Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5511675.5.5                    30 PI      79        270      797                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8542788.5                      24 PI      74        295      763                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8821522.5                      17 PI      93         21      792                RAB5A, member RAS oncogene family [Xenopus tropicalis]
     4   0.0    0Xl3.1-IMAGE:3437268-IMAGp.5                 9 PI      77        295      808                (no blast hit)
     5   0.0    0Xl3.1-XL439f10ex.3                          6 PI      82       1397     2079                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012767992 Xl3.1-XL444a16ex.5 - 67 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL444a16ex.5                                     GTGAGATTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTTTTTTTTTTTCTAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATAGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAAAAAAAA
                                                  Xl3.1-CHK-1012686131                                           TTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTTTTTTTTTTTCTAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATAGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAA
                                                      consensus depths                                          3     6     7    11    15    18    23    26    28    29    30    31    30    31    30    31    30    31    30    31    31    32    31    32    31    32    31    32    31    32    32    33    32    33    33    33    33    33    33    33    33    33    34    34    34    34    33    34    34    34    34    34    34    34    33    34    30    32    31    32    30    32    31    32    31    32    31    32    31    32    31    32    30    32    30    32    30    32    31    33    31    33    29    33    30    33    30    34    31    33    31    33    30    32    30    32    29    32    27    31    28    31    26    29    22    27    24    27    24    28    25    28    23    27    20    27    20    28    19    28    20    28    16    25    17    24    15    24    17    23    17    22    12    20    12    20    12    20    11    18    11    16    11    16    10    14     9    14    11    15    11    13    11    13    11    13    11    12    11    12    11    12    11    11    11    11     8    11     7    10     7    10     7    10     6    10     6     9     6    10     6    10     5     9     5     9     6    10     6    10     7    10     7    10     6    10     6    10     6    10     6    10     6     9     6     9     6    10     6    10     6     9     6     9     6     9     6     9     6     9     7    10     7    10     6     9     5     8     5     8     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6    11     6    11     6    12     6    12     6    11     6    11     6    11     6    12     6    12     6    12     6    13     5    13     6    14     6    14     7    15     6    15     8    16    12    15    14    16    13    16    14    16    16    18    16    18    16    18    16    18    14    18    15    17    15    17    15    17    15    17    14    17    14    16    15    17    13    15    13    14    12    14    11    13    11    13    11    13    11    12    10    12    11    12    10    12    10    12    10    11    10    11     8    11    10    11     9    11     7    11     8     9     5     6     4     6     5     6     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAGATGCATTGCAAGCCTCCATGGCAGTATGTTCAACTAGGCCCTGAGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTTGTTTACTGCTAATTCTGATTTTTTTTTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T-G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A------G---
                                               BLH ATG     244    1316                                     
                                               BLH MIN     244     136                                     
                                               BLH MPR     217     136                                     
