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGA
  5   1   2       bld Neu7 5g3  in                         XL013h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GttttaactcctttaattttttacattctcccccccccttttcctttttttGGGGGGTACCTATTGCTGAATTATTTCTTCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTG
  5   1   2       bld Neu7 5g                              XL001l17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGATGAAAAGCAAATCTATCTCAGGNAGCTCATAGCAAATGGCAGAAGAATTTGAGTTGGCAGGCTGTTCCTCTAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGG
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCGGCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTAGAAGCACGCGCAAGAGTCATTGCACAATAACTTTGTTTCCCTTGACTGTGATCAATGCACAATGGTCACACAGCATGGCAGACCTATGTTCACACAGGTATGCGTAGAATGCAGATTATACCTGGAGTTCATGTGCGACGATATGATGAAGATGAAAACC
  5   1   2       bld Tbd7      in                         XL085l17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTTATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAG
  5   1   2       bld DMZ       in                         xl294o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTCTTCAGGCTGTTCGTCAAAGTCATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTANAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCANTATCANGC
  5   1   2       bld DMZ       in                         xl315o23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCAAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGAACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGA
  5   1   2       bld Ga12 5x3  out                        XL158c15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCTGTACTCGCCAAAGGAGCCCCCCAACGGCAACGCCTTCCCCCCCTTCCACCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGA
  5   1   2       bld Ga12 5g                              XL179f18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGCCTTCCCCCCCTTCCACCCAGGCACCNTGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCNNCNTATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCANAGAGATACACAATTGGACGGACGCTGATCCCGCGGNATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCA
  5   1   2       bld DMZ  5g   ?                          xl225n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGATTCGGCACCATGGCTGGATGGAAGNGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTAC
  5   1   2       bld Ov1  5x3  out                   IMAGE:8328981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGAACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTNAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAA
  5   1   2       bld DMZ       in                         xl324h13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATCTGGAGCCTGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTA
  5   1   2       bld Egg6      in                    IMAGE:4435305.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGGATCGATATGTGGGACCCACCCCGATGTATCCACCAACATATGTGGAGCCCGGGATAGGGAGGTATACGCCATATGGGAACCAGACATACTACATAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACACGAGAGATACACTATTGGACGGACGGTGATCCCGCGGTATTTCCTAAACATCTTTGAGGGAGGAGCCACACAGCTGTACTAT
  3   1   2       bld Ga18      in                       xlk70f03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNNCATATGGAACCAGNCAGNCTACNNANNTTGAGCTGAACAAACGCTTGNAAAATTGGACAGAGGNATGTGACANTTGTGGTGGGATGCTTTTNNCACAGAGTTCTTTGAAGATGATGNAATGTTAACCATCACATTTTGTTTGGAGGATGGNCNNNGAGATACACTATAGGACGAACGCTGNTTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGANCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAANCCTATGNTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTANCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCNNNNCTAGGCNCCAACAGCCCATGGAACANNAANCCCCCCTCAAGTCAAGAAAGNAANTCC
  3   1   2       bld Ga18      in                      xlk137j01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGAGCTGAACAAANGCTTGCAAAATNGNANAGANGAATGTGACNATTNNNGGTGGGATGCTTTTACCACAGAGTTCTTNGAAGATGATGCAATGTTANNCCATCNCTTTTTGTTTGGAGGATGGNCNAAAGAGATACACANTNGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTNTTTCCCTCGACTGTGACCAGTGCACAATGNTCACACAGCATGGCAANCCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTANCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCNNNNCTAGGCNCCAACAGCCCATGGAACAGNNNNCCCCCTCAAGTCAAGAAAGTAAATCCGANNNCCANCNNCA
  5   1   2       bld Ga18      in                        xlk3n10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACNNTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAANCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGNNCAGCACCATGAGTTCTGGAGGGGGNAACACAAATNACAGCAACAGTAAAAAGAAGAGCCCAGCCAGTACCNTCGCCCTCTCCAGCCAGGTACCTGANGTAATGG
  5   1   2       bld Ov1                             IMAGE:6318027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGAACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTTGACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACCAATAACAGCAACAGCAAAAAGAAGAGGCCAGCCAGTACCTTCCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGAACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCCTGCCTTGATTATGGTTTCTTGGAAATCCTCCCCTTTCAGGAATGTAATGGTGGGGGGGCGGAAACAACCCCTGAATGGGGAGC
  5   1   2       bld Egg1                               PBX0139D02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACGAGGGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTT
  5   1   2       bld Egg1                               PBX0164C12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCCGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACT
  5   1   2       bld Egg1      in                    IMAGE:4678104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTNCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGA
  5   1   2       bld FaB                             IMAGE:8072369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTTGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGGAGGGGGCACACAAATAAACAGCACAGCAAAAAGAGAGCCCTGCAGTACTTCGCCCCTCTCAGCAGGTACTGATGTATGGTGTGGGCGACCAA
  5   1   2       bld Ga12      in                         XL150k24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGAACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAG
  5   1   2       bld Emb4                            IMAGE:5515059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCACGCGTCCGCCCACTCGTCCGCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCACCCTGATGGGAGGAGAATCGGAGATGAGATGAACGGCTCATACCGCCTGGAGACACTC
  5   1   2       bld Ga18                               xlk53i12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAATGTTAACCATCACATTTTGTTTGGAGGATGGACCAAAGAGATACACTATAGGACGGACGCTGATTCCTCGGTATTTCCGCAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCAAGGAGTCATTCCACAATAACTTTGTTTCCCTTGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGNGGGGNCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGNNGT
  5   1   2       bld DMZ       in                         xl230k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACG
  5   1   2       bld DMZ       in                         xl325m13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCAC
  3   1   2       bld Ga18      in                       xlk55k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GNNCCCGCNGTNNTTNCGAAGCNTCTTTGNNGGAGGANCCANAGAGCTGTACTATGTCNTGAAACACCCCAAGGAGTCNTTNCNCAATAATTTTNTTTCCNTCGACTGTGACCAGTGCACAATGGTCACACANCATGNNAANCCTATGTTCACACAGGTATGTGTAGAAGNCAGATTATNNCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTANNCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCNCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGTCAACACAAATAACAGCAACAGTAAAAAGAAGAGNCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAANCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCNNGNCTAGNNNNNACAGCCCATGGAACANNNNNNNCCCTCAANTCAAGAAAGNAANNC
  3   1   2       bld Eye1                            IMAGE:6949003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACAAGAGGTTGTTAATTAGTTTTTTGAAACCCCCCCCAAGGGGTTTCTTTCCACCCAAAAATTTTTTTTTCCTTCGGACTGTGGACCCGGTTCCACAAGGTCCCCCACAGCATGGGCAACCTTTTGTTCACACAGGTAAGGTTTGGAGGCCGGATTATTACCGGGAGTTTCTGTTTCGATGATATGATGAGGGTAAAAAACGTGGCACTTCGGTATCAGACAAACATCGAGAGCTCATTCCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAATACAAAAAAAGAAAAAATATATATATATTGTATACAGG
  3   1   2       bld Ga18                             rxlk114b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNNTCTTNNNNGGGNGNNNCCANAGANNTGTNCTATGTCTTGANACNCCCNAAGGAGTCATTCCNCAATANTTTTNTTNCCCTCGACTGTGNCNAGTGCACAATGNNCACACAGCATGGCAANCCTATGNTCACACAGGTATGTGTAGNAGGCAGATTATNNCTGGAGTTCATGTTCGATGACATGATGAGGATAAAANCGTGGCACTTCAGTATCAGACAACATCGAGAGCTCNTTCCCCGGAGTATTCTANNCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGNCTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACTCCGGCTGAACCAGCCAGACAAGCCCCCANNAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGTAAAAAGAAGAGNCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCNNNNCTAGNNNNNACAGCCCATGGAACANCAACCCCCCTCAAGTCAAGAAAGTAANTCCGAGNNCCANCT
  3   1   2       bld DMZ       in                         xl279c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAGCACCCCANGGAGTCATTCCACAATAACTTTGTTTTCCCTTGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACNTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGAGCGCCGCCAATGGAATTGATGATGAGGACAGCTTCA
  3   1   2       bld DMZ                                 rxl333h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTTGAAGCACCCCACGGAGTCATTNCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACNCAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCNTCGANAGNTTCANTNCCCGGAGTATTCTAGCCATGCATGNCCAAGACCCNCAAATGTTGGACCAGTNGTCTNAAANCATTACNAGATGCGGACTTTCCAACTGCACGGT