                                               BLH OVR     244      64                                     
                                               CDS MIN     244     136                                     
                                               EST CLI       2      24                                     
                                               ORF LNG     244       1                                     
  3  -1   2       bld Ga11                            IMAGE:3474752.3p AGCTCAGAATAAACGCTCAACTTTGGCATTTCCCAATTCCCCGGGGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATC
  5   1   2       bld Emb1      in                    IMAGE:3402316.5p             CACGCGTCCGGATTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGAGCGTTGCGGGGACGAGCTACAAGCATGCGATCCTGGGGCAACGATGCTGTGCTAAGAAANATCGGGATCTGTCCGCGCGGGAGGCGGGCTCTGTTTAGACGTTTGCCGAGAAGGATAACAAGAGCATCCAATCCCACTCCTTTGCAGTCTTGGGCTGCAGACCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGTGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073101.5p                           CCACGCGTCCGTGAGATTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGCGGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCC
  5   1   2       bld Emb1 5g                         IMAGE:6632261.5p                           GGACGCGTGGGTGAGATTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGNAACCACAGGGCTGGGAGCAGCAACACCATCAGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074640.5p                            GACCCACGCGTCCGATTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAA
  5   1   2       bld Egg3 5x3                        IMAGE:6326578.5p                            GTCGATTCCCGGGGATTTGTGACGTCTCGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAAACCACAGGCTGGAGCAAAGCACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAAACTAATTAAAGGCTTT
  5   1   2       bld Oo1  5g                         IMAGE:6856885.5p                                       TCGGATGTGACGTCTAGATTGGCTGTTCGGCACGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGTTCAAGCTTACCCAGATGACAACCGCTTTATTGTTCCTGGAGAACTCCTGCTAAAAAAATCCAGTGGATGGTGCAATGAAAATCCCTTCCATGGCCCTACTGGCCTACAAAAAGCCTTCCCAAAGGACCGGGAAACCCAACAAGGGTTTGGGTAAGCCAAAGTCACAACCATCCATTCTCCCGAAGGGGAAAGGAGGGGGAAGATGAATaaccccctacacccctgtggaaaataccatcccaccccctaaccccc
  5   1   2       bld Emb1 5g                         IMAGE:6863272.5p                                         CCACGCGTCCGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGGATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGGAGCAAGCAACACCATCAGAGGGAAGAGGAGTAGAACCTAACTGAAACAAGCACAC
  5   1   2       bld Emb1 5g3  in                    IMAGE:3401698.5p                                           TTTGTGACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAG
  5   1   2       bld Egg1 5g                            PBX0124D05.5p                                            GGCACGAGGCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCC
  5   1   2       bld DMZ  5g3  in                         xl264b03.5p                                                GACGTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTT
  5   1   2       chi Emb1                            IMAGE:6634049.5p                                                   GTCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATTCGGAGCCGCTTTTCCTTACCCAGACAGGCCTGTCCTCGATGATACAACCCGTAAAAATTTGGAAATTTTGGGGAATACCGCTTGGGTCAAAGAAAGAATATTCCCCAGCCCTTGCTTCCCATTGGTATTTACCGGGGGGAACGCCCCAAGGTTGGCAAAAAAGGTGGGAATTTTGGGACCTTCCCCCAAATGGGAGGGAAATCCCCCTTTTGGCCTaaaaaacccaaaagaaaactgggggggtaaaaaaaaaaaatttggccaaaaaaaaaaaagggggaaaaacccccccccaaaaaaatttgggagaaccccccccTTTTTTATTCTCGGGGGGAAAAACACAAAACGCTTGTGTATCTCTTTTA
  5   1   2       bld Gas5 5g                         IMAGE:3749033.5p                                                    TCTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCTAAGAACTGGGTAAAGAACTGCAGAGACAGGCAAGCCCCA
  5   1   2       bld DMZ  5g3  in                         xl312i04.5p                                                     CTAGATTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGC
  5   1   2       bld Emb1 5x3                        IMAGE:5156323.5p                                                      GGACGCGTGGGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGGATGTGAATGAGATCTTCATGGCTATAGCTAANAAGCTTCCCAAAGACGGAACACAGGCTGGAGCAAGCAACACCATCAGAGGGAGAGGAGTAGACCTAACTGGAACAGCACAACCCACCAAAAAGTCATGCTGTAGTAACTAATTAAAGGCTTCTTG
  5   1   2       bld Sp1  5g                         IMAGE:5512135.5p                                                      TGGATACGCTGTCCGGTAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAGAAGCTCAGGCTACGCAGATGACACAGCTTATTGTCATGAGACTCTGCTAGACTCAGTGATGTGATGAATCTCATGCTATGCTAAAGCTCAAGACGAACCAGCG
  5   1   2       bld Egg1 5g                            PBX0139B01.5p                                                       CACGAGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTG
  5   1   2       bld Ga12 5g                              XL147e09.5p                                                          GTGGCTGTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGATTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCA
  5   1   2       bld FaB  5g                         IMAGE:8071879.5p                                                                GTCCGGCAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGAACACAGCTTATTGTTCATGGAGACTTCTGCNTAGACATCAGTGAATGTGAATGAGATTCTCATGGC
  5   1   2       bld Em10 5g                         IMAGE:8318687.5p                                                                   CCGGCAGGAACAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGAC
  5   1   2       bld Eye1 5g                         IMAGE:6946584.5p                                                                      CAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATTGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCCTGTGGATTTTCAAAGAAGCTCACGCTTTACGCAGATGAACAACAGCTTATTTGTTCATGGGAGACTTCTGCTTAAGACATCCAGTGAAATGTGAAATTGAGATCTTTCATGGGCTAATAGCCTAAAAAAGCTTCCCAAAAGAACGGGAAACCACAAGGGCCTGGGAGGCCAAGTCAAACACCCCATTTCANTAAggaaaaaaagggaaattaaaaaccctttaaacctggaaaaaacaaggtcacaaaaaccccccaccccaaaaaaaaGGTTCCAAATGGGGCCTTGGTTAGATTTAAAAAC
  5   1   2       bld Te2N      in                    IMAGE:7203002.5p                                                                      CAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCNAAGACGGAACCACAGGCTGGAGCAAAGCACACCATCAGAAGGAGGAGGAGT
  5   1   2       bld Ga15 5g3  in                       XL444a16ex.5p                                                                      CAGGAACCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGGAGCAAGCAACACCATCAGA
  5   1   2       bld Egg3 5g                         IMAGE:3377355.5p                                                                         CCGGCAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTGTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGAC
  5   1   2       bld Te2  5g                         IMAGE:7392487.5p                                                                         GGAACAAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCATATTGTGATCGCTTTATCTGGTACAAAGCTGATCTGTCACAAAGAGAGCTGTGGTTTTTCAGAGCTCAGGCTACGCAGATGACACAGCTATTGTCATGAGACTCTGCTAGACTCATGATGTGATGAATCTCATGCTATACTAAAGCTTCAAGACGACACAGCTGAGCACACACA
  5   1   2       chi Int2                            IMAGE:8528346.5p                                                                         GGAACCAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGGTAAAAGAGCATCCAACCCACCCTTTGCTTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGGCCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCATAAAGGGACAGTTTCATGAATTCCAATAAAGCACAATCGGATCCGCTTTCCTTACCCAGACAGTTCTGTCTTGATGATACAATCTTACAATTTGAAATTTTCGATACAACTGGTCAAGAACTATATCACACCCTGTCTCTAAAGTACTATTACGAAGCCTCATCTGTAAGTATTTTCACATCCATCATCCTTTATTATTCTATTTCTCCAGTTAATATCTTGAATTAAAATACTTACCCAGACTTGTACATACTATTACTGTGTACGCCTTAATGGGTAACTTATCTTTATTCTCTCTGTAAATTCCTAATATTATATTAATTCTCTGTTATCACATTTATCCTTTAAATCTATATACTATATATCTTATCTGATTTCGCTAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7973880.5p                                                                              CAGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGAATTTCAGAAGCTCAGGCTTACGCAGATGACACAGCTTATGTTCATGAGACTCTGCTAGACATCATGATGTGATGAATCTCATGCTATACTAAAACTCCAAGACGGACCCGGCGGAGCAGCACCCTCAAGGAGAGATAACCTACGAACCCCACCCCAAGCAGCGGATACTATAGGTTTGTCTAACGATGATA
  5   1   2      seed Ga15 5g   ?                        XL478p11ex.5p                                                                               AGAAGCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAG
  5   1   2       bld Neu7 5g                              XL042g12.5p                                                                                   GCTGGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGC
  5   1   2       bld Eye1 5g                         IMAGE:7019885.5p                                                                                      GGACGGTAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATTGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGGCTTATTGTTCATGGAAGACTTCTGCTAAGACATCAGTGAATGTGAAATGAGATCTTTCATGGGCTATAGCCTAAAAAGCTTCCCAAAAGACGGGAACCCCAAGGGCTGGGAGCAAGGCAACACCC
  5   1   2       bld Gas7 5g3  in                    IMAGE:4083607.5p                                                                                        CCGGGAACGGCGTTGCGGGACGGCTAAAGCAGCGATCCGGGGCAACGAGCTGTGCTAAGAAAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATTCGGCAGTGGAAGGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGGTCCAATGTATTACAGGGGGAGCCCAGCTGCAATAGTTGTATATGACATCGCAGATGAGGAATCGTTTGCTAGAGCAAAAGAGCTGCTAAAAGAACCTGAGAGACAGGCAAGCCCCATTATTGTGATT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175121.5p                                                                                                                                                    AAATCGGGACTGTCCCGCGGGAGGCGGGCCTGTTTAGCGTTTGCCAGAAGGATAAAAGAGCATCCAACCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAG
  3   1   2       bld Te2N      in                    IMAGE:7203002.3p                                                                                                                                                                                                                       CCCACCCTTTGCGTCTTGGGCTGCAGCCGACTTTGCAATCATCAGACATCTTGTCCGCGCTTAAACATGGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGCGGGGAATAAAATCTGCCAGTTTAAGCTTGTCCTTTTAGGAGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTGTACCCTAAAGCCTCTATGGN
  5   1   2       bld Egg6                            IMAGE:4435760.5p                                                                                                                                                                                                                                                                                           GGCAAACCGAGGCGGAGCTACCAGACCGAATGGACCGAATGGGGGGAATAAAATCTGCCAGATTATTCTAGTTCTTTTACGAGAATCTGCATGTGGAAAGTACAGTTTAGTGCTTCACTTCATAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACACAGACAGTCTGACTCGATGATACAACCGTAAAATTTGAAATTTGAGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACCAGGAGAGCCCAAGC
  5   1   2       bld Egg1                               PBX0081G11.5p                                                                                                                                                                                                                                                                                                                                                                            AGAATCTGCAGTTGGAAAGTCCAGTTTAGTGCTTCGCTTCGTAAAGGGACAGTTTCATGAATTCCAAGAAAGCACAATCGGAGCCGCTTTCCTTACCCAGACAGTCTGTCTCGATGATACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTTGCTCCAATGTATTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCT
  3   1   2       bld Ga15 5g3  in                       XL444a16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAACCGTAAAATTTGAAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTNGCTCCAANGTATTACAGGGGAGCCCAAGCTGCAATAGTNGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCCTGTGAAAAC
  5   1   2       bld Brn3                            IMAGE:8539192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAATTTGGGATACAGCTGGTCAAGAGAGATATCACAGCCTGGCTCCAATGTACTACAGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCATTTGCAAGAGCAAAGAACTGGGTAAAAGAGCTGCAGAGACAGGCAAGCCCCAATATTGTGATAGCTTTATCTGGTAACAAAGCTGATCTGGCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAAGCTTATGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCAAAGACATCAGTGAATGTGAATGAGATATTCATGGCCATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGTGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCTACCAAAAGCCAATGCTGTAGTAACTAAATAAAGGCTTTTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTAGTGCCAGCCCTTCAGATGCATTGCAAGCCTCCATGGCAGTATGTTCAACTAGGCCCTGAGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTTGTTTACTGCTAATTCTGAttttttttttttCATATGCATGCATTACGTTTCTACAGCCGTTCTCGGTGTGGAGGAATAGACTGGTGTATTGTAAGACTCAGGACCTTGTTAGAA
  5   1   2       bld Bla1      in                    IMAGE:3379747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGGGGAGCCCAAGCTGCAATAGTTGTATATGACATCACAAATGAGGAATCGTTTGCTAGAGCAAAGAACTGGGTAAAAGAACTGCAGAGACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATC
  5   1   2       bld Neu7                                 XL016l13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGNACAGGCAAGCCCCAATATTGTGATCGCTTTATCTGGTAACAAAGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTTCAGCGTGGGAGAATAGACCTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGG
  5   1   2       bld Tad2                            IMAGE:6932638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACttttttttttttttctagaaaaaaaa
  5   1   2       bld DMZ                                  xl340n10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGATCTGTCCACAAAGAGAGCTGTGGATTTTCAAGAAGCTCAGGCTTACGCAGATGACAACAGCTTATTGTTCATGGAGACTTCTGCTAAGACATCAGTGAATGTGAATGAGATCTTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAAGCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAAGTTTTAAACttttttttttttttttt
  5   1   2       add Brn1                            IMAGE:6956084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTGGTCCGGTCCGGATTCTCGGGATGCTTATTGTTATGGAGACTTCTGCAAAGACATCAGTGAATGTGAATGAGATATTCATGGCCATAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGTGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCTACCAAAAGCCAATGCTGTAGTAACTAAATAAAGGCTTTTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTAGTGCCAGCCCTTCAGATGCATTGCAAGCCTCCATGGCAGTATGTTCAACTAGGCCCTGAGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTTGTTTACTGCTAATTCTGAttttttttttttCAATATGCATGCATTATGTTCTACAAGCCGTTCTCGGTGTGGAGGAATAGACTGGTGTATTGTAAAGACTCAGGACCTTGTTAAGAACAATATTTGTATCTGCAATGCATTGCAAACTTCTGGGTGCAACGTAGAAATGGTTATATTATATTATGATGGTGACAATTAGCCCAAAGTGGAACTTTTAACtttttttttttttttttAAGATAATACAAGCAGGGTATAAAATCTATTTCATCTCTTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGATCTACATTCCGGTTTATTAATTTATAACTTGTTTAGCCACTAATGGTTGCTGCTTTTCAAACGATAAGTACACCAATAACCCATTGAATGTTTTAGGGGGGAAATTCCTGGGTTTTTTATTTAATAAAA
  5   1   2       bld Eye1                            IMAGE:6946581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATGGCTATAGCTAAAAAGCTTCCAAAGACGGAACCACAGGCTGGAGCAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCCACCAAAAGTCAATGCTGTAGTAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACttttttttttttttttttctagaaaaaaaaaaGATTTTTTTAAGCTAATACAACCAGGGTATAAAATCAATTTTTTTCTCTACAGTGTTTTGCTCCAAAATCCCCCTTTTTACAAAATCCCAAATCTAACATTTCCGGTTTATTAAATTTAAAAACTTTCGATAACCCACTAAATTTTTGGCCGCCTTTTTCAACCGATTAAACACGAAATATTTGGATATGAATTAACACCCAAAAAAACTCCATTTAATGTGTTTTAGGGGGAAATAGGGCCTTAAATTTGTTTATTTTTTCAAAATTAACAATTTTACCCCAATTCCAAATTTCTCTTCCAAGGGGTGGAATATTTTTTTATATTTATTGGCCCCCTCTCCCTGTGACACACAAC
  5   1   2       add Sp1                             IMAGE:5507106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTAAAGCTAAAAAGCTTCCCAAGACGGAACCACAGGCTGGTGGAAGCAACACCATCAGAGGAAGAGGAGTAGACCTAACTGAAACAGCACAACCTACCAAAAGCCAATGCTGTAGTAACTAAATAAAGGCTTTTTGTTCTTTAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTAGTGCCAGCCCTTCAGATGCATTGCAAGCCTCCATGGCAGTATGTTCAACTAGGCCCTGAGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTTGTTTACTGCTAATTCTGAttttttttttttCAATATGCATGCATTATGTTCTACAAGCCGTTCTCGGTGTGGAGGAATAGACTGGTGTATTGTAAAGACTCAGGACCTTGTTAAGAACAATATTTGTATCTGCAATGCATTGCAAACTTCTGGGTGCAACGTAGAAATGGTTATATTATATTATGATGGTGACAATTAGCCCAAAGTGGAACTTTTAACttttttttttttttttAAGATAATACAAGCAGGGTATAAAATCTATTTCATCTCTTCTTTACAGTGTTTGCTCAAAATCACCTTCTCCAAAATCCAGATCTACATTCCGTTTATTATTTATAACTTGTTAGCACTAATGTTGCTGCTTTCAACGATAGTACACCATACCCATGATGTTAGGGGATATCTGGTTTTATAATAACATACGAGAA