  5   1   2       bld Em10                            IMAGE:7983594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCTTGAAGCACCCCAGGAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCATAACTCTCCAGCACTAGGCGCCACAGCCCATGGACAGCAACCCCCTCTCAGTCAGAAGAAATCC
  3   1   2       bld DMZ       in                         xl254k08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACACCCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGT
  3   1   2       bld DMZ       in                         xl253j03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCT
  3   1   2      seed DMZ       in                         xl302d02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTCATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAG
  5   1   2       bld Egg3                            IMAGE:6322830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCCGGGCACATAGTTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAAGAAATCCGAGAACCCAACTTCACAGGGCTTCCCGTaaaaaaaaaaaatgaccaaaaaaaggaaaaaTNNTNTTTATATGGTGGATAAACAAGCCCGATGTGGAACgaaacaaaagggttttaattaaaaggaaaagcctccccnaaaaggaaaaaaaaaGAGCGGG
  3   1   2       bld DMZ       in                         xl324h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCCACAATAACTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACC
  3   1   2       bld DMZ       in                         xl246l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAG
  5   1   2       bld Ga15                               XL419o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAA
  3   1   2       bld DMZ       in                         xl315o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGANGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACNTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTC
  3   1   2       bld DMZ       in                         xl301e07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTCCCTCGACTGTGATCAATGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCANCTAGGCGCCAACAGCCCATGGAAACAGCAAACCCCCCTCAAGTCANGAAAGTAAT
  3   1   2       bld Emb9      in                    IMAGE:7975075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTGACTAGATCAATGCACAATGGTCACACAGCATGGCCAAACCTATGTTCACACAGGTATGCGTAGAAAGCCAGATATTACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTACACCC
  3   1   2       bld Ga12      in                         XL146k11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTGATCAATGCACAATGGTCACACAGCATGGCAAACNTATGTTCACACAGGTATGCGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCC
  3   1   2       bld Ga18      in                        xlk3n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNNNNCAATGNTCANNCANNNNNCAANNCNTNNNTNANNNAGGTATGNGTAGNANNCAGATNATNCCTGGANNTCATGTTCGATGACATGATGAGNATAAAAACGTGGCNCTTCAGTATCAGACANCATCGAGAGCTCATTCCCCGGAGTANNCTANNNNTGNATGCCCAAGACCCCCAAATGTTGGNCCAGTTGTCTAAAANCATTACAAGATGCGGACTTTCCANCTCCACGCTTANCTACCTCCGACTGTGTGTCATCCTAGAGNCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGNCCTGTCTCTTTCAGAAATGNCAACGCATGGTGGCNNTCCGGCTGAACCAGCCAGACAAGCCCCCAGNAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGTAAAAAGAAGAGNCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCANCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAATGAnAAAAAAAGAAAAAATATATATATATGTGTATAACAGNCCGATGTGG
  3   1   2       bld Neu7      in                         XL046k07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGTAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAAC
  5   1   2       bld Ooc2                            IMAGE:3747248.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACCAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCTAGATGTAATGGTGGTGGGCGAACCAACCCTGATGGTATGAGAATTCGGAGATGAAGATGAACTGCTCATTACCCGGCTGGAGAACACTCAGTTTGACGCCCGCCATGGAAATGATGAC
  5   1   2       bld Ooc2                            IMAGE:3746889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACANATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCC
  3   1   2       bld DMZ       in                         xl230k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCT
  3   1   2       bld DMZ       in                         xl294o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCT
  3   1   2       bld Tbd7      in                         XL085l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGCAGATTATACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAAC
  3   1   2       bld Ga12      in                         XL172g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGCAGATAANACCTGGAGTTCATGTTCGACGATATGATGAGGATAAAAACGNGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGATGTAATGGT
  3   1   2       bld DMZ       in                         xl325m13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGATTATACCTGGAGTTCATGTTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAA
  3   1   2       bld Ga15      in                       XL489f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTATACTTGGGAGNTTCATGTTCGACGATATGATGAGGATAAAAANGTGGCACTTNAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTNTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTTTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTNCCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAA
  3   1   2       bld Ga12      out                        XL142c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTATATAGGGCACATGTGAAATGTATATATGATCTACATGTAGAAGAAGCTTTTATTTTTATAGTTTCCCTTTAAAAAGAAGAAAACACGGGTTATGTGAGCATGTGCAGCATCCCATCTTAATTTTGACTATGAAATGAGCATTCTCACTTATTTGCAGTTCTATCCAGACATACCAAGCTAGTACTGACTATGACTGCCCATTATCAGAAACCGGATCTTTTNTGGCTTTGGCCAAAACATACAATTTTTTTTAAAATTGAATAAAAACATGTTTTTTTGTAATAATGGACAGGCCTTGTTTTGACCAGGGCTTTAACCCTGCATCCCTTACATTGCATGCATTTTTGCAGGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAANCCGAGAACCCAACTCACAGG
  5  -1   2       chi Bla2                            IMAGE:7298366.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGTGTGTGCAGTATTGCAGTTCAATTCTGGAAGCAGTCACGCACTGTCCCGTGTGAGCGTTCTGGTCTTGAGTGAGAGATAACGGCATCATTCAGCGTGAGAGTCTCCCGAGTTTAGCAGCAGCCAGACCCAAATGTGCCAGTGTTAAAACATACAAGAGGGATTTCCAATCCACGCTAACTACTCCGACTATGTGTCTCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCCCAGTaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCCAAGATTGGN
  3   1   2       bld Egg4 5g3  in                    IMAGE:3744626.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGAGTTCATGTTCGACGATATGATGAGGATAAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCAAATGTTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCTGCCAGTCCTTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAA
  3   1   2       bld DMZ       out                        xl295f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTNTGCACTCAACCCATTATCAATATATTTAAGACACCTGAATGGAAAAATGGTTAGAAATAAAGTCCATACTCGCAGGTCTTCAACGTATAGATCTATATAGGGGCACATGTGAAATGTATATATGATCTACATGTAGAAGAAGCTTTTATTTTTATAGTTTCCCTTTAAAAAGAAGAAAACACGGTTATGTGAGCATGTGCAGCATCCCATNTTAATTTTGACTANGAAATGAGCATTCTCACTTNTTTGCAGTTCTATCCAGACATACCAAGCTAGTACTGACTATGACTGCCCATTATCAGAACTGGATCTTTTCTGGCTTTGGCCAAAACATACAATTTTTTTTAAAATNGAATAAAAACATGTTTTTTTGTAATAATGGACAGGCCTTGTTTTGACCAGGGCTTTAACCCNGCATCCCTTNCANTGCATGCATTTTTGCAGGCNTCAGCTTCCCCTTGAGNTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCNGGAACTNTTCCCTTTCNGGATGTAATGGTGGTGGGCGAACCAACCATGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCNCCAATGGAATNGATGATGAGGACAGCTTCAATAACTCTCCAGCATCTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCC
  3   1   2       bld DMZ       out                        xl307n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCACTCAACCCCATTATCAATATATTTAAGACACCTGAATGGAAAAATGGTTAGAAATAAAGTCCATACTCGCAGGTCTTCAACGTATAGATCTATATAGGGCACATGTGAAATGTATATATGATCTACATGTAGAAGAAGCTTTTATTTTTATAGTTTCCCTTTAAAAAGAAGAAAACACGGTTATGTGAGCATGTGCAGCATCCCATCTTAATTTTGACTATGAAATGAGCATTCTCACTTATTTGCAGTTCTATCCAGACATACCAAGCTAGTACTGACTATGACTGCCCATTATCAGAACTGGATCTTTTCTGGCTTTGGCCAAAACATACAATTTTTTTTAAAATTGAATAAAAACATGTTTTTTTGTAATAATGGACAGGCCTTGTTTTGACCAGGGCTTTAACCCTGCATCCCTTACATTGCATGCATTTTTGCAGGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAG
  3   1   2       bld Ga12      in                         XL150k24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCGACGATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTCACAG
  3   1   2       bld Egg4 5g3  in                    IMAGE:3744388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCGACGATATGATAAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCAAAATGTTGGACCAGTTGTCTAAAAACATACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTTTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTTGCCCTCTTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAAAA
  3   1   2       bld Neu4      in                    IMAGE:4084671.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATATGATGAGGATAAAAACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCGCTAAGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAA
  5  -1   2       bld Bla2                            IMAGE:7298496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCCCCTTAATA
  5  -1   2       bld Bla2      in                    IMAGE:7296552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGTGGCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Tbd7                                 XL073e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACTTCAGTATCAGGCAGCATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTCACAGG
  3   1   2       bld DMZ       out                        xl294f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAATGGTTAGAAATAAAGTCCATAACTCGCAGGTCTTCAACGTATAGATCTATATAGGGCACATGTGAAATGTATATATGATCTACATGTAGAAGAAGCTTTTATTTTTATAGTTTCCCTTTAAAAAGAAGAAAACACGGTTATGTGAGCATGTGCAGCATCCCATCTTAATTTTGACTATGAAATGAGCATTCTCACTTATTTGCAGTTCTATCCAGACATACCAAGCTAGTACTGACTATGACTGCCCATTATCAGAACTGGATCTTTTCTGGCTTTGGCCAAAACATACAATTTTTTTTAAAATTGAATAAAAACATGTTTTTTTGTAATAATGGACAGGCCTTGTTTTGACCAGGGCTTTAACCCTGCATCCCTTACATTGCATGCATTTTTGCAGGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCT
  5   1   2       bld Ga15      ?                        XL401i10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGTAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAANAAAANAA
  3   1   2       bld Emb4      in                    IMAGE:4201671.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTATTTCCCCGAAGTATTCAAGCCATGCATGCCCAAGACCCCAAAATTGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGNACTTTCAAACTCCACGCTAAACTCCCTCCGACTAATGTGTCATCCTAGAGCCCATGCAGAAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTA
  3   1   2       add DMZ       in                         xl236c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TNCCCGGAGTNTTNTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTTTAAAAACNTTNCAAGATGNGGACTTTNCAANTNCACGNTTAANTACCTNCGACTGTGTGTCATCCTAGAGCCCNTGCAGGAGNTTATGTCCNGGCNCAAGACTTNCAGTTTAAGTNCTNGGGNCTGTTTCAAGACCTGTTTTTTTNAGAAATGGCAACGCATGGTGGCACCTNCGGNTGAACCAGCCAGACAAGCCCCCAGCAAGNGCAGGAAAAGGAAAATNTNCGGNGGCAGCNCCNTGAGTTTTGGAGGGGGCAACNCAAATNACAGCAACNGTAAAAAGAAGAGCCCAGCCAGTNCCTTTGCCCTTTCCAGCCAGGTNCCTGATGTAATGGTGGTGGGNGAACCAACCCTGATGGGAGGAGAATTTGGAGATGAAGATGAACGGCTNATAACCCNCCTGGNGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGNGGACAGCTTCAATAACTNGCCAGCNCTNGGNGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAG
  5   1   2       bld Ga15      in                       XL520d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaattgacaaaaaaagaaaaaNTNT
  3   1   2       bld Egg1      in                    IMAGE:4678104.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAGCCATGCATGCCCAAGACCCCCAAATGTTGGCCCAGTTGTCTANAACCATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCCCAGTAAAA
  3   1   2       bld Neu7      out                        XL025o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTATAGATCTATATAGGGCACATGTGAAATGTATATATGATCTACATGTAGAAGAAGCTTTTATTTTTATAGTTTCCCTTTAAAAAGAAGAAAACACGGTTATGTGAGCATGTGCAGCATCCCATCTTAATTTTGACTATGAAATGAGCATTCTCACTTATTTGCAGTTCTATCCAGACATACCAAGCTAGTACTGACTATGACTGCCCATTATCAGAACTGGATCTTTTNCGGCTTTGGCCAAAACATNCAATTTTTTTTAAAATTGAATAAAAACATGTTTTTTTGTAATAATGGACAGGCCTTGTTTTGACCAGGGCTTTAACCCTGCATCCCTTACATTGCATGCATTTTTGCAGGCCTCAGCTTCCCCTTGAGCTCCAAGAAGCCGCTTCTGACCACGCGTAGTAGTGGAAGGAAGGGACACGCCTCNTGCCTTGATTATGTTTCTGGAACTCTTCCCTTTCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGNAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCC
  3   1   2       bld Oo1       in                    IMAGE:5078578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAA
  5   1   2       bld Ga12      in                         XL202p20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGTCTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGCTTAACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaa
  3   1   2       add Neu7 5g3  in                         XL013h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNTAAAAACATTACAAGATGCGGACTTTCCAACTCCACGNTTAACTACCTCCGACTGTGTGTCATCCTANAGCCCATGCAGGAGCTTATGTCCAGGCNCAANACTTACAGTTTAAGTCCTCGGGACTGTNTCAANACCTGTNTNTTTCANAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCANACAAGCCCCCAGCAAGNGCAGGAAAAGGAAAATGTCCGGAGGCAGCNCCATNAGTTTTGGAGGGGGCAACNCAAATAACAGCAACAGCAAAAANAANAGCCCAGCCAGNACCTTNGCCCTNTCCAGCCAGGNACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGANATNAANATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACNCCGCCAATGGAATTGATGACGAGGACAGCTTCAANAACTCGCCAGCNCTAGGNGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGGCTTCNCAGTAAAAAAAAAAAA
  3   1   2       add DMZ       in                         xl320k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAAACATTNCAAGATGNGGACTTTNCAACTNCNCGNTTAANTACCTNCGACTGTGTGTCATCCTAGAGCCCNTGCAGGNGNTTATGTCCNGGCNCAAGACTTNCAGTTTAAGTNCTTGGGNCTGTTTCAAGACCTGTTTTTTTNAGAAATGGCAACGCATGGTGGCNCCTNCGGNTGAACCAGCCAGACAAGCCCCCAGCAAGNGCAGGAAAAGGAAAATNTNCGGNGGCAGCNCCNTGAGTTTTGGAGGGGGCAACNCAAATNACAGCAACNGTAAAAAGAAGAGCCCAGCCAGTNCCTTTGCCCTTTCCAGCCAGGTACCTGATGTAATGGTGGTGGGNGAACCAACCCTGATGGGAGGAGAATTTGGAGATGAAGATGAACGGNTNATAACCCGCCTGGNGAACNCTCAGTTTGACGCCGCCAATGGAATTGATGACGNGGNCAGCTTCAATAACTNGCCAGCNCTAGGNGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGT
  5   1   2       bld Gas5                            IMAGE:3750524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAG
  5   1   2       bld Ga15                               XL420o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGG
  3   1   2       bld Sp1                             IMAGE:4964285.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAAGATGCGGACTTTCCAACTCCACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGT
  3   1   2       bld Oo1                             IMAGE:3404942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGCTAAACTACCTCCGACTATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGAGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCTGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAA
  3   1   2       bld Ga15      in                       XL428n06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCTAAACTACCTCCGANTATGTGTCATCNTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTNTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCNTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAG
  5   1   2       bld Ga15                               XL402d05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaattgacaaaaaaaaaa
  3   1   2       bld Egg6                            IMAGE:4436061.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACAGGCCGATGTG
  3   1   2       bld Ga12                                 XL215n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGACACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGNGCNGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACNAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCAATAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTNNAAGTCAAGAAAGTAAATCCGAGAACC
  3   1   2       bld Egg6      in                    IMAGE:4435305.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCATCCTAGAGCCCATGCAGGAGCTTATGTCCAGGCACAAGACTTACAGTTTAAGTCCTCGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACAGGCCGATGTG
  3   1   2       bld Ga15      in                       XL474d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCATCCTNGAGCCCATGCAGGAGCTTATGTCCAGACACAAGANTTACAGTTTAAGTCCTCGGGACTGTCTCAAGANTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACATCTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAA
  3   1   2       add Ga15      in                       XL520d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTNGAGCCCATGCAGGAGNTTNTNTNCAGGCNCAAGACTTTCAGTTTAAGTCCTNGGGNCTNTTTCAAGACCTGTTTTTTTNAGAAATGGCAACGCATGGTGGCNCCTNCGGGTGAACCAGCCAGACAAGCCCCCAGCAAGNGCAGGAAAAGGAAAATNTNCGGNGGCAGCCCCATGAGTTTTGGNGGGGGCAACNCAAATNACAGCNACAGCAAAAAGAAGNGCCCAGCCAGTTCCTTTGCCCTTTCCAGCCAGGTTCCTGATGTAATGGTGGTGGGNGAACCNACCCTGATGGGNGGNGAATTTGGNGATGAAGATGAACGGNTNATNACCCNCCTGGNGAACNCTCAGTTTGACGCCNCCAATGGAATTGATGNCGNGGNCAGNTTNAATNACTNGCCAGCNNTNGGNGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATNCGNGAACCCAACT
  3   1   2       add DMZ       out                        xl265h09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTNCCAAAAAAAAAAAATTTTTnCGTTTTTTnAAAAAAAAAACnTGTTTTTTTTTGTAATGATGGACNGGCCTTGTTTGACCNGGGCTTTAACCCTGCATNCCTTNCNTTGCNTGCATTTTTGCAGGCCTCAGNTTCCCCTTGAGNTCCAAGAAGCCGNTTTTGNCCCCGCGTNGTAGTGGAAGGAAGGGNCCCGCCTTTGCCTTGATTATGTTTTTGGAACTTTTCCCTTTCNGGATGTAATGGNGGNGGGNGAACCNACCCTGATGGGNGGNGAATTTGGNGATGAAGATGAACGGNTCATAACCCNCCTGGNGAACNCTCAGTTTGNCGCCNCCNATGGAATTGATGNCGGGGNCAGNTTCAATAACTNGCCAGCCCTNGGNGCCAACNGCCCNTGGAACNGCAAACCCCCCNCAAGTCAAGAAAGTAAATCCGNGAACCCAACTTCNCNGGNTTCCCNGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACCAGGCCGATG
  3   1   2       bld Oo1                             IMAGE:3405262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTTATGTCAGAACCAAAGTTCAGTTTTAGTCCTGAAGCTGTTCAAAACTGTTTCTTTAGAAATGCAAAGAATGGTGGCACCTCCGGCTAACCAGCCAGACAAGCCCCTACCAAGCGCAGAAAAAGGAAAATGTCTGGGGCAAGCACCATGAGTCTGGAGGGGGCAACACAAATAACAGCANCAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTA
  5   1   2       bld Tad1                            IMAGE:6938907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGGACTGTCTCAAGACCTGTCTCTTTCAGAAATGGCAACGCATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCCAGCAAGCGCAGGAAAAGGAAAATGTCCGGAGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCTACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCACCGACTCAAN
  5   1   2       bld Ga15      in                       XL412h17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTCTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL412h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTNTCAAGACTTGTCTCTTTCAGAAATGGCAAAGAATGGTGGCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAG
  3   1   2       add Ga12      in                         XL202p20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAATGGCAACGCATGGTGGCCCCTCCGGGTGAACCAGCCNGNCAAGCCCCCAGCAAGNGCAGGAAAAGGNAAATGTCCGGNGGCAGCCCCNTGAGTTTTGGNGGGGGCNACCCAAATNACNGCNACNGCNAAAAGNAGNGCCCAGCCAGTNCCTTNGCCCTTTCCAGCCAGGTNCCTGATGTAATGGNGGNGGGNGAACCNACCCTGATGGGNGGNGAATTNGGAGATGAAGATGAACGGNTCATAACCCNCCTGGNGAACNCTCAGTTTGNCGCCNCCNATGGAATTGATGNCGNGGNCAGCTTCAATAACTNGCCAGCCCTNGGNGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGNGAACCCAACTTCNCAGGNTTCCCAGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAA
  3   1   2       add Sp1       in                    IMAGE:4175871.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACGAATGCGGGCACCTCCGCGCTTGAACCAGCCAGACAAAGCCCCTAAAAGGCGCAGGTTAAGGAAAATGTCTGGGGCCAACACCATGAGTTTTGTATGGGGCAGCCCAAATAACACCAACAGCAAAAAGAAGAGCCCTGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGTTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTTTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCAC
  5   1   2       bld Ga18                              xlk145k13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGGTGNCACCTCCGGCTGAACCAGCCAGACAAGCCCCTAACAAGCGCAGGAAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaaaatgacaaaaaaaTATATANGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCaaaaaaaaaa
  3   1   2       chi Gas8                            IMAGE:3517382.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGGCCCGAATCGGCAAAATTCCCTAATCATCCAAAGAGAATCCCCCAAAAAAGGGTTAAGGGTGGTCCAATTTTGGACCAGGGGCCAATATCCGCGCCCCACCAAAAGAAAAGCCAAGCCGGACCTTTGCCCTTTTCAACCCAGGTCCTTAAGGTAATGGTGGTGGCCGAACCCACCCTTGATGGGAGAAGAATTGGAAAATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCAAAAAAAAGAAAAAAAAAAGCTGAAACGTATCTACCTGTAAATTGAAATAAATTACATTTTAAATTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu4      in                    IMAGE:4084625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCAACCCAGACAGGCCCTACAAAGGCAGGAAAAGGAAAATTTCCGGGGGCAACACCATGAGTTCTGAGGGGGGCACCCCAAATACCAGCACAGGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAA
  3   1   2       bld Tbd7      in                         XL094a19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAGGAAAATGTCCGGGGGCAGCACCATGAGTTCTGNAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGNCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAAAACCCAACTTCACAGG
  5   1   2       bld Ov1                             IMAGE:6318690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTANaaaaaaaaaaaaaaaaaaaaaaatgaccaaaaaaTATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCaaaaaaaaaaaaaaaaaaaaaaGCTGAAACGTATCTACCTGTAAATTTAAATAAATGACATTTTAAATGTAACCCCTATAGGTCCTGCCTTTTTAAGAAGAGGGGTTAGTGTAAGAGCAAAATTGGAAAGGAGGTACTGTGGACCAGGCGCTGCCATCTTAACGAAATGTCCAATAAAGATCAGTGTGTTTATATCAATAGAAATGTATATATGGGCTTGGTGGTTGGACAAACACTGAGAAAGCCATACATTTAGTGTGAGATACTTTACTGGGCATGAGCTCAACCAGTCTCTCTGGCTTAGCACTTTATTGGNAAATTTCTGGAACAACCCTTTATTATATCCCTTTCATTTAGGCAATAGGGAGAACCATCTTTCNTGTANAAGGNACAGGGAGCAATACCCCTCTGTAAACTGAACATTTCCAAAATGGGGGCCCCCCTGGNCCTTTTGTGTTCCCATGGTGGATCATTGTAAGCAAACTTTCATTCCCCCTTTTCTCGGCCAAATCAAATGGGGCCCATTTTATAGCTT
  5   1   2       bld Ov1                             IMAGE:6318692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATGTCCGGGGGCAGCACCATGAGTTCTGGAGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaCCATTGACAAAAAAATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCaaaaaaaaaaaaaaaaaaaaaaGCTGAAACGTATCTACCTGTAAATTTAAATAAATGACATTTTAAATGTAACCCCTATAGGTCCTGCCTTTTTAAGAAGAGGGGTTAGTGCAAGAGCAAAATTGGAAAGGAGGTACTGTGGACCATGTGCTGCCATCTTAACGAAATGTCCAATAAAGATCCCGGTGTTTTTATCAATAGAACTGTATATATGCGGCTTGGGGGGTCTGGACAAACCCCTAAGAAAACCCTAACATTTAGTGCGGAGATACTTTTACTGGGGCATGAAGCTCAACCCATCCCTCTCTGGCCTTAGCAACCTTCATTGGAAAATTTCTGGGAAACAACCCCTTTATTCATATCCCCTTCCATTTAAGGCCAATAGGGAGAAACCTTTCTTCTTTGTACCAAAGGACCCGGAAGCAATTACCCCCCCTGGGAAATTGAAACTTTCCAAAAAGTGGCCCCCACCCTGGTCCTTTCTTGTTTTTCCCCGGTTGGCCACATTGGTAGACAAACTCTCCATTTTTCTCTTGCTTCCCTAATCCCAGTGTGGGCAAACTATCCCACTTCGCTCCTTT
  5   1   2       bld Emb1                            IMAGE:6634733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGGGCAACACAAATAACAGCAACAGCAAAAAGAAGAGCCCAGCCAGTACCTTCGCCCTCTCCAGCCAGGTACCTGATGTAATGGTGGTGGGCGAACCAACCCTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaatgacaaaaaaagaaaaaatatatatatatgtgtataacaggccgatgtggaggaacaaaatgttttaaataaaagtaaagtctccaaaaaaagaaaaaaaaaaGCTGAAACGTATCTACCTGTAAATTGAAATAAATTACATTTTAAATTTAACCCCTATAGGTCCTGCCTTTTTAAAAAGAGGGGTTAGTGTAAGAGCAAAATGGGGGAAGGAGGTACTGTGGACCATGCGCTGCCATCTTAACAAAAGCATTTTAGCGTCTGTCAGACAGAGCGGTGTGTGTTTATATCTATATAAATGTGTATATGGGCTTGGCGGGTGGAGGCCAGAGAAATAAGTGGGACACACAAACACTGATAAAGCCATAGATTTAGTGGGAGATACTCTAGTGGGCATGGGCTCACCCAGTCTCTCTGGCTTAGCGCTTTATTGGAGATCTCTAGCACCCCAACCTTTTTATGTAGCCCTTTCATTTAGGGCAATAGGGAGAACCGGTCTTTTCGTGGTTCCAGGGACAGGNAGAT
  3   1   0       chi Ooc2                            IMAGE:3745209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTTTAGCCCTCATCATACAGGTAACCTATGACATGGTGGAGGACAACCCAACCCTTATGCTAGTACAATTTGAGCATAAAAACAAACGGCTCATAACCCGCGTGAATTACACTCAGTTTTATTCCGCCAATGTAATTTATGATTAGCACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAAAAAAAAAAAAAAATGACAAAAAATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCAAAAAAAAA
  3   1   2       add Ooc2                            IMAGE:3745089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAAAAAAACCATCCCTGATAGGGANACAATTTAGATATTAATATAAGGTGCTCATAACCCGCCTATAAATCACTCAGTTTTACACCGCCAATGCTATTGATAATGAGGTCAGCTTCAATTACTCTCCAGCACTAGGCGCCAACATCCCATGTTACAGCAAACCCCCCTCAAGTCAAGAAAGTTAATCCGAGAACCCAACTTCACAGGCTTCCCAGTAAAAAAAAAATAAAAAAAAAAAAAATGACAAAAAATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCAAAAAAAAA
  3   1   2       add Neu4      in                    IMAGE:4084626.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGAACCAACCCCTGATGGGAGGAGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCAGGAGGAAACAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTGTCACCAGTAAAA
  3   1   2       add DMZ       in                         xl222h04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCNCGNGGCTGATGGGNGGNGAATTNGGAGATGAAGATGAACGGCTCATAACCCNCCTGGNGAACNCTCAGTTTGACGCCGCCAATGGAATTGATGNCGNGGNCAGCTTCAATAACTNGCCAGCNCTNGGNGCCAACAGCCCNTGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGGGAACCCAACTTCCCNGGNTTCCCNGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACCAGGCCGAT
  5   1   2       bld DMZ       in                         xl222h04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGATGGGAGGAGAATTCGGAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaantgacaaaaaaagaaaaaaTATATATNTNTGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCaaaaaaaaaa
  5   1   2       bld Ga15                               XL464n01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAATTTGGGGATGAAGACGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaa
  3   1   2       add Ooc2                            IMAGE:3745113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTTGGGTAGAAAATCATATGGCTAAAAATCCACTTGTAGAACACTCAGTTTATCTCCGTCAATGTAATTGATTATGAGCACAGCTTCAATAACTCTCCAGCACTAGGTGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCAC
  3   1   2       bld Egg1                               PBX0002H10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCGAAGATGAAGATGAACGGCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGACGAGGACAGCTTCAATAACTCGCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTAAAAAAAAAAAATGACAAAAAAAGAAAAAATATATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCAAAAAAAGAAAAAAAAAAGCTGAAACGTATCTACCTGTAAATTGAAATAAATTACATTTTAAAAAAAAAAAAAAAAAAAAAGATTC
  5   1   2       bld Ov1                    IMAGE:6318692-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTCCATAAACCCCGCCTAGGAGAACACTCAGTTTAGACCGCCCGCCAATGGAATTCGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaaaaatgacaaaaaaaTATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGCCTCCaaaaaaaaaaaaaaaaaaaaaaGCTGAAACGTATCTACCTGTAAATTTAAATAAATGACATTTTAAATGTAACCTCTATAGGTCCTGCCTTTTTAAGAAAAGGGGTTAGTGTAAGAGCAAAATTGGAAAGGAGGTACTGGGGACCAGGCGCTGCCATCTTAACGAAA
  5   1   2       bld Neu7      in                         XL006l15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCATAACCCCGCCTGGAGNAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTGaaaaaaaaaa
  3   1   2       bld Neu7      in                         XL006l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTCATAACCCGCCTGGAGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGNAAAGTAAAGCCGAGAACCC
  3   1   2       add Ooc2                            IMAGE:3745185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCATAACCCGCCTGTTAAACACTCAGTTTGACNCCGCCAATGGAATTGATGATNAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCTTCAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCCCAGTAAAAAAAAAAAAAAAAAAAAAAAAATGACAAAAAATATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCAAAAAAAAA
  5   1   2       bld Tbd5                            IMAGE:3579787.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAACACTCAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaaaaaaatgacaaaaaaaaaTATATATGTGTATAACAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCaaaaaaaaaaaaaaaaaaaaGCTGAAACGTATCTACCTGTAAATTTAAATAAATGACGTTTTAAATGTAACCCCTATAGGTCCTGCCTTTTAAGAAGAGGGGTTAGTGTAAGAGCAAAATTGGAAAGGAGGTACTGTGGACCAGGCGCTGCCATCTTAACGAAATGTCCAATAAAGATCAGTGTGTTTATATCAATAGAAATGTATATATGGGCTTGTGGTTGGACAAACACTGAAAAAGCCATACATTTANT
  5   1   2       bld Ga18                               xlk80j08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTTTGACGCCGCCAATGGAATTGATGATGAGGACAGCTTCAATAACTCTCCAGCACTAGGCGCCAACAGCCCATGGAACAGCAAACCCCCCTCAAGTCAAGAAAGTAAATCCGAGAACCCAACTTCACAGGCTTCACAGTaaaaaaaaaaaaaaaaaaaaaaaaatgacaaaaaaaTATATATGTGTATANCAGGCCGATGTGGAGGAACAAAATGTTTTAAATAAAAGTAAAGTCTCCaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)