  5   1   2       bld Gas5      in                    IMAGE:3749232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAACTAATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAA
  5   1   2       bld Tad2      in                    IMAGE:6873379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATTAAAGGCTTCTTGTTCTATAAACTGTATGGATATTATCTTGCTTCCTAATTGTTAATAACAATTTAGTGTTTAATCCTGTCTTGGCCTTTGTGCCATCCCTTCAGAGCAATGCATTGCAATCCCCCATGGCAGTCAGTATGTTCAACTAGGCCCTGTGAAAACTAATAAAGAGAGACTTGCAGTGTGGTCTCATACATAATACAGAGTTCTTTTACTGCTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACttttttttttttttctagaaaaaaaaaaGATTTTTTTAAGCTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATAGTATGATTACACCAAAAACTCATTAATGTTTANGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGGGATTTTTATTATGCCCTCCTGCACCCATCTTACAGAACACCCAACTCTTTCAATCTACTCTATTTTTgggggggggggg
  3   1   2       bld Emb9 5g3  in                    IMAGE:7973880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAATAAAGAGGAGGACTTGCAGTGTGGTCTCATAACATAATAACAGAGACCTTTACTGCTAATCAGATTTTTTAATATGCATGCATATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAACTTTTAAAACTTTTTTTTTTTTTTCTAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATAGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGTTTCCCTTTTTTTTTATTTTTGTATCCAGTTTTACCCACTGCAAATACAAAAAAACGCAATGTTCCAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACCAAAACGTTAAAAAGTATTGACAGTGGAAAAAT
  5   1   2       bld Ga15      in                       XL431b07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAATTCAGATTTTTTAATATGCATGCATTATGTTCTACGATGCGTTCTCAGCGTGGGAGAATAGACTGGTGTATTATAAAGAGCTTTATCACATGCAGGACCTTGGTAAGAACAATAATTGTATCTGCAATGCATTGCAAACTTCTTGGTGGAAAGTAGAAATGGTTCTATTATAATGGTGACAATTAGCCCAAAGTGGAAGTTTTAAAACttttttttttttttttttccaaaaaaaaaa
  3   1   2       bld Tad2      in                    IMAGE:6873379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTGCAAATGCATTGCAAACTTTTTTTTTGGAAAGTAAAAAAGGTTTTTTTTTAATTGGGGGCAATTAGCCCCAAAGGGGAGGTTTTAAAACTTTTTTTTTTTTTCTAGAAAAAAAAAAAGATTTTTTTAGCTTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTCCAGGGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCTAACGATAAACAGAATATAGTATGATTACACCCAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTTACAGAACACCCAACTCTTTCAATTCTACTTCTAATTTTTGGGGGGGGGGGGTTCCCTCTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATCTTAGCTTTGAAACCTTTAAAAGGCATGACAGTTAAGACCT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAACTTTTAAAACTTTTTTTTTTTTTTTCTAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATTGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGGTACTAAAATGCTA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073101.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTCTAGAAAAAAAAAAGATTTTTTTAAGCTAATACAAGCAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATTGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAAAAAAAAAAAG
  3   1   2       bld Bla1      in                    IMAGE:3379747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGGTATAAAATCAATTTTTTCTCTACAGTGTTTGCTCAAAATCACCTTTTACAAAATCCAGATCTACATTCCGTTTATTAATTTATAACTTCGTAGCCACTAATTTTGCCGCTTTCAAACGATAAACAGAATATAGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGGTTTCCCTTTTTTTTT
  3   1   2       bld DMZ  5g3  in                         xl312i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTTTGCCGCTTTCNAACGNTAAACNGNATTTTGNNNGGTTNCCCCNAAAACNCCTTAANGNTTNGGGGNTNGGGTTAGNTTTTNTTTCANATNCNATTNCCCATCNATTTTTCNAGGGGNTTTTTNTTNTGCCCNCCNGCCCCNTTTTCNCAGNACCCCNAANTNTTTCAATTTTACTTTTAATTTNGGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCNGTATGTATTAAAGCATGGTGAAACATTTGAGCACTGGGNTGTAATATGTTAAGATTTGCTATACCACTATTTTAGCTTTGNAACCTTTAAAAGGCNNTACAGTAAGTGC
  3   1   2       bld DMZ                                 rxl243o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGCCGCTTTCAAACGNTAAACAGAATATTGTATGATTACACCAAAAACTCATTAATGTTTAGGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCNCCATNTTCACAGAACNCCAAACTCTTTCAATTNTACTTCTAATTTTTTGGGGGGGGGGTTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTATAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACANTTGAGCATTGGGTTCTAATA
  3   1   2       bld Emb1 5g3  in                    IMAGE:3401698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATATTGTATGATTACACCAAAAACTCATTAATGTTTAAGGGATAGGCTTAGTTTTTATTTCATATACAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTTGGGGGGGGTTTTTCCCTTTTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTAAAAAAA
  3   1   2       bld DMZ  5g3  in                         xl264b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TNCCCCNAAAACTCCTTAATGTTTAGGGGNTAGGNTTAGTTTTTATTTCATATNCAATTACCNATCAATTNTTCAAGGGGNTTTTTNTTATGCCCTCCTGCCCCNTNTTCNCAGNACCCCNAACTCTTTCAATTNTACTTNTAATTTNGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTGTAAGATTTGGTAAAACG
  3   1   2       bld Gas7 5g3  in                    IMAGE:4083607.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTACCAATCAATTCTTCAAGGTGATTTTTATTATGCCCTCCTGCACCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTTGGGGGGGGTTTTTCCCTTTTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAGCATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ga18                             rxlk117i10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTNTTATNCCCTCNNGCNCCATCTTNACAGANNNCCAANNTCTTTNAATTCTNCTTCNANTTTTGGGGGGGGGGGGTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGA
  3   1   2       bld Gas5      in                    IMAGE:3749232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATCTTCACAGAACACCAAACTCTTTCAATTCTACTTCTAATTTTGGGGGGGGGGTTTCCCTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCGTGGGTAATTTAAAAAA
  3   1   2       bld Ov1                             IMAGE:4055321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTCTAATTTTTGGGGGGGGGGTTTTCCCTTTTTTTTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAAAAAAAA
  3   1   2       bld Ga15      in                       XL431b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCNGGGGGGGGGGTTTCCCTTTTTNNTTTATTTTTGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAANNGTA
  3   1   2       bld Ga18                              rxlk73o15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNGGGGGGGnnnnnnnnnTTTTTTTTTTTTTTNNNTCNAGTTTNNCCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTATAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATNACAGTTAAGTGCTATTTTGGTGAATG
  5   1   2       bld Emb1                            IMAGE:6635391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    tatttttGTATCCAGTTTTACCCAATGCAAATACAAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACtaaaatgctaaaaaaataaaaagctaatggtttttcctcaacccataaaaataaaaaaaaaaaaaaaaaaaacaaaacaaaaG
  5   1   2       add Ov1                             IMAGE:8330490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ttGTATCCNGTTTTACCCNNTGCCTATACCAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACtaaaatgctaaaaaaataaaaaGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACAGAAACAATTCATTCACTGTATGTATTAAAACATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCAATACAAATATATTAGCTTTGAAACCTTTAAAAAGCATTACAATTAATAGCAATTTTGGTGAATGACAATCAATAAAACCAATCGTGGTAATTTTAACTAGaaaaataaaaaataaaGGGCTGCAACATTATAATAATTCATAATAGGTCCAAAACAATAAATAATCAAAATTTATATGATCAAGTTGTACCATACTGAATTATTATTATAACAAATCATTGACCCACTCTTTTTTCTACTATATTAGAGAAAAGCAATCACTTATATAATTAAAATAAAATTTAATTTTTTCTTAAATTAG
  3   1   2       bld Gas8                            IMAGE:3516541.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTAAAATTATAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTCCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGA
  3   1   2       bld Emb1      in                    IMAGE:3402316.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGCAATGTTCTAACAATTATGTATCCTCCATTTAACTATCTTAAAATTGGATGGTACAATTGTAATGTAAATAGGGTACTGAACTGTAGACTACATTTATGTTCTGTTACTTGTAAGATTTGGTTAAAACTGTACAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAGCATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCGTGGTAATTTAAACCAGAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4175121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTTACTAAAATGCTAAAAAAATAAAAAGCTAATGGTTTTTCCTCTATCCTGATTTCCTCCTTATGTGGCTTATGGCGTTTCTTTTACCACTGTAACAATTCATTCGCTGTATGTATTAAAGCATGGTGAAACATTTGAGCATTGGGTTTTAATATGTTAAGATTTGCTATACCATTATTTTAGCTTTGAAACCTTTAAAAGGCATTACAGTTAAGTGCTATTTTGGTGAATGACACTCAATAAATCAAACCATGGTAATTTAAACCAGAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)